Restriction Map of GDB1/YPR184W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

GDB1/YPR184W on chromosome XVI from coordinates 902044 to 906654.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.13478

MboI Hpy188I |MmeI | AgeI ||DpnI | BetI* HphI |||BstKTI | Cfr10I | TseI |||| TspDTI | |HpaII | AluI |||| | MaeII | || BbvI | CviJI |||| | | SetI | || Hpy166II | |BisI |||| | | TaiI | || | FalI | ||BlsI |||| | | BciVI | || | FalI | ||SetI \\\\ \ \ \ \ \\ \ \ \ \\\ ATGAATAGATCATTACTGCTACGTTTGTCGGATACCGGTGAACCCATTACAAGCTGCTCT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTATCTAGTAATGACGATGCAAACAGCCTATGGCCACTTGGGTAATGTTCGACGAGA / // / / / / / // / / / / //// | || | | | MaeII Hpy188I || | | | | |||TseI | || | | | BciVI || | | | | ||BisI | || | | TaiI || | | | | |BlsI | || | | SetI || | | | | CviJI | || | TspDTI || | | | | AluI | || MboI || | | | SetI | |DpnI || | | HphI | BstKTI || | BbvI MmeI || Hpy166II |Cfr10I |BetI* |AgeI HpaII FalI FalI M N R S L L L R L S D T G E P I T S C S * I D H Y C Y V C R I P V N P L Q A A L E * I I T A T F V G Y R * T H Y K L L L ----:----|----:----|----:----|----:----|----:----|----:----| X F L D N S S R K D S V P S G M V L Q E X S Y I M V A V N T P Y R H V W * L S S H I S * * Q * T Q R I G T F G N C A A R HgaI SetI | TspEI | FalI | | AciI HgaI | FalI | | | BsrBI | AsuI* | |Hpy178III* | | | | DdeI | AvaII | || TspGWI | | | | SauI* AcyI | |BmgT120I \ \\ \ \ \ \ \ \ \ \ \\ TACGGAAAAGGTGTCTTGACGCTACCACCAATTCCGCTCCCTAAGGACGCCCCAAAGGAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCCTTTTCCACAGAACTGCGATGGTGGTTAAGGCGAGGGATTCCTGCGGGGTTTCCTG // / / // / / / // |FalI | Hpy178III* || BsrBI | AcyI |AvaII |FalI TspGWI || AciI SauI* |AsuI* SetI |TspEI DdeI |HgaI HgaI BmgT120I Y G K G V L T L P P I P L P K D A P K D T E K V S * R Y H Q F R S L R T P Q R T R K R C L D A T T N S A P * G R P K G P ----:----|----:----|----:----|----:----|----:----|----:----| * P F P T K V S G G I G S G L S A G F S K R F L H R S A V V L E A G * P R G L P V S F T D Q R * W W N R E R L V G W L V Tsp4CI* | AluI | CviJI | | SetI | | | BspMI | | | | BsrI | | | | | SfeI* | | | | | | CviRI* | | | | | | | PstI AciI | | | | | | | | SetI BccI CviJI | BsrBI | | | | | | | | NlaIV |MaeI BseGI \ \ \ \ \ \ \ \ \ \ \ \\ \ CAACCGCTCTATACGGTCAAGCTACTGGTATCTGCAGGTTCCCCTGTCGCTAGGGATGGG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGGCGAGATATGCCAGTTCGATGACCATAGACGTCCAAGGGGACAGCGATCCCTACCC / / / / / / / /// / / / / / BsrBI | | CviJI | | | ||| NlaIV | MaeI | CviJI AciI | | AluI | | | ||SfeI* BccI BseGI | SetI | | | |SetI Tsp4CI* | | | CviRI* | | PstI | BspMI BsrI Q P L Y T V K L L V S A G S P V A R D G N R S I R S S Y W Y L Q V P L S L