Reference: Sor F and Fukuhara H (1982) Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast. Nucleic Acids Res 10(5):1625-33

Reference Help

Abstract


The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.

Reference Type
Journal Article | Research Support, Non-U.S. Gov't
Authors
Sor F, Fukuhara H
Primary Lit For
Additional Lit For
Review For

Gene Ontology Annotations


Increase the total number of rows showing on this page using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table.

Gene/Complex Qualifier Gene Ontology Term Aspect Annotation Extension Evidence Method Source Assigned On Reference

Phenotype Annotations


Increase the total number of rows showing on this page using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table; click on the small "i" buttons located within a cell for an annotation to view further details.

Gene Phenotype Experiment Type Mutant Information Strain Background Chemical Details Reference

Disease Annotations


Increase the total number of rows showing on this page using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table.

Gene Disease Ontology Term Qualifier Evidence Method Source Assigned On Reference

Regulation Annotations


Increase the total number of rows displayed on this page using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; to filter the table by a specific experiment type, type a keyword into the Filter box (for example, “microarray”); download this table as a .txt file using the Download button or click Analyze to further view and analyze the list of target genes using GO Term Finder, GO Slim Mapper, or SPELL.

Regulator Target Direction Regulation Of Happens During Method Evidence

Post-translational Modifications


Increase the total number of rows showing on this page by using the pull-down located below the table, or use the page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table.

Site Modification Modifier Reference

Interaction Annotations


Genetic Interactions

Increase the total number of rows showing on this page by using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table; click on the small "i" buttons located within a cell for an annotation to view further details about experiment type and any other genes involved in the interaction.

Interactor Interactor Allele Assay Annotation Action Phenotype SGA score P-value Source Reference

Physical Interactions

Increase the total number of rows showing on this page by using the pull-down located below the table, or use the page scroll at the table's top right to browse through the table's pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table; click on the small "i" buttons located within a cell for an annotation to view further details about experiment type and any other genes involved in the interaction.

Interactor Interactor Assay Annotation Action Modification Source Reference

Functional Complementation Annotations


Increase the total number of rows showing on this page by using the pull-down located below the table, or use the page scroll at the table's top right to browse through its pages; use the arrows to the right of a column header to sort by that column; filter the table using the "Filter" box at the top of the table.

Gene Species Gene ID Strain background Direction Details Source Reference