Restriction Map of SKI3/YPR189W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

SKI3/YPR189W on chromosome XVI from coordinates 912664 to 916962.


MaeIII Tsp45I AluI Hpy178III* CviJI | Ksp632I* Hpy188I Hin4II* | | BsmAI | MseI | SetI CviJI TspEI | | Eco31I \ \ \ \ \ \ \ \ \ ATGTCGGATATTAAACAGCTATTGAAGGAAGCCAAACAAGAATTGACAAATCGTGACTAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGCCTATAATTTGTCGATAACTTCCTTCGGTTTGTTCTTAACTGTTTAGCACTGATA / / /// / / / / / Hpy188I | ||CviJI CviJI TspEI | | Ksp632I* | ||AluI | Tsp45I | |Hin4II* | MaeIII | SetI Hpy178III* MseI M S D I K Q L L K E A K Q E L T N R D Y C R I L N S Y * R K P N K N * Q I V T M V G Y * T A I E G S Q T R I D K S * L * ----:----|----:----|----:----|----:----|----:----|----:----| X D S I L C S N F S A L C S N V F R S * X T P Y * V A I S P L W V L I S L D H S H R I N F L * Q L F G F L F Q C I T V I Hpy188I | XmnI | | SetI | | | MseI | | | | BinI* | | | | | MaeI | | | | | | MboI | | | | | | XhoII TaqI | | | | | | | DpnI | MboII | | | | | | | |BstKTI | |TspDTI | | | | | | | ||Hpy178III* | || BccI | | | | | | | ||| TspEI \ \\ \ \ \ \ \ \ \ \ \\\ \ GAAGAGACCATCGAAATATCGGAAAAGGTTCTTAAACTAGATCCCGATAATTATTTCGCA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTCTGGTAGCTTTATAGCCTTTTCCAAGAATTTGATCTAGGGCTATTAATAAAGCGT / // / / // // /// / / / Eco31I || | | |XmnI || ||| | | TspEI BsmAI || | | SetI || ||| | Hpy178III* || | Hpy188I || ||| XhoII || BccI || ||| MboI |TaqI || ||DpnI TspDTI || |BstKTI MboII || MaeI |BinI* MseI E E T I E I S E K V L K L D P D N Y F A K R P S K Y R K R F L N * I P I I I S H R D H R N I G K G S * T R S R * L F R T ----:----|----:----|----:----|----:----|----:----|----:----| S S V M S I D S F T R L S S G S L * K A H L S W R F I P F P E * V L D R Y N N R F L G D F Y R F L N K F * I G I I I E C PleI |MlyI MboII ||AluI BbvII* ||CviJI | TaqI |||MaeI MaeI | | HinfI ||||SetI \ \ \ \ \\\\\ CATATTTTTCTAGGGAAAGCACTTTCGAGTCTTCCAGCTAGTAATAATGTCAGTTCAAAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTATAAAAAGATCCCTTTCGTGAAAGCTCAGAAGGTCGATCATTATTACAGTCAAGTTTA / / // / /// / MaeI | || | ||| MaeI | || | ||CviJI | || | ||AluI | || | |PleI | || | |MlyI | || | SetI | || HinfI | |TaqI | BbvII* MboII H I F L G K A L S S L P A S N N V S S N I F F * G K H F R V F Q L V I M S V Q I Y F S R E S T F E S S S * * * C Q F K S ----:----|----:----|----:----|----:----|----:----|----:----| C I K R P F A S E L R G A L L L T L E F V Y K E L S L V K S D E L * Y Y H * N L M N K * P F C K R T K W S T I I D T * I BbvI | GsuI | Eco57MI | |MaeII | |AflIII | ||BsaAI | ||| SetI Hpy188I | ||| TaiI | NlaIV | ||| | AciI | |BssKI | ||| | | TseI | |EcoRII | ||| | | NspBII* | || ScrFI AluI | ||| | | |BisI | || BseBI CviJI | ||| | | ||BlsI | || |SetI | SetI | ||| | | ||| TspEI Hpy178III* \ \\ \\ \ \ \ \\\ \ \ \\\ \ \ CGGAACCTGGAGAGAGCTACTAATCATTACGTGTCCGCTGCCAAATTAGTTCCTGATAAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GCCTTGGACCTCTCTCGATGATTAGTAATGCACAGGCGACGGTTTAATCAAGGACTATTG / / / / / / / / // / //// / / / | | | | | CviJI | | || | |||TseI TspEI | SetI | | | | | AluI | | || | ||BisI Hpy178III* | | | | SetI | | || | |BlsI | | | EcoRII | | || | NspBII* | | | BssKI | | || | AciI | | BseBI | | || AflIII | | ScrFI | | |MaeII | NlaIV | | BsaAI | SetI | TaiI Hpy188I | SetI | BbvI Eco57MI GsuI R N L E R A T N H Y V S A A K L V P D N G T W R E L L I I T C P L P N * F L I T E P G E S Y * S L R V R C Q I S S * * P ----:----|----:----|----:----|----:----|----:----|----:----| R F R S L A V L * * T D A A L N T G S L D S G P S L * * D N R T R Q W I L E Q Y P V Q L S S S I M V H G S G F * N R I V CspCI | BseMII | |BspCNI | ||BslFI | ||| MnlI | ||| | Hin4I | ||| | |DdeI | ||| | || TspRI SetI Hin4I | ||| | || | SetI \ \ \ \\\ \ \\ \ \ CTTTTAGCGTGGAAAGGACTTTTTCTCTTATTTAGAACCACTGAGGTTGTCCCAGACATA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAATCGCACCTTTCCTGAAAAAGAGAATAAATCTTGGTGACTCCAACAGGGTCTGTAT / / // // / // / Hin4I | || || | |DdeI CspCI | || || | SetI | || || BslFI | || |TspRI | || Hin4I | || MnlI | |BspCNI | BseMII CspCI L L A W K G L F L L F R T T E V V P D I F * R G K D F F S Y L E P L R L S Q T Y F S V E R T F S L I * N H * G C P R H T ----:----|----:----|----:----|----:----|----:----|----:----| R K A H F P S K R K N L V V S T T G S M G K L T S L V K E R I * F W Q P Q G L C K * R P F S K K E * K S G S L N D W V Y SetI TspDTI | CfrI MseI | | BalI HgaI | | CviJI |Bce83I* CspCI SspI | | HaeIII CviRI* |AhaIII* \ \ \ \ \ \ \\ CTTTCGTATGATGAATATTTTGACCTGTGTGGCCAATATGCAGACGCACTTTTAAAGCAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAGCATACTACTTATAAAACTGGACACACCGGTTATACGTCTGCGTGAAAATTTCGTC / / / / / / / // / SspI | TspDTI | CfrI CviRI* | || HgaI SetI HaeIII | |MseI CviJI | AhaIII* BalI Bce83I* L S Y D E Y F D L C G Q Y A D A L L K Q F R M M N I L T C V A N M Q T H F * S R F V * * I F * P V W P I C R R T F K A G ----:----|----:----|----:----|----:----|----:----|----:----| S E Y S S Y K S R H P W Y A S A S K F C V K T H H I N Q G T H G I H L R V K L A K R I I F I K V Q T A L I C V C K * L L Tsp4CI* BseGI | SmlI TspEI | Hpy178III* | | BsmAI | FokI | | SfaNI \ \ \ \ \ \ \ \ GAACAGTCTCAAGTAGAACTAATAAATGACATAAAATTACTAAAGAAAACGCATCCAGAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTCAGAGTTCATCTTGATTATTTACTGTATTTTAATGATTTCTTTTGCGTAGGTCTA / / / / / / / Tsp4CI* | BsmAI | FokI BseGI Hpy178III* SmlI TspEI E Q S Q V E L I N D I K L L K K T H P D N S L K * N * * M T * N Y * R K R I Q I T V S S R T N K * H K I T K E N A S R L ----:----|----:----|----:----|----:----|----:----|----:----| S C D * T S S I F S M F N S F F V C G S P V T E L L V L L H C L I V L S F A D L F L R L Y F * Y I V Y F * * L F R M W I BssKI EcoRII |SecI* ||ScrFI ||BseBI CviJI |||SetI AciI \ \\\\ \ TGTCAAAAAGCCTTTTATCAGCATTTGAAACCTGGGTCGCTAATGGCGGAAACTATTGGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| ACAGTTTTTCGGAAAATAGTCGTAAACTTTGGACCCAGCGATTACCGCCTTTGATAACCA / / / / / / / SfaNI CviJI | | EcoRII AciI EciI | | BssKI | | SecI* | BseBI | ScrFI SetI C Q K A F Y Q H L K P G S L M A E T I G V K K P F I S I * N L G R * W R K L L V S K S L L S A F E T W V A N G G N Y W S ----:----|----:----|----:----|----:----|----:----|----:----| Q * F A K * * C K F G P D S I A S V I P N D F L R K D A N S V Q T A L P P F * Q T L F G K I L M Q F R P R * H R F S N T BssKI SecI* EcoRII | ScrFI MseI Tsp4CI* EciI | BseBI HgaI PsiI | SspI \ \ \ \ \ \ \ CGTCATCTATCTACACCCCAGGACGCTTTATTAAATCTTATAAAGATACTGTCTAATATT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GCAGTAGATAGATGTGGGGTCCTGCGAAATAATTTAGAATATTTCTATGACAGATTATAA /// / / / / / ||EcoRII | | PsiI Tsp4CI* SspI ||BssKI | HgaI |SecI* MseI BseBI ScrFI R H L S T P Q D A L L N L I K I L S N I V I Y L H P R T L Y * I L * R Y C L I L S S I Y T P G R F I K S Y K D T V * Y * ----:----|----:----|----:----|----:----|----:----|----:----| R * R D V G W S A K N F R I F I S D L I D D D I * V G P R K I L D * L S V T * Y T M * R C G L V S * * I K Y L Y Q R I N AluI BinI* CviJI SetI |MaeI | TspGWI MseI ||SetI | | DdeI SetI ||| MboI Hin4I | | |Eam1105I | Hin4I ||| | DpnI Hin4I | | || Hpy188I | Hin4I ||| | |BstKTI \ \ \ \\ \ \ \ \\\ \ \\ GAAACAACGGAAATAGGTAAGACCCTTAGTCAGAACAGGTTAAAACTAAAAGCTAGTGAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGTTGCCTTTATCCATTCTGGGAATCAGTCTTGTCCAATTTTGATTTTCGATCACTA / / / / / / / / / / // / // Hin4I SetI | | | | | | MseI | || | |DpnI Hin4I | | | | | Hin4I | || | BstKTI | | | | | Hin4I | || MaeI | | | | SetI | |BinI* | | | Hpy188I | CviJI | | DdeI | AluI | Eam1105I SetI TspGWI E T T E I G K T L S Q N R L K L K A S D K Q R K * V R P L V R T G * N * K L V I N N G N R * D P * S E Q V K T K S * * S ----:----|----:----|----:----|----:----|----:----|----:----| S V V S I P L V R L * F L N F S F A L S Q F L P F L Y S G * D S C T L V L L * H F C R F Y T L G K T L V P * F * F S T I BssKI Hpy178III* EcoRII TspEI Hpy188I | TspEI |SecI* | MseI | TspEI | | MseI ApoI ||ScrFI | | ApoI | | MboI | | TspDTI TspEI ||BseBI | | TspEI | | BclI \ \ \ \ \\\ \ \ \ \ \ \ CCTGATTATCAAATTAAACTAAATTCATTCTCCTGGGAAATAATTAAAAATTCAGAAATT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTAATAGTTTAATTTGATTTAAGTAAGAGGACCCTTTATTAATTTTTAAGTCTTTAA / / / // / / / // // / | | | |MseI TspEI | EcoRII |MseI || TspEI | | | TspEI ApoI | BssKI TspEI |Hpy188I | | TspDTI | SecI* TspEI | Hpy178III* BseBI ApoI MboI ScrFI P D Y Q I K L N S F S W E I I K N S E I L I I K L N * I H S P G K * L K I Q K L * L S N * T K F I L L G N N * K F R N * ----:----|----:----|----:----|----:----|----:----|----:----| G S * * I L S F E N E Q S I I L F E S I D Q N D F * V L N M R R P F L * F N L F R I I L N F * I * E G P F Y N F I * F N MboI DpnI | DpnI TspEI |BstKTI BsrI SspI | |BstKTI | TsoI \\ \ \ \ \\ \ \ GATCAGTTATACAACCAGTTGGTAAATATTCTCGCTGACGATCAAAAGAGAAGTGAAATT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGTCAATATGTTGGTCAACCATTTATAAGAGCGACTGCTAGTTTTCTCTTCACTTTAA // / / / // / / / || BclI BsrI SspI || MboI | TspEI || MboI |DpnI TsoI |DpnI BstKTI BstKTI D Q L Y N Q L V N I L A D D Q K R S E I I S Y T T S W * I F S L T I K R E V K L S V I Q P V G K Y S R * R S K E K * N * ----:----|----:----|----:----|----:----|----:----|----:----| S * N Y L W N T F I R A S S * F L L S I Q D T I C G T P L Y E R Q R D F S F H F I L * V V L Q Y I N E S V I L L S T F N AciI BisI |BlsI TfiI ||TauI BsrI TspRI HinfI ||NspBII* BseGI \ \ \ \\\ \ GAGAACCAGTGGTTAGAATATAGAATCAAAGTGCTAAAATCAATGCCGCTGGATGTAAAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTGGTCACCAATCTTATATCTTAGTTTCACGATTTTAGTTACGGCGACCTACATTTT / / //// / TspRI HinfI |||| BseGI BsrI TfiI |||NspBII* |||AciI ||BisI |BlsI TauI E N Q W L E Y R I K V L K S M P L D V K R T S G * N I E S K C * N Q C R W M * K E P V V R I * N Q S A K I N A A G C K K ----:----|----:----|----:----|----:----|----:----|----:----| S F W H N S Y L I L T S F D I G S S T F Q S G T T L I Y F * L A L I L A A P H L L V L P * F I S D F H * F * H R Q I Y F Hpy178III* TfiI FokI | MseI MnlI TaqI HinfI \ \ \ \ \ \ AAAGATTTTTTCACGAAAGTTAAGGAAATGGTCGAGGATATGGTTCTTGTGAATCATCAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTAAAAAAGTGCTTTCAATTCCTTTACCAGCTCCTATACCAAGAACACTTAGTAGTT / / / / / / FokI | | MnlI TaqI HinfI | MseI TfiI Hpy178III* K D F F T K V K E M V E D M V L V N H Q K I F S R K L R K W S R I W F L * I I N R F F H E S * G N G R G Y G S C E S S I ----:----|----:----|----:----|----:----|----:----|----:----| F S K K V F T L S I T S S I T R T F * * F L N K * S L * P F P R P Y P E Q S D D F I K E R F N L F H D L I H N K H I M L MboI BglII XhoII | DpnI | |BstKTI Cac8I | ||Hpy178III* | FatI | ||| SfaNI | CviRI* | ||| | MboII | |CviAII | ||| | |FatI | ||MwoI TaqI | ||| | ||CviAII | ||| NlaIII AsuII | ||| | ||| NlaIII \ \\\ \ \ \ \\\ \ \\\ \ TCTTTGCTTGCATGGCAAAAGTATTTCGAATGGACAGATTACGAAGATCTGGACAACATG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAACGAACGTACCGTTTTCATAAAGCTTACCTGTCTAATGCTTCTAGACCTGTTGTAC /// // / // / / /// // ||| |FatI AsuII || | | ||| |FatI ||| CviAII TaqI || | | ||| CviAII ||CviRI* || | | ||NlaIII ||NlaIII || | | |SfaNI |MwoI || | | MboII Cac8I || | Hpy178III* || XhoII || BglII || MboI |DpnI BstKTI S L L A W Q K Y F E W T D Y E D L D N M L C L H G K S I S N G Q I T K I W T T W F A C M A K V F R M D R L R R S G Q H G ----:----|----:----|----:----|----:----|----:----|----:----| D K S A H C F Y K S H V S * S S R S L M I K A Q M A F T N R I S L N R L D P C C R Q K C P L L I E F P C I V F I Q V V H BinI* | MboI | XhoII | | DpnI | | |BstKTI | | || CfrI | | || |BinI* | | || ||BalI | | || ||CviJI | | || ||HaeIII | | || |||FatI TatI | | || ||||CviAII |Csp6I | | || ||||| MboI ||RsaI | | || ||||| |NlaIII ||ScaI ApoI | | || ||||| ||DpnI BseGI FokI ||| MseI TspEI | | || ||||| |||BstKTI \ \ \\\ \ \ \ \ \\ \\\\\ \\\\ GATGCCCCATTGATAATAAAGTACTTTAAGAAATTTCCTAAAGATCCATTGGCCATGATC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTACGGGGTAACTATTATTTCATGAAATTCTTTAAAGGATTTCTAGGTAACCGGTACTAG / / /// / / / // / /// /// / BseGI FokI ||| MseI | | || XhoII ||| ||| MboI ||TatI | | || MboI ||| ||DpnI |Csp6I | | |DpnI ||| |BstKTI ScaI | | BstKTI ||| |FatI RsaI | BinI* ||| CviAII TspEI ||CfrI ApoI |NlaIII HaeIII CviJI BinI* BalI D A P L I I K Y F K K F P K D P L A M I M P H * * * S T L R N F L K I H W P * S C P I D N K V L * E I S * R S I G H D P ----:----|----:----|----:----|----:----|----:----|----:----| S A G N I I F Y K L F N G L S G N A M I P H G M S L L T S * S I E * L D M P W S I G W Q Y Y L V K L F K R F I W Q G H D BssKI EcoRII | ScrFI | BseBI | |MnlI MnlI TfiI | || CviJI |TaqI MseI HinfI CviJI \ \\ \ \\ \ \ \ CTCTATTCCTGGCTTTCCTCAAAACTATCGAAATATGATATTAAAAGTTTGGAATCGGCT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GAGATAAGGACCGAAAGGAGTTTTGATAGCTTTATACTATAATTTTCAAACCTTAGCCGA // / / / / / / || EcoRII | TaqI MseI | CviJI || BssKI MnlI HinfI || CviJI TfiI |BseBI |ScrFI MnlI L Y S W L S S K L S K Y D I K S L E S A S I P G F P Q N Y R N M I L K V W N R L L F L A F L K T I E I * Y * K F G I G * ----:----|----:----|----:----|----:----|----:----|----:----| R * E Q S E E F S D F Y S I L L K S D A G R N R A K R L V I S I H Y * F N P I P E I G P K G * F * R F I I N F T Q F R S Hin4II* | SetI | |BsiYI* Hin4II* | || CviJI | Eco57I TspGWI BsmAI | || HaeIII | Eco57MI | MseI | BseGI \ \\ \ \ \ \ \ \ \ AATAAACCACCTGAAGGCCATAAAAAGACGGAGAAGGAAACAGATATTAAGGATGTAGAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTGGTGGACTTCCGGTATTTTTCTGCCTCTTCCTTTGTCTATAATTCCTACATCTA / / / / / / / / / / | | BsiYI* HaeIII | Eco57MI TspGWI MseI | BsmAI | SetI CviJI | Eco57I BseGI Hin4II* Hin4II* N K P P E G H K K T E K E T D I K D V D I N H L K A I K R R R R K Q I L R M * M * T T * R P * K D G E G N R Y * G C R * ----:----|----:----|----:----|----:----|----:----|----:----| L L G G S P W L F V S F S V S I L S T S * Y V V Q L G Y F S P S P F L Y * P H L I F W R F A M F L R L L F C I N L I Y I MseI | MboII | |TspDTI MseI | ||MboI | MboII | ||| DpnI | | MboI | ||| |BstKTI | | | DpnI | ||| || TspDTI | | | |BstKTI FokI | ||| || FnuDII* | | | || TspDTI \ \ \\\ \\ \ \ \ \ \\ \ GAGACAAATGAAGATGAAGTTAAAGATCGCGTTGAAGATGAAGTTAAAGATCGTGTTGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTGTTTACTTCTACTTCAATTTCTAGCGCAACTTCTACTTCAATTTCTAGCACAACTT / // ///// // //// FokI || ||||FnuDII* || |||MboI || |||MboI || ||TspDTI || ||TspDTI || |DpnI || |DpnI || BstKTI || BstKTI |MseI |MseI MboII TspDTI MboII E T N E D E V K D R V E D E V K D R V E R Q M K M K L K I A L K M K L K I V L K D K * R * S * R S R * R * S * R S C * R ----:----|----:----|----:----|----:----|----:----|----:----| S V F S S S T L S R T S S S T L S R T S H S L H L H L * L D R Q L H L * L D H Q L C I F I F N F I A N F I F N F I T N F MboII | MboI | | DpnI MboII | | |MnlI |SetI | | |BstKTI |BbvII* | | ||Hpy178III* FalI |TspDTI | | |||TspDTI FalI || MboII | | ||||MnlI | BseRI MboII || | MboII \ \ \\\\\ \ \ \ \\ \ \ GATGAAGTCAAAGATCAAGATGAGGAGGCAAAGGAAGATGAAGAAGAAGACCTTGATGAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTCAGTTTCTAGTTCTACTCCTCCGTTTCCTTCTACTTCTTCTTCTGGAACTACTA / ////// / / / / / / / | |||||Hpy178III* FalI BseRI | | | | BbvII* | ||||MnlI FalI | | | | MboII | |||MboI | | | MboII | ||TspDTI | | TspDTI | |DpnI | | MboII | |MnlI | SetI | BstKTI MboII MboII D E V K D Q D E E A K E D E E E D L D D M K S K I K M R R Q R K M K K K T L M I * S Q R S R * G G K G R * R R R P * * Y ----:----|----:----|----:----|----:----|----:----|----:----| S S T L S * S S S A F S S S S S S R S S L H L * L D L H P P L P L H L L L G Q H I F D F I L I L L C L F I F F F V K I I SetI |MaeIII |Tsp45I TspEI || MboII | FalI Ksp632I* || | Tsp4CI* | FalI MnlI |MnlI || | | TspRI TspGWI \ \ \ \\ \\ \ \ \ \ ATAGAAATTGGTTTATTAGAGGAAGAGGTTGTCACTGTATTGACGGAGAATATCGTAAAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TATCTTTAACCAAATAATCTCCTTCTCCAACAGTGACATAACTGCCTCTTATAGCATTTT / / / / / / / / / / FalI | MnlI | | SetI | | Tsp4CI* TspGWI FalI TspEI | Ksp632I* | | Tsp45I MnlI | | MaeIII | MboII TspRI I E I G L L E E E V V T V L T E N I V K * K L V Y * R K R L S L Y * R R I S * N R N W F I R G R G C H C I D G E Y R K M ----:----|----:----|----:----|----:----|----:----|----:----| I S I P K N S S S T T V T N V S F I T F Y L F Q N I L P L P Q * Q I S P S Y R L Y F N T * * L F L N D S Y Q R L I D Y F DdeI | Hin6I StyI | |GlaI BsmI SecI* BtgZI | ||HhaI | SfaNI SspI SetI | MnlI \ \ \\\ \ \ \ \ \ \ TGTAAAAATAATATCTTAGCGCATCGCATTCTTTGTCAATATTACCTACTGACCAAGGAG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| ACATTTTTATTATAGAATCGCGTAGCGTAAGAAACAGTTATAATGGATGACTGGTTCCTC / //// / / / / // BtgZI |||| BsmI SfaNI | SetI |SecI* |||Hin6I SspI |StyI ||GlaI MnlI |HhaI DdeI C K N N I L A H R I L C Q Y Y L L T K E V K I I S * R I A F F V N I T Y * P R S * K * Y L S A S H S L S I L P T D Q G V ----:----|----:----|----:----|----:----|----:----|----:----| H L F L I K A C R M R Q * Y * R S V L S I Y F Y Y R L A D C E K D I N G V S W P T F I I D * R M A N K T L I V * Q G L L TseI |BisI ||BlsI AsuI* |||AluI AvaII |||CviJI MseI DraII |||| SetI BbvI |TspEI PpuMI \\\\ \ \ \\ \ TATGAGGCAGCTTTACCATACATCAAAAATGGTATTTCTTTAATTGCCTATAATATAAAG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTCCGTCGAAATGGTATGTAGTTTTTACCATAAAGAAATTAACGGATATTATATTTC /// / / / ||CviJI BbvI | TspEI ||TseI MseI ||AluI |BisI BlsI SetI Y E A A L P Y I K N G I S L I A Y N I K M R Q L Y H T S K M V F L * L P I I * R * G S F T I H Q K W Y F F N C L * Y K G ----:----|----:----|----:----|----:----|----:----|----:----| Y S A A K G Y M L F P I E K I A * L I F T H P L K V M C * F H Y K K L Q R Y Y L I L C S * W V D F I T N R * N G I I Y L BmgT120I |BssKI |EcoRII ||SecI* TsoI |||ScrFI | Hpy178III* |||BseBI Csp6I ApoI | | CviJI ||||SetI |RsaI MseI TspEI | | | Tsp4CI* \\\\\ \\ \ \ \ \ \ \ GACCTGGGGGTACATTTGCCATTAACAAAAAGAGAATTTTCTCTGGATTTGGCTACCGTT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGACCCCCATGTAAACGGTAATTGTTTTTCTCTTAAAAGAGACCTAAACCGATGGCAA /// / / // / / / / / ||| | | |Csp6I MseI TspEI | | Tsp4CI* ||| | | RsaI ApoI | CviJI ||| | EcoRII TsoI Hpy178III* ||| | BssKI ||| | SecI* ||| BseBI ||| ScrFI ||PpuMI ||DraII ||AvaII ||AsuI* |BmgT120I SetI D L G V H L P L T K R E F S L D L A T V T W G Y I C H * Q K E N F L W I W L P F P G G T F A I N K K R I F S G F G Y R L ----:----|----:----|----:----|----:----|----:----|----:----| S R P T C K G N V F L S N E R S K A V T P G P P V N A M L L F L I K E P N P * R V Q P Y M Q W * C F S F K R Q I Q S G N TseI BbvI |BisI | AsuI* ||BlsI SfaNI | AvaII |||CviRI* | NdeI TaqI | |BmgT120I |||| MseI \ \ \ \ \\ \\\\ \ TATACATATGTCGATGCCCCAAAGGACCACAATGCTGCATTAAAGTTATATGATAACATT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| ATATGTATACAGCTACGGGGTTTCCTGGTGTTACGACGTAATTTCAATATACTATTGTAA // / /// /// / |NdeI TaqI ||AvaII ||| MseI SfaNI ||AsuI* ||CviRI* |BmgT120I ||TseI BbvI |BisI BlsI Y T Y V D A P K D H N A A L K L Y D N I I H M S M P Q R T T M L H * S Y M I T F Y I C R C P K G P Q C C I K V I * * H F ----:----|----:----|----:----|----:----|----:----|----:----| * V Y T S A G F S W L A A N F N Y S L M K Y M H R H G L P G C H Q M L T I H Y C I C I D I G W L V V I S C * L * I I V N BetI* SetI |HpaII HphI | TspEI \\ \ \ \ TTATCCGGTGATTTTAGTAATATACAAGCAAAAATGGGCAAAGGTATAATTTTTATTGAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AATAGGCCACTAAAATCATTATATGTTCGTTTTTACCCGTTTCCATATTAAAAATAACTT // / / / |BetI* HphI SetI TspEI HpaII L S G D F S N I Q A K M G K G I I F I E Y P V I L V I Y K Q K W A K V * F L L K I R * F * * Y T S K N G Q R Y N F Y * K ----:----|----:----|----:----|----:----|----:----|----:----| K D P S K L L I C A F I P L P I I K I S K I R H N * Y Y V L L F P C L Y L K * Q * G T I K T I Y L C F H A F T Y N K N F SetI |FatI SfaNI |CviRI* TspEI ||CviAII Hin4II* BseGI FokI ||| NlaIII TspDTI \ \ \ \\\ \ \ AGGAAAAATTGGAAGGATGCTATGACATTACTAACACAGGTGCATGAACAATCGCCTAAT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTTTTTAACCTTCCTACGATACTGTAATGATTGTGTCCACGTACTTGTTAGCGGATTA / / / / / / // / | TspEI BseGI FokI SetI | |FatI TspDTI | SfaNI | CviAII Hin4II* CviRI* NlaIII R K N W K D A M T L L T Q V H E Q S P N G K I G R M L * H Y * H R C M N N R L I E K L E G C Y D I T N T G A * T I A * * ----:----|----:----|----:----|----:----|----:----|----:----| L F F Q F S A I V N S V C T C S C D G L F S F N S P H * S M V L V P A H V I A * P F I P L I S H C * * C L H M F L R R I Hpy188I | Tsp4CI* | | FatI | | |CviAII CviJI Hpy178III* | | || NlaIII | NdeI MnlI \ \ \ \\ \ \ \ \ AATCTGGAAGTTTTATCTGAACTGTCATGGAGTAAAGCCCATATGGGTTATATGGACGAG 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGACCTTCAAAATAGACTTGACAGTACCTCATTTCGGGTATACCCAATATACCTGCTC / / / / // / / / Hpy178III* | | | |FatI CviJI NdeI MnlI | | | CviAII | | NlaIII | Tsp4CI* Hpy188I N L E V L S E L S W S K A H M G Y M D E I W K F Y L N C H G V K P I W V I W T R S G S F I * T V M E * S P Y G L Y G R G ----:----|----:----|----:----|----:----|----:----|----:----| L R S T K D S S D H L L A W I P * I S S Y D P L K I Q V T M S Y L G Y P N Y P R I Q F N * R F Q * P T F G M H T I H V L AluI CviJI | SetI MaeII | Cac8I | SetI | | CviJI | TaiI | | |DdeI Tsp4CI* SetI | |TaqI \ \ \\ \ \ \ \\ GCATTAGCTGGCTTAGATACTGTCATCAAGGGTATCAAAGGTATGGATTTACGTTCGATA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAATCGACCGAATCTATGACAGTAGTTCCCATAGTTTCCATACCTAAATGCAAGCTAT / / / / / / / / / / | | | | DdeI Tsp4CI* SetI | | TaqI | | | CviJI | MaeII | | Cac8I TaiI | CviJI SetI | AluI SetI A L A G L D T V I K G I K G M D L R S I H * L A * I L S S R V S K V W I Y V R * I S W L R Y C H Q