G M G T A L Y G Q A T G I C R F P C R * G W A ----:----|----:----|----:----|----:----|----:----|----:----| W G S * V T L S S T D A P E G T A L S P G V A R Y P * A V P I Q L N G Q R * P H L R E I R D L * Q Y R C T G R D S P I P MnlI | EcoNI | Hpy178III* | | BsiYI* MboI | | | Hin4II* | DpnI | | | | ApoI MaeI FokI TspEI | |BstKTI | | | | TspEI \ \ \ \ \\ \ \ \ \ \ CTAGTTTGGACTAATTGCCCACCAGATCACAACACGCCCTTCAAGAGGGACAAATTTTAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GATCAAACCTGATTAACGGGTGGTCTAGTGTTGTGCGGGAAGTTCTCCCTGTTTAAAATG / / / // / / / // / / / MaeI FokI TspEI || MboI | | || Hin4II* | TspDTI |DpnI | | |Hpy178III* TspEI BstKTI | | EcoNI ApoI | BsiYI* MnlI L V W T N C P P D H N T P F K R D K F Y * F G L I A H Q I T T R P S R G T N F T S L D * L P T R S Q H A L Q E G Q I L Q ----:----|----:----|----:----|----:----|----:----|----:----| S T Q V L Q G G S * L V G K L L S L N * A L K S * N G V L D C C A R * S P C I K * N P S I A W W I V V R G E L P V F K V BseGI | CviRI* | | FokI | | |GsuI AluI | | |Eco57MI CviJI | | || SetI |MnlI | | || | DrdI ||SetI | | || | | AccI ||| BsiI* | | || | | |Hpy166II BslFI ||| Hpy178III* | | || | | || BssKI TspDTI ||| | MslI | | || | | || EcoRII \ \\\ \ \ \ \ \\ \ \ \\ \ AAAAAAATCATTCATTCCAGCTTTCACGAGGATGACTGCATTGACCTGAATGTCTACGCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTTAGTAAGTAAGGTCGAAAGTGCTCCTACTGACGTAACTGGACTTACAGATGCGA / / / / / / / // / // BslFI | CviJI | | | | || FokI |AccI | AluI | | | | || DrdI Hpy166II | MnlI | | | | |SetI SetI | | | | Eco57MI | | | | GsuI | | | CviRI* | | BseGI | BsiI* | MslI Hpy178III* K K I I H S S F H E D D C I D L N V Y A K K S F I P A F T R M T A L T * M S T L K N H S F Q L S R G * L H * P E C L R S ----:----|----:----|----:----|----:----|----:----|----:----| L F I M * E L K * S S S Q M S R F T * A C F F * E N W S E R P H S C Q G S H R R F F D N M G A K V L I V A N V Q I D V S ScrFI BseBI | CviJI | | Csp6I | | |RsaI BsmAI | | ||MwoI Hpy178III* | SmlI \ \ \\\ \ \ \ CCAGGCTCGTACTGCTTTTATCTATCTTTCAGGAACGATAACGAAAAACTTGAGACAACA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCCGAGCATGACGAAAATAGATAGAAAGTCCTTGCTATTGCTTTTTGAACTCTGTTGT / / / // / / / | | | |Csp6I Hpy178III* | SmlI | | | RsaI BsmAI | | MwoI | EcoRII | BssKI | CviJI BseBI ScrFI P G S Y C F Y L S F R N D N E K L E T T Q A R T A F I Y L S G T I T K N L R Q Q R L V L L L S I F Q E R * R K T * D N K ----:----|----:----|----:----|----:----|----:----|----:----| G P E Y Q K * R D K L F S L S F S S V V E L S T S S K D I K * S R Y R F V Q S L W A R V A K I * R E P V I V F F K L C C MboI SetI FatI | DpnI | ApoI |CviAII | |BstKTI | TspEI Bce83I* || NlaIII | || BtgZI | EcoRI \ \\ \ \ \\ \ \ \ AGGAAATACTACTTTGTTGCCTTGCCCATGCTTTATATAAACGATCAGTTCCTACCTTTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTTTATGATGAAACAACGGAACGGGTACGAAATATATTTGCTAGTCAAGGATGGAAAC / / // // / / / Bce83I* | |FatI || MboI | BtgZI | CviAII |DpnI SetI NlaIII BstKTI R K Y Y F V A L P M L Y I N D Q F L P L G N T T L L P C P C F I * T I S S Y L * E I L L C C L A H A L Y K R S V P T F E ----:----|----:----|----:----|----:----|----:----|----:----| L F Y * K T A K G M S * I F S * N R G K L S I S S Q Q R A W A K Y L R D T G V K P F V V K N G Q G H K I Y V I L E * R Q BseYI CviJI | GsaI | |CviJI | || FokI | || SduI | || HgiJII* | || | Hpy188I | || | | BsrI | || | | |NlaIV | || | | ||CviJI | || | | ||| SduI | || | | ||| BseGI | || | | ||| HgiJII* BccI TaqI | || | | ||| |BfiI \ \ \ \\ \ \ \\\ \\ AATTCCATCGCTTTACAAAGTGTTGTATCGAAATGGCTGGGCTCTGACTGGGAGCCCATC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGGTAGCGAAATGTTTCACAACATAGCTTTACCGACCCGAGACTGACCCTCGGGTAG / / / / /// / / / /// / EcoRI BccI TaqI | ||| | | | ||| BfiI TspEI | ||| | | | ||CviJI ApoI | ||| | | | ||BseGI | ||| | | | |NlaIV | ||| | | | HgiJII* | ||| | | | SduI | ||| | | BsrI | ||| | FokI | ||| Hpy188I | ||CviJI | |BseYI | HgiJII* | SduI CviJI GsaI N S I A L Q S V V S K W L G S D W E P I I P S L Y K V L Y R N G W A L T G S P S F H R F T K C C I E M A G L * L G A H P ----:----|----:----|----:----|----:----|----:----|----:----| F E M A K C L T T D F H S P E S Q S G M S N W R K V F H Q I S I A P S Q S P A W I G D S * L T N Y R F P Q A R V P L G D SfeI* | BsiYI* AciI | |MnlI TaqI BisI HphI | || BplI BccI |BlsI |Csp6I | || BplI | TspEI ||TauI ||RsaI | || |MnlI \ \ \\\ \\\ \ \\ \\ CTATCGAAAATTGCCGCTAAAAACTACAATATGGTACATTTCACCCCTCTACAGGAAAGA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GATAGCTTTTAACGGCGATTTTTGATGTTATACCATGTAAAGTGGGGAGATGTCCTTTCT // ///// / // / // / / |TaqI ||||AciI | |Csp6I | || | MnlI BccI |||BisI | RsaI | || SfeI* ||BlsI HphI | |MnlI |TauI | BplI TspEI | BplI BsiYI* L S K I A A K N Y N M V H F T P L Q E R Y R K L P L K T T I W Y I S P L Y R K E I E N C R * K L Q Y G T F H P S T G K R ----:----|----:----|----:----|----:----|----:----|----:----| R D F I A A L F * L I T C K V G R C S L G I S F Q R * F S C Y P V N * G E V P F * R F N G S F V V I H Y M E G R * L F S MfeI TspEI | CviRI* | | TaqI | | | BssKI | | | EcoRII PleI BplI | | | | ScrFI HinfI |MlyI BplI | | | | BseBI MseI \ \\ \ \ \ \ \ \ \ GGCGAGTCTAACTCGCCTTACTCTATATACGACCAATTGCAGTTCGACCAGGAACACTTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCTCAGATTGAGCGGAATGAGATATATGCTGGTTAACGTCAAGCTGGTCCTTGTGAAA / / / // / / / HinfI PleI BplI |CviRI* | | EcoRII MlyI BplI TspEI | | BssKI MfeI | BseBI | ScrFI TaqI G E S N S P Y