We have analyzed a series of 5' deletions of the RAS2 gene to investigate its complex transcriptional regulation in the yeast Saccharomyces cerevisiae. Two positive transcriptional regulatory elements were identified. Element A regulates two of the three clusters of RAS2 transcripts. This element is capable of activating a heterologous promoter and contains two copies of the sequence CCTCGCCCC. Although one copy is sufficient for partial transcriptional activation, both copies are required for maximal RAS2 induction. Deletion of one copy resulted in a reduced level of RAS2 mRNA, selective loss of cluster II transcripts and reduced ability to activate the heterologous CYC1 promoter. Each of the 9 bp C rich repeats of element A is part of a sequence with extensive homology to a transcriptional regulatory element upstream of the human epidermal growth factor receptor (EGFR) gene. Element B contains a tandem duplication of a 21 nucleotide sequence TACATATATATATATCTTAG and activates cluster I RAS2 transcripts in the absence of Element A. The physiological role of these deletions was determined by assaying their ability to support growth on a nonfermentable carbon source. RAS2 promoter deletions containing either element A or B were able to overcome this growth defect characteristic of ras2 mutants cells. Deletion of both elements resulted in an insufficient amount of RAS2 protein for growth on a non-fermentable carbon source.

• PMID: 2198534
• DOI full text
• PMC full text
• PubMed
• PubTator

Reference Type

Journal Article | Research Support, Non-U.S. Gov't

Authors

Lisziewicz J, Brown J, Breviario D, Sreenath T, Ahmed N, Koller R, Dhar R

Primary Lit For

Additional Lit For

Review For