G Y Q R Y G F T F D R ----:----|----:----|----:----|----:----|----:----|----:----| A N A P K S V T M L P I L P I S K R E I P M L Q S L Y Q * * P Y * L Y P N V N S C * S A * I S D D L T D F T H I * T R Y FatI |CviAII ||Cac8I ||| SphI Hpy188I ||| NspI | MseI Cac8I ||| NlaIII | | MnlI | CviJI Hpy166II ||| | SfaNI \ \ \ \ \ \ \\\ \ \ GATTTCAGAGCATTAAACTTATGGAGGCAAGCCAAAGTTTACATTATGAAGCATGCTTCC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAAGTCTCGTAATTTGAATACCTCCGTTCGGTTTCAAATGTAATACTTCGTACGAAGG / // / / / / /// / Hpy188I |MnlI | CviJI Hpy166II | ||| TspDTI MseI Cac8I | ||FatI | |CviAII | Cac8I NlaIII NspI SphI D F R A L N L W R Q A K V Y I M K H A S I S E H * T Y G G K P K F T L * S M L P F Q S I K L M E A S Q S L H Y E A C F H ----:----|----:----|----:----|----:----|----:----|----:----| S K L A N F K H L C A L T * M I F C A E L N * L M L S I S A L W L K C * S A H K I E S C * V * P P L G F N V N H L M S G Hin6I |GlaI |MstI* MaeII |FspAI TspDTI | SetI ||BsmI Hpy188I |MseI | TaiI ||HhaI TspEI | MseI \\ \ \ \\\ \ \ \ ATTAACGATGCTAAACAGGAAAACGTCAAGTGCGCATTCAAATTACTCATTCAGAGTATT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTGCTACGATTTGTCCTTTTGCAGTTCACGCGTAAGTTTAATGAGTAAGTCTCATAA / / / / /// / / / / | MseI | MaeII ||Hin6I TspEI | | BsaXI SfaNI TaiI |FspAI | TstI SetI |MstI* Hpy188I |GlaI HhaI BsmI I N D A K Q E N V K C A F K L L I Q S I L T M L N R K T S S A H S N Y S F R V L * R C * T G K R Q V R I Q I T H S E Y * ----:----|----:----|----:----|----:----|----:----|----:----| M L S A L C S F T L H A N L N S M * L I W * R H * V P F R * T R M * I V * E S Y N V I S F L F V D L A C E F * E N L T N PfoI BssKI TstI | HpaII TaqI BsrI BsaXI | ScrFI | BsaXI TspRI | SspI | CauII* | | TstI | BfiI \ \ \ \ \ \ \ \ \ AAAATATTGGACACTTTTGCTCCCGGATTTTCGACACTGGGCGATATTTATTGCCACTAT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTATAACCTGTGAAAACGAGGGCCTAAAAGCTGTGACCCGCTATAAATAACGGTGATA / / /// / // / / | SspI ||| | |TaqI BsrI BfiI MseI ||| | TspRI ||| BsaXI ||| TstI ||BssKI ||PfoI |HpaII CauII* ScrFI K I L D T F A P G F S T L G D I Y C H Y K Y W T L L L P D F R H W A I F I A T I N I G H F C S R I F D T G R Y L L P L L ----:----|----:----|----:----|----:----|----:----|----:----| L I N S V K A G P N E V S P S I * Q W * * F I P C K Q E R I K S V P R Y K N G S F Y Q V S K S G S K R C Q A I N I A V I Hin4II* | BcgI | | BdaI | | BdaI | | |HindIII | | || AluI | | || CviJI | | || | SetI | | || | SfaNI | | || | | TaqI | | || | | |MboI BsiYI* | | || | | || DpnI | AsuI* | | || | | || |FauI | DraII | | || | | || |BstKTI PsiI | |BmgT120I | | || | | || ||Hpy178III* |BdaI | ||CviJI | | || | | || ||| AciI |BdaI MnlI | ||HaeIII | | || | | || ||| | BseGI \\ \ \ \\\ \ \ \\ \ \ \\ \\\ \ \ TATAAAGACCATTTGAGGGCCTTCAAATGTTATTTCAAAGCTTTCGATCTGGATGCGGGG 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTTCTGGTAAACTCCCGGAAGTTTACAATAAAGTTTCGAAAGCTAGACCTACGCCCC // / / // / / / / / / // /// / / |PsiI MnlI BsiYI* |DraII | | | | | | || ||| | AciI BdaI |AsuI* | | | | | | || ||| BseGI BdaI BmgT120I | | | | | | || ||Hpy178III* HaeIII | | | | | | || |FauI CviJI | | | | | | || MboI | | | | | | |DpnI | | | | | | BstKTI | | | | | | SfaNI | | | | | | TaqI | | | | | HindIII | | | | CviJI | | | | AluI | | | SetI | | BdaI | | BdaI | BcgI Hin4II* Y K D H L R A F K C Y F K A F D L D A G I K T I * G P S N V I S K L S I W M R G * R P F E G L Q M L F Q S F R S G C G G ----:----|----:----|----:----|----:----|----:----|----:----| * L S W K L A K L H * K L A K S R S A P N Y L G N S P R * I N N * L K R D P H P I F V M Q P G E F T I E F S E I Q I R P CviRI* |EcoP15I ||Cac8I ||| Cac8I ||| | BbvI ||| | CviJI ||| | | MfeI ||| | | TspEI ||| | | | BcgI ||| | | | |BglI ||| | | | |MwoI ||| | | | || BtgZI ||| | | | || | MboII ||| | | | || | Cac8I FokI ||| | | | || | | TseI | BcgI ||| | | | || | | AluI | | TseI ||| | | | || | | CviJI | | |BisI ||| | | | || | | |BisI | | ||BlsI ||| | | | || | | ||BlsI | | ||| BcgI BbvI ||| | | | || | | ||SetI \ \ \\\ \ \ \\\ \ \ \ \\ \ \ \\\ GATTACACAGCAGCGAAGTATATTACCGAAACTTATGCAAGCAAGCCCAATTGGCAAGCT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CTAATGTGTCGTCGCTTCATATAATGGCTTTGAATACGTTCGTTCGGGTTAACCGTTCGA / / //// / / // / / // / // /// | | |||BcgI BbvI | || | | || | || ||BisI | | ||TseI | || | | || | || |BlsI | | |BisI | || | | || | || CviJI | | BlsI | || | | || | || BtgZI | FokI | || | | || | || AluI BcgI | || | | || | |Cac8I | || | | || | |SetI | || | | || | MboII | || | | || TspEI | || | | || MfeI | || | | |BbvI | || | | BcgI | || | | MwoI | || | | BglI | || | CviJI | || Cac8I | |EcoP15I | Cac8I CviRI* D Y T A A K Y I T E T Y A S K P N W Q A I T Q Q R S I L P K L M Q A S P I G K L L H S S E V Y Y R N L C K Q A Q L A S C ----:----|----:----|----:----|----:----|----:----|----:----| S * V A A F Y I V S V * A L L G L Q C A P N C L L S T Y * R F K H L C A W N A L I V C C R L I N G F S I C A L G I P L S BccI |Hpy178III* || MseI || VspI || |TspEI Hin6I || || MseI |GlaI || || PacI SetI HphI ||HhaI \\ \\ \ \ \ \\\ GCTTCTTCCATCGCTTCAAGATTAATTAAAGGTGAAAAAGCAAAGGCAGAACTGCGCTCA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGAAGGTAGCGAAGTTCTAATTAATTTCCACTTTTTCGTTTCCGTCTTGACGCGAGT / / / / /// / /// TseI | | | ||SetI HphI ||Hin6I | | | |MseI |GlaI | | | TspEI HhaI | | VspI | | PacI | | MseI | Hpy178III* BccI A S S I A S R L I K G E K A K A E L R S L L P S L Q D * L K V K K Q R Q N C A Q F F H R F K I N * R * K S K G R T A L K ----:----|----:----|----:----|----:----|----:----|----:----| A E E M A E L N I L P S F A F A S S R E Q K K W R K L I L * L H F L L P L V A S S R G D S * S * N F T F F C L C F Q A * AsuI* |CviJI BdaI |HaeIII BdaI |BmgT120I | TfiI ||BsrI | HinfI \\\ \ \ AATAACTGGCCCTTTAGGGTCGTAGGGATTGCTCATTTGGAAAAGCAAGAAGAAAGTGAT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTGACCGGGAAATCCCAGCATCCCTAACGAGTAAACCTTTTCGTTCTTCTTTCACTA //// / / |||AsuI* BdaI MboII ||BmgT120I BdaI |HaeIII |CviJI BsrI N N W P F R V V G I A H L E K Q E E S D I T G P L G S * G L L I W K S K K K V I * L A L * G R R D C S F G K A R R K * F ----:----|----:----|----:----|----:----|----:----|----:----| F L Q G K L T T P I A * K S F C S S L S L Y S A R * P R L S Q E N P F A L L F H I V P G K P D Y P N S M Q F L L F F T I MaeII AflIII |BinI* |BsaAI ||BdaI ||BdaI TaqII |||SetI | HinfI |||TaiI | | FatI |||| MboI | | |CviAII |||| |Hin4I | | || NlaIII |||| |Hin4I | | || |PleI |||| ||DpnI | | || ||MlyI MboII |||| |||BstKTI | | || ||| AsuI* \ \\\\ \\\\ \ \ \\ \\\ \ TCTATTGAGTGGTTTCAATCTGCTTTACGTGTTGATCCAAATGATGTAGAGTCATGGGTG 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AGATAACTCACCAAAGTTAGACGAAATGCACAACTAGGTTTACTACATCTCAGTACCCAC / //// / // / / / // / HinfI |||| | || MboI TaqII | || PleI TfiI |||| | |DpnI | || MlyI |||| | BstKTI | |FatI |||| AflIII | CviAII |||MaeII NlaIII |||BinI* HinfI |||Hin4I |||Hin4I ||BsaAI |BdaI |BdaI TaiI SetI S I E W F Q S A L R V D P N D V E S W V L L S G F N L L Y V L I Q M M * S H G W Y * V V S I C F T C * S K * C R V M G G ----:----|----:----|----:----|----:----|----:----|----:----| E I S H N * D A K R T S G F S T S D H T N * Q T T E I Q K V H Q D L H H L T M P R N L P K L R S * T N I W I I