S I Y D Q L Q F D Q E H F A S L T R L T L Y T T N C S S T R N T L R V * L A L L Y I R P I A V R P G T L * ----:----|----:----|----:----|----:----|----:----|----:----| P S D L E G * E I Y S W N C N S W S C K L R T * S A K S * I R G I A T R G P V S A L R V R R V R Y V V L Q L E V L F V K Hpy178III* | MaeII | |BtrI Hpy178III* | || SetI |NruI | || TaiI |FnuDII* | || BbvII* || MseI | || | ApoI || |TspDTI | || | TspEI || |AhaIII* | || | |BcgI || || FatI | || | |MboII || || |CviAII | || | || BtgZI || || || BcgI | || | || | Eco57I || || || |NspI |BsmAI || | || | Eco57MI || || || |NlaIII \\ \\ \ \\ \ \ \\ \\ \\ \\ AAGTCTCCTGAAGACGTGAAAAATTTAGTTGAGCATATACATCGCGATTTAAACATGCTT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGAGGACTTCTGCACTTTTTAAATCAACTCGTATATGTAGCGCTAAATTTGTACGAA / / // // // / / / // / // // // MseI | || || || | | BtgZI || | || || |FatI | || || || | Eco57MI || | || || CviAII | || || || | Eco57I || | || |BcgI | || || || TspEI || | || NlaIII | || || || ApoI || | || NspI | || || |BbvII* || | |MseI | || || |MboII || | AhaIII* | || || BcgI || TspDTI | || |MaeII |Hpy178III* | || BtrI FnuDII* | |TaiI NruI | |SetI | BsmAI Hpy178III* K S P E D V K N L V E H I H R D L N M L S L L K T * K I * L S I Y I A I * T C F V S * R R E K F S * A Y T S R F K H A F ----:----|----:----|----:----|----:----|----:----|----:----| L D G S S T F F K T S C I C R S K F M S * T E Q L R S F N L Q A Y V D R N L C A L R R F V H F I * N L M Y M A I * V H K AluI CviJI BsaXI | SetI | MnlI | | TsoI | | SduI | | TspEI StyI | | BssKI MseI MseI | | |TsoI SecI* | | HgiAI* \ \ \ \ \\ \ \ \ \ TCATTAACAGATATTGTTTTTAACCACACAGCTAATAATTCTCCTTGGTTAGTTGAGCAC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAATTGTCTATAACAAAAATTGGTGTGTCGATTATTAAGAGGAACCAATCAACTCGTG / / / / // / / / // MseI MseI | | |TsoI TspEI | | |MnlI | | TsoI | | HgiAI* | CviJI | | SduI | AluI | BsaXI SetI SecI* StyI S L T D I V F N H T A N N S P W L V E H H * Q I L F L T T Q L I I L L G * L S T I N R Y C F * P H S * * F S L V S * A P ----:----|----:----|----:----|----:----|----:----|----:----| E N V S I T K L W V A L L E G Q N T S C K M L L Y Q K * G C L * Y N E K T L Q A * * C I N N K V V C S I I R R P * N L V AluI CviJI HpaII BtsI Ecl136II ScrFI | BsaXI | TaqI CauII* | | Hin6I | SetI | BseYI | | |GlaI Hin6I | SduI | CviJI | | ||HhaI |GlaI | SacI | BsiYI* | | ||TspRI ||HhaI | HgiAI* | | GsaI | | |||TsoI |||HaeII | HgiJII* \ \ \ \ \ \\\\ \\\\ \ \ CCGGAGGCTGGGTATAACCACATCACTGCGCCACATCTAATCAGCGCCATAGAGCTCGAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GGCCTCCGACCCATATTGGTGTAGTGACGCGGTGTAGATTAGTCGCGGTATCTCGAGCTG /// / / // /// //// / / / ||| | BseYI |BsaXI ||Hin6I |||Hin6I | | TaqI ||| CviJI