Y L * P H BmgT120I |BssKI |CviJI MwoI |EcoRII |MluI |HaeIII |BslFI ||SecI* |AflIII |||ScrFI || FnuDII* |||BseBI || |OliI |||| Hin4I || |MslI |||| Hin4I || || BstXI SfaNI \\\\ \ \\ \\ \ \ GGCCTGGGACAAGCATACCACGCGTGTGGTCGTATAGAAGCATCTATCAAAGTTTTTGAC 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CCGGACCCTGTTCGTATGGTGCGCACACCAGCATATCTTCGTAGATAGTTTCAAAAACTG /// / / / //// / ||| | EcoRII MwoI |||AflIII SfaNI ||| | BssKI |||BslFI ||| | SecI* |||MluI ||| BseBI ||MslI ||| ScrFI ||OliI ||AsuI* |FnuDII* |BmgT120I BstXI |HaeIII |CviJI Hin4I Hin4I G L G Q A Y H A C G R I E A S I K V F D A W D K H T T R V V V * K H L S K F L T P G T S I P R V W S Y R S I Y Q S F * Q ----:----|----:----|----:----|----:----|----:----|----:----| P R P C A Y W A H P R I S A D I L T K S P G P V L M G R T H D Y L L M * * L K Q A Q S L C V V R T T T Y F C R D F N K V TspEI | TspEI | | MseI | | | AsuI* MseI | | | DraII |AhaIII* | | | |CviJI || AluI | | | |HaeIII || CviJI | | | |BmgT120I MnlI || | SetI \ \ \ \\ \ \\ \ \ AAGGCAATTCAATTAAGGCCCTCTCATACTTTTGCCCAATACTTTAAAGCTATTTCTCTA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGTTAAGTTAATTCCGGGAGAGTATGAAAACGGGTTATGAAATTTCGATAAAGAGAT / // /// / /// / | || ||DraII MnlI ||| CviJI | || ||AsuI* ||| AluI | || |BmgT120I ||SetI | || HaeIII |MseI | || CviJI AhaIII* | |MseI | TspEI TspEI K A I Q L R P S H T F A Q Y F K A I S L R Q F N * G P L I L L P N T L K L F L Y G N S I K A L S Y F C P I L * S Y F S M ----:----|----:----|----:----|----:----|----:----|----:----| L A I * N L G E * V K A W Y K L A I E R C P L E I L A R E Y K Q G I S * L * K E L C N L * P G R M S K G L V K F S N R * MaeIII Tsp45I Hpy178III* | MaeII | CviJI | | SetI | |AciI | | TaiI Hpy178III* Hpy178III* | |BisI | | | SetI | HphI | SetI | ||BlsI \ \ \ \ \ \ \ \ \ \\\ TGTGACGTAGGTGAATATCTTGAAAGTTTAGACATTCTGGAAAAGGTATGTCAAGAAGCC 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| ACACTGCATCCACTTATAGAACTTTCAAATCTGTAAGACCTTTTCCATACAGTTCTTCGG / /// / / / / /// | ||SetI Hpy178III* | SetI | ||BisI | |MaeII HphI Hpy178III* | |BlsI | Tsp45I | CviJI | MaeIII | TauI TaiI Hpy178III* SetI C D V G E Y L E S L D I L E K V C Q E A V T * V N I L K V * T F W K R Y V K K P * R R * I S * K F R H S G K G M S R S R ----:----|----:----|----:----|----:----|----:----|----:----| H S T P S Y R S L K S M R S F T H * S A I H R L H I D Q F N L C E P F P I D L L T V Y T F I K F T * V N Q F L Y T L F G TauI PleI |SfeI* |MlyI |Ksp632I* |MboII StyI || HinfI ||TspEI SecI* \\ \ \\\ \ GCTACAGAAGAGTCATTCCAAATTGGTTTAGTGGAAGTGCTTATGAGATGTTCCTTGGAT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| CGATGTCTTCTCAGTAAGGTTTAACCAAATCACCTTCACGAATACTCTACAAGGAACCTA / // / // / / | |SfeI* | |PleI TspEI SecI* | | | |MlyI StyI | | | MboII | | HinfI | Ksp632I* AciI A T E E S F Q I G L V E V L M R C S L D L Q K S H S K L V * W K C L * D V P W I Y R R V I P N W F S G S A Y E M F L G F ----:----|----:----|----:----|----:----|----:----|----:----| A V S S D N W I P K T S T S I L H E K S R * L L T M G F Q N L P L A * S I N R P S C F L * E L N T * H F H K H S T G Q I MfeI TspEI | CviRI* MboI \ \ \ TTATATTCGCAAGGGTTCTTGCTCAAATCAGTTTCAATTGCAAAGGACACTATTGAACGG 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| AATATAAGCGTTCCCAAGAACGAGTTTAGTCAAAGTTAACGTTTCCTGTGATAACTTGCC // / |CviRI* BstKTI TspEI MfeI L Y S Q G F L L K S V S I A K D T I E R Y I R K G S C S N Q F Q L Q R T L L N G I F A R V L A Q I S F N C K G H Y * T D ----:----|----:----|----:----|----:----|----:----|----:----| K Y E C P N K S L D T E I A F S V I S R N I N A L T R A * I L K L Q L P C * Q V * I R L P E Q E F * N * N C L V S N F P SetI | MboI DpnI | XhoII |BstKTI | | DpnI ||Hpy178III* | | |BstKTI ||| BinI* | | || BinI* ||| |TspEI TspEI | | || |SetI ||| || BsaBI | TspRI | | || || BseMII ||| || | TspGWI | |MseI | | || || |BspCNI \\\ \\ \ \ \ \\ \ \ \\ \\ \\ ATCAAGATAATTATCAGTGAATTAAAATGTGAGAACCAACAGGTTTGGATCTACCTTTCA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTCTATTAATAGTCACTTAATTTTACACTCTTGGTTGTCCAAACCTAGATGGAAAGT / / / / / / // / // // // | | | | | TspEI |MseI SetI || || |BspCNI | | | | | TspRI TspEI || || BseMII | | | | TspGWI || || BinI* | | | | BsaBI || |SetI | | | BinI* || XhoII | | Hpy178III* || MboI | MboI |DpnI DpnI BstKTI I K I I I S E L K C E N Q Q V W I Y L S S R * L S V N * N V R T N R F G S T F H Q D N Y Q * I K M * E P T G L D L P F T ----:----|----:----|----:----|----:----|----:----|----:----| I L I I I L S N F H S F W C T Q I * R E S * S L * * H I L I H S G V P K S R G K D L Y N D T F * F T L V L L N P D V K * TatI |Csp6I SetI ||RsaI PleI | TfiI ||ScaI |MlyI | HinfI ||| DdeI HinfI ||SetI | | SpeI \\\ \ \ \\\ \ \ \ CAAGTACTGAGATTATTTATTTGGATAGAGTCAAAGGTTGATACTTTACCTGTTGAATCA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCATGACTCTAATAAATAAACCTATCTCAGTTTCCAACTATGAAATGGACAACTTAGT /// / / / / / / ||| DdeI | | PleI SetI HinfI ||TatI | | MlyI TfiI |Csp6I | SetI ScaI HinfI RsaI Q V L R L F I W I E S K V D T L P V E S K Y * D Y L F G * S Q R L I L Y L L N H S T E I I Y L D R V K G * Y F T C * I T ----:----|----:----|----:----|----:----|----:----|----:----| C T S L N N I Q I S D F T S V K G T S D V L V S I I * K S L T L P Q Y K V Q Q I L Y Q S * K N P Y L * L N I S * R N F * TspEI | TfiI | HinfI | | MboII | | | SalI MaeI | | | |TaqI | BdaI | | | |AccI | BdaI ApoI BdaI | | | ||HindII | | TspEI TspEI TspEI BdaI | | | ||Hpy166II \ \ \ \ \ \ \ \ \ \\\ CTAGTATCAATTTTTGAAAATTCTCAATTTTCTGGTAGTGAAGAAATTGATTCTGTCGAC 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| GATCATAGTTAAAAACTTTTAAGAGTTAAAAGACCATCACTTCTTTAACTAAGACAGCTG /// / / / / / // /// ||SpeI TspEI TspEI TspEI BdaI | || ||SalI |MaeI ApoI BdaI | || |AccI BdaI | || |TaqI BdaI | || Hpy166II | || HindII | |HinfI | |TfiI | MboII TspEI L V S I F E N S Q F S G S E E I D S V D * Y Q F L K I L N F L V V K K L I L S T S I N F * K F S I F W * * R N * F C R Q ----:----|----:----|----:----|----:----|----:----|----:----| S T D I K S F E * N E P L S S I S E T S V L I L K Q F N E I K Q Y H L F Q N Q R * Y * N K F I R L K R T T F F N I R D V TaqI Hin4I Cac8I ClaI TaqI Hin4I BsrDI | CviRI* \ \ \ \ \ \ AATATCAAAATCGATACTTTACTCGATAGCACTACTGATGATAATGTGTCCATTGCGTGC 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TTATAGTTTTAGCTATGAAATGAGCTATCGTGATGACTACTATTACACAGGTAACGCACG / // / /// ClaI |Hin4I BsrDI ||CviRI* TaqI |Hin4I |Hin4I TaqI |Hin4I Cac8I N I K I D T L L D S T T D D N V S I A C I S K S I L Y S I A L L M I M C P L R A Y Q N R Y F T R * H Y * * * C V H C V Q ----:----|----:----|----:----|----:----|----:----|----:----| L I L I S V K S S L V V S S L T D M A H C Y * F R Y K V R Y C * Q H Y H T W Q T I D F D I S * E I A S S I I I H G N R A Hin4I Hin4I | MboI MboI | | DpnI Hpy188I | | |BstKTI | DpnI | | ||DdeI | |BstKTI | | ||| AluI | || ApoI | | ||| CviJI | || TspEI | | ||| | SetI | || |BinI* \ \ \\\ \ \ \ \\ \\ AAGTTTTTGATCTTAGCTTCAAAATATAGTGTTTCGGATCAAAAATTTACAGATATAGCA 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAAAAACTAGAATCGAAGTTTTATATCACAAAGCCTAGTTTTTAAATGTCTATATCGT // / /// / // / / / || | ||CviJI | || MboI | TspEI || | ||AluI | |DpnI | ApoI || | |DdeI | BstKTI BinI* || | SetI Hpy188I || MboI |DpnI BstKTI K F L I L A S K Y S V S D Q K F T D I A S F * S * L Q N I V F R I K N L Q I * Q V F D L S F K I * C F G S K I Y R Y S R ----:----|----:----|----:----|----:----|----:----|----:----| L N K I K A E F Y L T E S * F N V S I A C T K S R L K L I Y H K P D F I * L Y L L K Q D * S * F I T N R I L F K C I Y C Tsp4CI* SetI | AsuI* | DdeI | DraII | | Hpy188I | |BmgT120I | | | AluI | || BsiYI* | | | CviJI | ||CviJI | MnlI | | | TspDTI BspCNI | ||HaeIII | |BsrI | | | | SetI |BseMII \ \\\ \ \\ \ \ \ \ \ \\ GGAACGGTCAGGGCCTCATACTGGTATAATATAGGTATCTCAGAGCTTACTGCTTTCATA 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTGCCAGTCCCGGAGTATGACCATATTATATCCATAGAGTCTCGAATGACGAAAGTAT / // / / / /// / // Tsp4CI* || | MnlI SetI ||| | |BseMII || | BsrI ||| | BspCNI || BsiYI* ||| CviJI |DraII ||| AluI |AsuI* ||TspDTI BmgT120I ||SetI HaeIII |DdeI CviJI Hpy188I G T V R A S Y W Y N I G I S E L T A F I E R S G P H T G I I * V S Q S L L L S * N G Q G L I L V * Y R Y L R A Y C F H N ----:----|----:----|----:----|----:----|----:----|----:----| P V T L A E Y Q Y L I P I E S S V A K M L F P * P R M S T Y Y L Y R L A * Q K * S R D P G * V P I I Y T D * L K S S E Y AciI TseI | BbvI |BisI | SfaNI ||BlsI MwoI MseI TspEI \ \ \\\ \ \ \ ACATTGAAAGAACCGCAGTATAGAGATGCTGCTATTTTTGCTTTTAAGAAATCCATTCAA 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAACTTTCTTGGCGTCATATCTCTACGACGATAAAAACGAAAATTCTTTAGGTAAGTT / / /// / / | SfaNI ||| MwoI MseI | BbvI ||TseI AciI |BisI BlsI T L K E P Q Y R D A A I F A F K K S I Q H * K N R S I E M L L F L L L R N P F N I E R T A V * R C C Y F C F * E I H S I ----:----|----:----|----:----|----:----|----:----|----:----| V N F S G C Y L S A A I K A K L F D M * L M S L V A T Y L H Q * K Q K * S I W E C Q F F R L I S I S S N K S K L F G N L Tsp4CI* MaeI |FalI | FalI AjuI |FalI AjuI | FalI CviJI TsoI \\ \ \ \ \ \ TTACAGTCTAATACAAGTGAAACTTGGATTGGTCTAGGGATAGCCACTATGGACATCAAC 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTCAGATTATGTTCACTTTGAACCTAACCAGATCCCTATCGGTGATACCTGTAGTTG // / / / / / / / || | AjuI | | AjuI CviJI TsoI || Tsp4CI* | MaeI |TspEI FalI FalI FalI FalI L Q S N T S E T W I G L G I A T M D I N Y S L I Q V K L G L V * G * P L W T S T T V * Y K * N L D W S R D S H Y G H Q L ----:----|----:----|----:----|----:----|----:----|----:----| N C D L V L S V Q I P R P I A V I S M L I V T * Y L H F K S Q D L S L W * P C * * L R I C T F S P N T * P Y G S H V D V BsmAI Hin4II* | BsrDI MseI | NlaIV \ \ \ \ \ TTTCGTGTCTCTCAACATTGCTTTATTAAAGCAACTGCTTTGGAACCGAAGGCGACAAAT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGCACAGAGAGTTGTAACGAAATAATTTCGTTGACGAAACCTTGGCTTCCGCTGTTTA / / / / / | BsmAI MseI | NlaIV BsrDI Hin4II* F R V S Q H C F I K A T A L E P K A T N F V S L N I A L L K Q L L W N R R R Q I S C L S T L L Y * S N C F G T E G D K Y ----:----|----:----|----:----|----:----|----:----|----:----| K R T E * C Q K I L A V A K S G F A V F S E H R E V N S * * L L Q K P V S P S L K T D R L M A K N F C S S Q F R L R C I SetI |MseI FatI ||AhaIII* |CviAII ||| BciVI || TsoI ||| |BdaI ApoI || |NlaIII CviJI MaeI ||| |BdaI TspEI \\ \\ \ \ \\\ \\ \ ACATGGTTCAACTTGGCTATGCTAGGTTTAAAGAAAAAGGATACTGAATTTGCTCAACAG 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| TGTACCAAGTTGAACCGATACGATCCAAATTTCTTTTTCCTATGACTTAAACGAGTTGTC // // / // // / / / / || |FatI CviJI |MaeI || BciVI TspEI | AlwNI || CviAII SetI || BdaI ApoI SetI |TsoI || BdaI NlaIII |MseI AhaIII* T W F N L A M L G L K K K D T E F A Q Q H G S T W L C * V * R K R I L N L L N R M V Q L G Y A R F K E K G Y * I C S T G ----:----|----:----|----:----|----:----|----:----|----:----| V H N L K A I S P K F F F S V S N A * C Y M T * S P * A L N L S F P Y Q I Q E V C P E V Q S H * T * L F L I S F K S L L HphI | TfiI | HinfI | | TsoI | | | MaeIII | | | Tsp45I | | | | StyI | | | | SecI* | | | | | SetI | | | | | | EcoNI SetI | | | | | | |CviJI |AlwNI | | | | | | ||MaeI || Hpy188I | | | | | | ||BsiYI* || | BdaI | | | | | | ||| SetI || | BdaI | | | | | | ||| | CviJI || | | TspEI CviJI | | | | | | ||| | HaeIII \\ \ \ \ \ \ \ \ \ \ \ \\\ \ \ GTTCTGAATAAATTACAAAGCCTTGCCCCACAAGATTCGTCACCTTGGCTAGGTATGGCC 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGACTTATTTAATGTTTCGGAACGGGGTGTTCTAAGCAGTGGAACCGATCCATACCGG / / / / / / / / / /// // / | BdaI TspEI CviJI | | | | | ||| |MaeI HaeIII | BdaI | | | | | ||| SetI CviJI Hpy188I | | | | | ||EcoNI | | | | | ||CviJI | | | | | |SecI* | | | | | |StyI | | | | | BsiYI* | | | | Tsp45I | | | | MaeIII | | | SetI | | HinfI | | TfiI | TsoI HphI V L N K L Q S L A P Q D S S P W L G M A F * I N Y K A L P H K I R H L G * V W P S E * I T K P C P T R F V T L A R Y G L ----:----|----:----|----:----|----:----|----:----|----:----| T R F L N C L R A G C S E D G Q S P I A P E S Y I V F G Q G V L N T V K A L Y P N Q I F * L A K G W L I R * R P * T H G MnlI TfiI HinfI | SmlI | Hpy178III* Hin4I | | Hin4I Bce83I* | TspDTI | | | BsmAI | Hpy188I | |CviRI* \ \ \ \ \ \ \ \\ TTGATTCTTGAGGAACAAGGAGACATTATCGGAAGTTCTAAACTTTTTGCACACTCCTTC 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAAGAACTCCTTGTTCCTCTGTAATAGCCTTCAAGATTTGAAAAACGTGTGAGGAAG / / / / / / / / / / | | | SmlI BsmAI | Hpy188I Hin4I | CviRI* | | Hpy178III* Bce83I* TspDTI | HinfI | Hin4I | TfiI MnlI L I L E E Q G D I I G S S K L F A H S F * F L R N K E T L S E V L N F L H T P S D S * G T R R H Y R K F * T F C T L L H ----:----|----:----|----:----|----:----|----:----|----:----| K I R S S C P S M I P L E L S K A C E K R S E Q P V L L C * R F N * V K Q V S R Q N K L F L S V N D S T R F K K C V G E TseI CviJI |BisI ||BlsI |||Hin6I ||||GlaI Hin4II* ||||MstI* | Hin4II* |||||HhaI TfiI | | BbvI SetI ||||||TspEI SmlI HinfI \ \ \ \ \\\\\\\ \ \ ATATTATCTAATGGAAGGTCAAAGGCTGCGCAATTTATGTATGCTAAAAATGTCCTTGAG 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| TATAATAGATTACCTTCCAGTTTCCGACGCGTTAAATACATACGATTTTTACAGGAACTC / / // ////// / / | Hin4II* |BbvI |||||| TspEI SmlI Hin4II* SetI |||||Hin6I ||||MstI* ||||GlaI |||TseI |||HhaI ||BisI |BlsI CviJI I L S N G R S K A A Q F M Y A K N V L E Y Y L M E G Q R L R N L C M L K M S L R I I * W K V K G C A I Y V C * K C P * E ----:----|----:----|----:----|----:----|----:----|----:----| M N D L P L D F A A C N I Y A L F T R S * I I * H F T L P Q A I * T H * F H G Q Y * R I S P * L S R L K H I S F I D K L MaeIII TspDTI MseI Tsp45I HphI | Tsp4CI* VspI Bce83I* | BsmAI | | TspRI BtsI \ \ \ \ \ \ \ \ AATCACATTAATAATGGTGACGATGAAAGAGATATTGAGACAGTGGAAAAACTAACCACT 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTGTAATTATTACCACTGCTACTTTCTCTATAACTCTGTCACCTTTTTGATTGGTGA / / / / / // / / / HinfI | | | HphI || | Tsp4CI* TspRI TfiI | | Tsp45I || TspRI BtsI | | MaeIII |TspDTI | Bce83I* BsmAI VspI MseI N H I N N G D D E R D I E T V E K L T T I T L I M V T M K E I L R Q W K N * P L S H * * W * R * K R Y * D S G K T N H C ----:----|----:----|----:----|----:----|----:----|----:----| F * M L L P S S S L S I S V T S F S V V S D C * Y H H R H F L Y Q S L P F V L W I V N I I T V I F S I N L C H F F * G S TspRI | MwoI | | TsoI | | |AluI Hpy178III* MboII | | |CviJI | MboII |SapI | | || SetI | TspEI |Ksp632I* \ \ \\ \ \ \ \\ GCTTCAATAGCTTTAGAGCAGTTTTTCAAAAAAAGTCCTGATAGTCAATTTGCTCTTCAA 