TspRI |TsoI ||GlaI | Ecl136II ||| GsaI BtsI |GlaI |HhaI | CviJI ||BsiYI* HhaI HaeII | AluI ||BssKI HgiJII* |HpaII HgiAI* CauII* SacI ScrFI SduI SetI P E A G Y N H I T A P H L I S A I E L D R R L G I T T S L R H I * S A P * S S T G G W V * P H H C A T S N Q R H R A R P ----:----|----:----|----:----|----:----|----:----|----:----| G S A P Y L W M V A G C R I L A M S S S G P P Q T Y G C * Q A V D L * R W L A R R L S P I V V D S R W M * D A G Y L E V BssKI EcoRII |SecI* ||ScrFI ApoI ||BseBI TspEI TspEI TspEI ||| CviJI \ \ \ \\\ \ CAAGAATTGCTCAATTTTAGTAGGAATTTGAAATCCTGGGGCTATCCTACCGAACTGAAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTAACGAGTTAAAATCATCCTTAAACTTTAGGACCCCGATAGGATGGCTTGACTTT / / / / / / TspEI TspEI TspEI | | CviJI ApoI | EcoRII | BssKI | SecI* BseBI ScrFI Q E L L N F S R N L K S W G Y P T E L K K N C S I L V G I * N P G A I L P N * K R I A Q F * * E F E I L G L S Y R T E K ----:----|----:----|----:----|----:----|----:----|----:----| W S N S L K L L F K F D Q P * G V S S F G L I A * N * Y S N S I R P S D * R V S L F Q E I K T P I Q F G P A I R G F Q F MboII | MboI | BglII | XhoII | | DpnI | | |BstKTI | | || Hpy178III* | | || |MboII | | || |Ksp632I* | | || ||MboI | | || ||| DpnI | | || ||| |FatI | | || ||| |BstKTI FatI | | || ||| ||CviAII CviRI* | | || ||| ||| NlaIII |CviAII | | || ||| ||| | Tsp4CI* || NspI | | || ||| ||| | | MseI || NlaIII \ \ \\ \\\ \\\ \ \ \ \\ \ AATATAGAAGATCTCTTCAAGATCATGGACGGTATTAAAGTGCATGTTTTAGGGTCGTTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTATATCTTCTAGAGAAGTTCTAGTACCTGCCATAATTTCACGTACAAAATCCCAGCAAC / // / / ///// // / / / // | || | | ||||| || | MseI | |FatI | || | | ||||| || Tsp4CI* | CviAII | || | | ||||| |FatI CviRI* | || | | ||||| CviAII NlaIII | || | | ||||MboI NspI | || | | |||NlaIII | || | | ||Ksp632I* | || | | ||DpnI | || | | |BstKTI | || | | Hpy178III* | || | MboII | || XhoII | || BglII | || MboI | |DpnI | BstKTI MboII N I E D L F K I M D G I K V H V L G S L I * K I S S R S W T V L K C M F * G R * Y R R S L Q D H G R Y * S A C F R V V E ----:----|----:----|----:----|----:----|----:----|----:----| F I S S R K L I M S P I L T C T K P D N F Y L L D R * S * P R Y * L A H K L T T I Y F I E E L D H V T N F H M N * P R Q AluI Hpy166II CviJI | MaeII | SetI | | SetI | | Hpy178III* | | TaiI | | |SapI | | |CviRI* | | |Ksp632I* Tsp4CI* SspI AciI | | ||MboII | | || EcoRV CviJI \ \ \ \ \ \\\ \ \ \\ \ \ AAACTGTGGGAATATTATGCGGTAAACGTGCAAACAGCTCTTCGGGATATCAAAGCCCAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGACACCCTTATAATACGCCATTTGCACGTTTGTCGAGAAGCCCTATAGTTTCGGGTA / / / // / / / / / // / Tsp4CI* SspI | || | | | CviJI | |EcoRV CviJI | || | | | AluI | Ksp632I* | || | | SetI | SapI | || | CviRI* Hpy178III* | || | MboII | || MaeII | |TaiI | |SetI | Hpy166II AciI K L W E Y Y A V N V Q T A L R D I K A H N C G N I M R * T C K Q L F G I S K P I T V G I L C G K R A N S S S G Y Q S P L ----:----|----:----|----:----|----:----|----:----|----:----| F S H S Y * A T F T C V A R R S I L A W S V T P I N H P L R A F L E E P Y * L G F Q P F I I R Y V H L C S K P I D F G M MaeIII | Tsp4CI* | | AvaI | | Hpy178III* | | |BmeT110I | | || Hin4I | | || Hin4I TfiI | | || | SspI Eam1105I MslI HinfI | | || | | MseI | Hpy188I \ \ \ \ \\ \ \ \ \ \ TGGAATGACGAATCTAACGAAAGTTACAGTTTTCCCGAGAATATTAAAGACATCTCGTCC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTTACTGCTTAGATTGCTTTCAATGTCAAAAGGGCTCTTATAATTTCTGTAGAGCAGG / / / //// / / / / MslI HinfI Tsp4CI* |||| | MseI | Hpy188I TfiI MaeIII |||| SspI Eam1105I |||AvaI ||BmeT110I |Hpy178III* Hin4I Hin4I W N D E S N E S Y S F P E N I K D I S S G M T N L T K V T V F P R I L K T S R P E * R I * R K L Q F S R E Y * R H L V R ----:----|----:----|----:----|----:----|----:----|----:----| Q F S S D L S L * L K G S F I L S M E D N S H R I * R F N C N E R S Y * L C R T P I V F R V F T V T K G L I N F V D R G BseMII |BspCNI ||Tth111I |||MaeII Hin4I ||||MaeIII Hin4I ||||Tsp45I |MaeI ||||| SetI || AluI ||||| TaiI || CviJI ||||| | DdeI || | SetI ||||| | | CviJI || | | Hin4II* ||||| | | TspRI BsiYI* \\ \ \ \ \\\\\ \ \ \ \ GATTTCGTAAAACTAGCTTCCTTTGTGAAGGACAACGTCACTGAGCCTAACTTCGGCACT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAAGCATTTTGATCGAAGGAAACACTTCCTGTTGCAGTGACTCGGATTGAAGCCGTGA / /// / // //// / // / Hin4I ||| Hin4II* || |||| | || BsiYI* Hin4I ||CviJI || |||| | |CviJI ||AluI || |||| | DdeI |MaeI || |||| Tsp45I SetI || |||| MaeIII || |||MaeII || ||TspRI || |Tth111I || TaiI || SetI |BspCNI BseMII D F V K L A S F V K D N V T E P N F G T I S * N * L P L * R T T S L S L T S A L F R K T S F L C E G Q R H * A * L R H S ----:----|----:----|----:----|----:----|----:----|----:----| S K T F S A E K T F S L T V S G L K P V R N R L V L K R Q S P C R * Q A * S R C I E Y F * S G K H L V V D S L R V E A S MseI | MaeII AluI | | SetI ApoI CviJI HphI | | TaiI TspEI | SetI \ \ \ \ \ \ \ CTTGGTGAAAGAAACTCAAACAGGATTAACGTGCCAAAATTTATTCAACTACTGAAGCTC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GAACCACTTTCTTTGAGTTTGTCCTAATTGCACGGTTTTAAATAAGTTGATGACTTCGAG / / / / / / HphI | MaeII TspEI | CviJI MseI ApoI | AluI TaiI SetI SetI L G E R N S N R I N V P K F I Q L L K L L V K E T Q T G L T C Q N L F N Y * S S W * K K L K Q D * R A K I Y S T T E A H ----:----|----:----|----:----|----:----|----:----|----:----| R P S L F E F L I L T G F N I * S S F S E Q H F F S L C S * R A L I * E V V S A K T F S V * V P N V H W F K