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGTTATCGAAATCTCGTCAAAAAGTTTTTTTCAGGACTATCAGTTAAACGAGAAGTT / // / / / / / | || CviJI | | TspEI MboII | || AluI | MboII | |SetI Hpy178III* | TsoI MwoI A S I A L E Q F F K K S P D S Q F A L Q L Q * L * S S F S K K V L I V N L L F N F N S F R A V F Q K K S * * S I C S S M ----:----|----:----|----:----|----:----|----:----|----:----| A E I A K S C N K L F L G S L * N A R * Q K L L K L A T K * F F D Q Y D I Q E E S * Y S * L L K E F F T R I T L K S K L SduI HgiAI* | SapI | Ksp632I* | | Hpy178III* TspDTI | | | MaeIII TsoI | CviJI | | | | SetI MslI CviRI* | |BsrI \ \ \ \ \ \ \ \ \\ TGTGCTCTTCTAACTCTTGAAAGGTTACATCACTATGAAAATGCAAACGAACTGGCTAAT 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| ACACGAGAAGATTGAGAACTTTCCAATGTAGTGATACTTTTACGTTTGCTTGACCGATTA / / / / / / / / / // Ksp632I* | | SetI | MslI | | | |CviJI HgiAI* | | MaeIII | | | BsrI SapI | Hpy178III* | | TspDTI SduI Ksp632I* | CviRI* SapI TsoI C A L L T L E R L H H Y E N A N E L A N V L F * L L K G Y I T M K M Q T N W L I C S S N S * K V T S L * K C K R T G * S ----:----|----:----|----:----|----:----|----:----|----:----| H A R R V R S L N C * * S F A F S S A L I H E E L E Q F T V D S H F H L R V P * T S K * S K F P * M V I F I C V F Q S I BdaI BdaI | Tsp4CI* BdaI | | MseI BdaI SmlI | | TspDTI | Bce83I* | Hpy178III* | | |TspEI \ \ \ \ \ \ \\ CGGTTGATAGGCATTTTGGAAAAAAAGTTTGAGAAAACTCAAGATGAAAGAGAACTGTTT 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| GCCAACTATCCGTAAAACCTTTTTTTCAAACTCTTTTGAGTTCTACTTTCTCTTGACAAA / / / / / / | Bce83I* | | | TspDTI BdaI | | Tsp4CI* BdaI | BdaI | BdaI Hpy178III* SmlI R L I G I L E K K F E K T Q D E R E L F G * * A F W K K S L R K L K M K E N C L V D R H F G K K V * E N S R * K R T V * ----:----|----:----|----:----|----:----|----:----|----:----| R N I P M K S F F N S F V * S S L S S N D T S L C K P F F T Q S F E L H F L V T P Q Y A N Q F F L K L F S L I F S F Q K ApoI TspEI TspEI | TaqI | MseI TspEI DdeI SetI | AsuII \ \ \ \ \ \ \ AATTTTGCGATAATTAAAGGACAATTCGCTCGTATTCACTTAGGTTTAGGAAATTTCGAA 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAAACGCTATTAATTTCCTGTTAAGCGAGCATAAGTGAATCCAAATCCTTTAAAGCTT / / // / // / / | TspEI |MseI TspEI |DdeI | AsuII MseI TspEI SetI | TaqI TspEI ApoI N F A I I K G Q F A R I H L G L G N F E I L R * L K D N S L V F T * V * E I S N F C D N * R T I R S Y S L R F R K F R T ----:----|----:----|----:----|----:----|----:----|----:----| L K A I I L P C N A R I * K P K P F K S * N Q S L * L V I R E Y E S L N L F N R I K R Y N F S L E S T N V * T * S I E F BdaI BdaI BdaI BdaI |Hpy188I | Bce83I* ||TfiI | | MboI ||Hin4I | | | DpnI ||Hin4I | | | |BstKTI ||HinfI | | | || SmlI SetI ||| TaqI Hpy99I \ \ \ \\ \ \ \\\ \ \ CTCTCTATTGAAAACGCTGATCTTTCTCAAGGTATTATATCTGAATCGAGCGACGAAAAA 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| GAGAGATAACTTTTGCGACTAGAAAGAGTTCCATAATATAGACTTAGCTCGCTGCTTTTT / / // / // // / / / / | Bce83I* || MboI |SmlI || | | | Hpy99I BdaI |DpnI SetI || | | TaqI BdaI BstKTI || | HinfI || | TfiI || Hpy188I |BdaI |BdaI Hin4I Hin4I L S I E N A D L S Q G I I S E S S D E K S L L K T L I F L K V L Y L N R A T K N L Y * K R * S F S R Y Y I * I E R R K I ----:----|----:----|----:----|----:----|----:----|----:----| S E I S F A S R E * P I I D S D L S S F V R * Q F R Q D K E L Y * I Q I S R R F E R N F V S I K R L T N Y R F R A V F F Hin4I Hin4I DdeI MseI | TspDTI Bpu10I | MboII MseI \ \ \ \ \ \ TCAATGAAAACCAAAATATCCAATCACATTTGCTTAGGATTAAGTTATTTCTTCTTAAAC 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTACTTTTGGTTTTATAGGTTAGTGTAAACGAATCCTAATTCAATAAAGAAGAATTTG / / / // / Hin4I TspDTI | |MseI MseI Hin4I | MboII Bpu10I DdeI S M K T K I S N H I C L G L S Y F F L N Q * K P K Y P I T F A * D * V I S S * T N E N Q N I Q S H L L R I K L F L L K R ----:----|----:----|----:----|----:----|----:----|----:----| D I F V L I D L * M Q K P N L * K K K F I L S F W F I W D C K S L I L N N R R L * H F G F Y G I V N A * S * T I E E * V MboI BclI | DpnI TfiI | |BstKTI XmnI DdeI HinfI | || Hpy188I TspEI EspI* | DdeI \ \\ \ \ \ \ \ GACTTTGATCAGACTTTGAACCAATTCCAAGAACTGCTAAGCATTTCAAAGGATTCTAAG 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAAACTAGTCTGAAACTTGGTTAAGGTTCTTGACGATTCGTAAAGTTTCCTAAGATTC // / / / / / / || Hpy188I | TspEI EspI* | DdeI || BclI XmnI DdeI HinfI || MboI TfiI |DpnI BstKTI D F D Q T L N Q F Q E L L S I S K D S K T L I R L * T N S K N C * A F Q R I L S L * S D F E P I P R T A K H F K G F * A ----:----|----:----|----:----|----:----|----:----|----:----| S K S * V K F W N W S S S L M E F S E L R S Q D S K S G I G L V A L C K L P N * V K I L S Q V L E L F Q * A N * L I R L SetI |TfiI MseI |HinfI MaeI |TspEI || Hpy188I |SetI ||Hin4II* SetI || | HphI TspEI \\ \\\ \ \\ \ \ \ CACCTAGTTGTTTTAATTGCGAAGGTGCTTTATGATGTAGGTGAATCTGACACAAAGGAA 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGATCAACAAAATTAACGCTTCCACGAAATACTACATCCACTTAGACTGTGTTTCCTT / / // / / / // / SetI MaeI || | SetI SetI || HphI || TspEI |Hpy188I |MseI HinfI Hin4II* TfiI H L V V L I A K V L Y D V G E S D T K E T * L F * L R R C F M M * V N L T Q R K P S C F N C E G A L * C R * I * H K G N ----:----|----:----|----:----|----:----|----:----|----:----| C R T T K I A F T S * S T P S D S V F S A G L Q K L Q S P A K H H L H I Q C L P V * N N * N R L H K I I Y T F R V C L F AciI |BisI ||BlsI |||TauI |||Hin6I ||||GlaI |||||HhaI CviJI |||||| TsoI MaeIII \ \\\\\\ \ \ ATTGCTTTACAGGAACTAACAGAATATATAGCCACAAGCGGCGCAGACTTGTTAGTAACA 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGAAATGTCCTTGATTGTCTTATATATCGGTGTTCGCCGCGTCTGAACAATCATTGT / / ////// / TspEI CviJI |||||Hin6I MaeIII |||||TsoI ||||GlaI |||HhaI ||BisI ||AciI |BlsI TauI I A L Q E L T E Y I A T S G A D L L V T L L Y R N * Q N I * P Q A A Q T C * * H C F T G T N R I Y S H K R R R L V S N T ----:----|----:----|----:----|----:----|----:----|----:----| I A K C S S V S Y I A V L P A S K N T V F Q K V P V L L I Y L W L R R L S T L L N S * L F * C F I Y G C A A C V Q * Y C TseI CviRI* |BisI TspEI ||BlsI | BbvI |||AluI | | XbaI |||CviJI | | |MaeI |||| SetI | | |Hpy178III* MseI MboII \\\\ \ \ \ \\ \ \ CTAACGATTGCAGCTATGTCAATTCTAGACGATAAGCGTGAAGATTTAAGCATTATTTTA 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| GATTGCTAACGTCGATACAGTTAAGATCTGCTATTCGCACTTCTAAATTCGTAATAAAAT //// / /// / / |||CviJI | ||XbaI | MboII |||TseI | |Hpy178III* MseI |||AluI | |MaeI ||BisI | BbvI |BlsI TspEI |SetI CviRI* L T I A A M S I L D D K R E D L S I I L * R L Q L C Q F * T I S V K I * A L F * N D C S Y V N S R R * A * R F K H Y F R ----:----|----:----|----:----|----:----|----:----|----:----| S V I A A I D I R S S L R S S K L M I K V L S Q L * T L E L R Y A H L N L C * K * R N C S H * N * V I L T F I * A N N * HindIII | AluI | CviJI | MboII TspEI | | SetI \ \ \ \ GAAGAATTGAAAGCTTTGCCATTATCCAAACAAATAATAGATAAGCACAAAGACGCACCA 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTAACTTTCGAAACGGTAATAGGTTTGTTTATTATCTATTCGTGTTTCTGCGTGGT / /// / | ||| HindIII | ||CviJI | ||AluI | |MboII | SetI TspEI E E L K A L P L S K Q I I D K H K D A P K N * K L C H Y P N K * * I S T K T H H R I E S F A I I Q T N N R * A Q R R T I ----:----|----:----|----:----|----:----|----:----|----:----| S S N F A K G N D L C I I S L C L S A G L L I S L K A M I W V F L L Y A C L R V F F Q F S Q W * G F L Y Y I L V F V C W AgeI BetI* Cfr10I TspEI |HpaII |Hin4I || Hin4I || BsmAI || | AlfI HgaI || | DdeI || | AlfI | Hpy188I || | | MboII MaeIII || | Hpy166II \ \ \\ \ \ \ \ \\ \ \ TATCTGATAGAAGAAATTACTAAGAGACTTTATCGTAACGATACCGGTAAACAAGTATGG 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGACTATCTTCTTTAATGATTCTCTGAAATAGCATTGCTATGGCCATTTGTTCATACC / / / / /// / / // / | | Hin4I | ||DdeI | | || Hpy166II | HgaI | |BsmAI | | |Cfr10I Hpy188I | MboII | | |BetI* TspEI | | |AgeI | | |AlfI | | |AlfI | | HpaII | Hin4I MaeIII Y L I E E I T K R L Y R N D T G K Q V W I * * K K L L R D F I V T I P V N K Y G S D R R N Y * E T L S * R Y R * T S M A ----:----|----:----|----:----|----:----|----:----|----:----| Y R I S S I V L L S * R L S V P L C T H M D S L L F * * S V K D Y R Y R Y V L I I Q Y F F N S L S K I T V I G T F L Y P Csp6I |RsaI || Bce83I* FalI || | AlfI SmlI SetI FalI || | AlfI |SetI | MnlI SspI \\ \ \ \\ \ \ \ CAAAGGAGTGCGTACTTTTTCCCTAATAACCTCAAGGTTTGGGAGAGATTAGATAAGAAT 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCCTCACGCATGAAAAAGGGATTATTGGAGTTCCAAACCCTCTCTAATCTATTCTTA // / / // / / / || AlfI SetI || MnlI FalI SspI || AlfI |SmlI FalI |Bce83I* SetI |Csp6I RsaI Q R S A Y F F P N N L K V W E R L D K N K G V R T F S L I T S R F G R D * I R I K E C V L F P * * P Q G L G E I R * E Y ----:----|----:----|----:----|----:----|----:----|----:----| C L L A Y K K G L L R L T Q S L N S L F A F S H T S K G * Y G * P K P S I L Y S L P T R V K E R I V E L N P L S * I L I XmnI FalI |AluI FalI |CviJI | MaeIII || SetI | | MnlI || | MboII | | | AciI Hpy166II \\ \ \ \ \ \ \ \ ATTCAACGAAGAATAGCTTCTAATGGACAAAATAAAGTTACTGCGGAGGAGATGAGTAAA 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTTGCTTCTTATCGAAGATTACCTGTTTTATTTCAATGACGCCTCCTCTACTCATTT /// / / / / / // ||| MboII FalI | | AciI |BseRI ||CviJI FalI | MaeIII Hpy166II ||AluI MnlI |XmnI SetI I Q R R I A S N G Q N K V T A E E M S K F N E E * L L M D K I K L L R R R * V N S T K N S F * W T K * S Y C G G D E * T ----:----|----:----|----:----|----:----|----:----|----:----| I * R L I A E L P C F L T V A S S I L L Y E V F F L K * H V F Y L * Q P P S S Y N L S S Y S R I S L I F N S R L L H T F StyI SduI ApoI SecI* BseRI TspEI MnlI SetI BseSI \ \ \ \ \ CTATATTGTGAGAGTAAGAATTTGAGAAGCATACAAAGAGGTATGTTTTTGTGCCCTTGG 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| GATATAACACTCTCATTCTTAAACTCTTCGTATGTTTCTCCATACAAAAACACGGGAACC / / / / / TspEI MnlI SetI BseSI SecI* ApoI SduI StyI L Y C E S K N L R S I Q R G M F L C P W Y I V R V R I * E A Y K E V C F C A L G I L * E * E F E K H T K R Y V F V P L E ----:----|----:----|----:----|----:----|----:----|----:----| S Y Q S L L F K L L M C L P I N K H G Q V I N H S Y S N S F C V F L Y T K T G K * I T L T L I Q S A Y L S T H K Q A R P AclI MaeII |MaeIII || SetI || TaiI || | SfeI* || | |Hin4II* || | ||CviRI* || | ||| PstI || | ||| | MwoI || | ||| | |BtsI || | ||| | |TspRI || | ||| | || Hin6I || | ||| | || |GlaI || | ||| | || ||HhaI || | ||| | || |||HaeII \\ \ \\\ \ \\ \\\\ AACGTTACTGCAGTGAAGGCGCTAAACGAATGTTTCTAA 4270 4280 4290 ----:----|----:----|----:----|----:---- TTGCAATGACGTCACTTCCGCGATTTGCTTACAAAGATT / / / / // / //// | | | | || | |||Hin6I | | | | || | ||GlaI | | | | || | |HhaI | | | | || | HaeII | | | | || BtsI | | | | |MwoI | | | | SfeI* | | | CviRI* | | Hin4II* | | MaeIII | | TspRI | | PstI | MaeII | AclI TaiI SetI N V T A V K A L N E C F * T L L Q * R R * T N V S X R Y C S E G A K R M F L X ----:----|----:----|----:----|----:---- F T V A T F A S F S H K * S R * Q L S P A L R I N R V N S C H L R * V F T E L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 8 BspACI,SsiI AclI 1 Psp1406I AflIII 3 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 3 DraI AjuI 1 AlfI 2 AluI 15 AluBI AlwNI 1 CaiI ApoI 9 AcsI,XapI AsuI* 7 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BalI 2 MlsI,MluNI,MscI,Msp20I BbvI 8 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 2 Bce83I* 6 BpuEI BcgI 2 BciVI 1 BfuI BclI 2 FbaI,Ksp22I BdaI 12 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglI 1 BglII 1 BinI* 8 AlwI,BspPI,AclWI BisI 11 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 11 BmgT120I 7 Bpu10I 1 BsaAI 2 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BsaXI 1 BseBI 7 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 3 BseRI 2 BseSI 1 BaeGI,BstSLI BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 7 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 3 BsrDI 2 BseMI,Bse3DI BsrI 6 BseNI,Bse1I,BsrSI BssKI 8 BstSCI,StyD4I BstKTI 18 BstXI 1 BtgZI 2 BtsI 2 Cac8I 8 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CspCI 1 CviAII 8 CviJI 41 CviKI-1 CviRI* 11 HpyCH4V DdeI 12 BstDEI,HpyF3I DpnI 18 MalI DraII 4 EcoO109I Eam1105I 1 AspEI,BmeRI,DriI,AhdI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 2 EcoNI 1 BstENI,XagI EcoP15I 1 EcoRII 7 AjnI,Psp6I,PspGI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 6 FatI 8 FauI 1 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 FspAI 1 GlaI 6 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 9 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HhaI 6 BstHHI,CfoI,AspLEI Hin4I 11 Hin4II* 10 HpyAV Hin6I 6 HinP1I,HspAI HindII 1 HincII HindIII 2 HinfI 16 HpaII 3 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 21 Hpy188III Hpy188I 16 Hpy99I 1 Ksp632I* 5 Eam1104I,EarI,Bst6I MaeI 10 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 10 MboI 18 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 22 MfeI 2 MunI MluI 1 MlyI 4 SchI MnlI 18 MseI 34 Tru1I,Tru9I MslI 2 RseI,SmiMI MstI* 2 AviII,FspI,NsbI,Acc16I MwoI 6 HpyF10VI,BstMWI NdeI 2 FauNDI NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 1 BstNSI,XceI OliI 1 AleI PacI 1 PfoI 1 PleI 4 PpsI PpuMI 1 Psp5II,PspPPI PsiI 2 AanI PstI 1 RsaI 4 AfaI SalI 1 SapI 2 LguI,PciSI,BspQI ScaI 2 BmcAI,AssI,ZrmI ScrFI 8 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 9 BseDI,BssECI,BsaJI SetI 59 SfaNI 9 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 6 SmoI SpeI 1 BcuI,AhlI SphI 1 PaeI,BbuI SspI 6 StyI 4 Eco130I,EcoT14I,ErhI,BssT1I TaiI 6 TaqI 14 TaqII 1 TatI 2 TauI 3 TfiI 12 PfeI TseI 8 ApeKI TsoI 8 Tsp45I 5 NmuCI Tsp4CI* 10 HpyCH4III,TaaI,Bst4CI TspDTI 16 TspEI 46 TasI,Tsp509I,Sse9I TspGWI 4 TspRI 8 TscAI TstI 1 VspI 2 PshBI,AseI XbaI 1 XhoII 4 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AcyI AflII AloI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BamHI BarI BbvCI BceAI BmeT110I BmtI BplI BsePI BseYI BsgI BsiI* Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstZ17I BtrI Cfr9I DinI DraIII DrdI DsaI* Ecl136II Eco47III EcoICRI EcoRI EcoRV EcoT22I EgeI EheI Esp3I FseI GsaI HgiCI* HgiJII* HpaI KasI KpnI MauBI McrI* MmeI Mph1103I MroNI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NsiI PasI PflMI PmaCI PmeI PpiI PshAI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SanDI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI Tth111I XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769