N L * Q L E CfrI | BalI | CviJI | HaeIII | |SecI* | |DsaI* MboII | || Hin4I Hin4I | Tsp4CI* | || Hin4I Hin4I | | TfiI | || |CviJI MnlI BccI Eco57I | | HinfI | || || BdaI Hpy178III* |MseI Eco57MI | | | TspRI | || || BdaI | BceAI \\ \ \ \ \ \ \ \\ \\ \ \ \ ATTAACGATGGTGGTAGTGATGACAGTGAATCTTCGTTGGCCACGGCTCAAAACATCTTG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTGCTACCACCATCACTACTGTCACTTAGAAGCAACCGGTGCCGAGTTTTGTAGAAC / / / / // / / / / // / / | | | Eco57MI || | HinfI | | |CviJI | Hpy178III* | | | Eco57I || | TfiI | | |BdaI MnlI | | Hin4I || Tsp4CI* | | |BdaI | | Hin4I |MboII | | DsaI* | MseI TspRI | | SecI* BccI | CfrI HaeIII Hin4I Hin4I CviJI BalI I N D G G S D D S E S S L A T A Q N I L L T M V V V M T V N L R W P R L K T S * * R W W * * * Q * I F V G H G S K H L E ----:----|----:----|----:----|----:----|----:----|----:----| M L S P P L S S L S D E N A V A * F M K * * R H H Y H H C H I K T P W P E F C R N V I T T T I V T F R R Q G R S L V D Q PpiI | TspRI | | AvaI | | XhoI | | SmlI SetI | | PspXI |HindII BdaI Hpy99I | | |TaqI |Hpy166II BdaI | DrdI | | |BmeT110I \\ \ \ \ \ \ \\ AACGAGGTCAACTTACCCTTATATAGAGAATACGACGATGATGTCAGTGAGATACTCGAG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTCCAGTTGAATGGGAATATATCTCTTATGCTGCTACTACAGTCACTCTATGAGCTC / / / / / / / / // | SetI Hpy166II BdaI | | | PpiI |PspXI BceAI HindII BdaI | | TspRI |SmlI | DrdI |XhoI Hpy99I |AvaI BmeT110I TaqI N E V N L P L Y R E Y D D D V S E I L E T R S T Y P Y I E N T T M M S V R Y S S R G Q L T L I * R I R R * C Q * D T R A ----:----|----:----|----:----|----:----|----:----|----:----| F S T L K G K Y L S Y S S S T L S I S S S R P * S V R I Y L I R R H H * H S V R V L D V * G * I S F V V I I D T L Y E L Tsp4CI* | AsuI* | Bsp120I | |AsuI* | |BmgT120I | ||CviJI | ||NlaIV | ||HaeIII | ||BmgT120I | ||| ApaI | ||| SduI | ||| BseSI | ||| HgiJII* | ||| | BsiYI* | ||| | | AsuI* | ||| | | AvaII | ||| | | |BmgT120I | ||| | | ||SetI | ||| | | |||BsrI PpiI | ||| | | |||| MaeIII Tsp4CI* |SspI | ||| | | |||| Tsp45I \ \\ \ \\\ \ \ \\\\ \ CAACTGTTCAATCGTATCAAATATTTGAGATTAGATGACGGTGGGCCCAAGCAAGGTCCA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGACAAGTTAGCATAGTTTATAAACTCTAATCTACTGCCACCCGGGTTCGTTCCAGGT / / / / / /// / / /// Tsp4CI* PpiI SspI | | ||| | | ||AvaII | | ||| | | ||AsuI* | | ||| | | |BmgT120I | | ||| | | TspRI | | ||| | | BsrI | | ||| | SetI | | ||| BsiYI* | | ||Bsp120I | | ||AsuI* | | |BmgT120I | | |AsuI* | | BmgT120I | | HaeIII | | NlaIV | | CviJI | HgiJII* | BseSI | SduI | ApaI Tsp4CI* Q L F N R I K Y L R L D D G G P K Q G P N C S I V S N I * D * M T V G P S K V Q T V Q S Y Q I F E I R * R W A Q A R S S ----:----|----:----|----:----|----:----|----:----|----:----| C S N L R I L Y K L N S S P P G L C P G A V T * D Y * I N S I L H R H A W A L D L Q E I T D F I Q S * I V T P G L L T W TspRI |Tsp4CI* || HindII || Hpy166II || | MaeII || | |BtrI || | || SetI || | || TaiI || | || | SduI || | || | BseSI CviJI Csp6I || | || | | MseI | MnlI SetI BccI |RsaI \\ \ \\ \ \ \ \ \ \ \ \\ GTGACCGTTGACGTGCCCTTAACAGAGCCTTATTTTACGAGGTTCAAAGGAAAAGATGGT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CACTGGCAACTGCACGGGAATTGTCTCGGAATAAAATGCTCCAAGTTTCCTTTTCTACCA / // // / / / / / / | || |MaeII MseI | MnlI SetI BccI RsaI | || |BseSI CviJI | || |SduI | || BtrI | |TaiI | |SetI | Hpy166II | HindII Tsp4CI* Tsp45I MaeIII V T V D V P L T E P Y F T R F K G K D G * P L T C P * Q S L I L R G S K E K M V D R * R A L N R A L F Y E V Q R K R W Y ----:----|----:----|----:----|----:----|----:----|----:----| T V T S T G K V S G * K V L N L P F S P L S R Q R A R L L A K N * S T * L F L H H G N V H G * C L R I K R P E F S F I T MaeIII BstEII | Hin4I | Hin4I | |BtgZI | ||SpeI MnlI | |||MaeI | CviJI | |||| BsiYI* \ \ \ \\\\ \ ACTGATTATGCCCTCGCCAACAATGGCTGGATATGGAATGGTAACCCACTAGTGGATTTT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTAATACGGGAGCGGTTGTTACCGACCTATACCTTACCATTGGGTGATCACCTAAAA / / / / / / // Csp6I MnlI CviJI | | | |SpeI | | | BtgZI | | | MaeI | | BsiYI* | BstEII | MaeIII Hin4I Hin4I T D Y A L A N N G W I W N G N P L V D F L I M P S P T M A G Y G M V T H * W I L * L C P R Q Q W L D M E W * P T S G F C ----:----|----:----|----:----|----:----|----:----|----:----| V S * A R A L L P Q I H F P L G S T S K Y Q N H G R W C H S S I S H Y G V L P N S I I G E G V I A P Y P I T V W * H I K ApoI TspEI EcoRI |SfaNI || Hpy178III* || | Hin4I || | Hin4I || | |AluI || | |CviJI || | || SetI || | || | Hin4I || | || | | MaeII || | || | | |BsaAI || | || | | |SnaBI Hin4I || | || | | || SetI Tsp4CI* CviRI* || | || | | || TaiI Tth111I \ \\ \ \\ \ \ \\ \ \ GCATCGCAGAATTCAAGAGCTTATTTACGTAGAGAAGTTATCGTGTGGGGGGACTGTGTC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAGCGTCTTAAGTTCTCGAATAAATGCATCTCTTCAATAGCACACCCCCCTGACACAG / // //// / // / / / CviRI* || |||CviJI | |MaeII | | Tth111I || |||AluI | SnaBI | Tsp4CI* || ||Hin4I | BsaAI Hin4I || |SetI TaiI || | SetI || Hpy178III* |SfaNI Hin4I Hin4I EcoRI TspEI ApoI A S Q N S R A Y L R R E V I V W G D C V H R R I Q E L I Y V E K L S C G G T V S I A E F K S L F T * R S Y R V G G L C Q ----:----|----:----|----:----|----:----|----:----|----:----| A D C F E L A * K R L S T I T H P S Q T Q M A S N L L K N V Y L L * R T P P S H C R L I * S S I * T S F N D H P P V T D Tsp4CI* | CviJI | | MlyI | | PleI | | |TspGWI | | || HinfI MseI | | || | BbvII* Eco57I BslFI | | || | | MboII Eco57MI \ \ \ \\ \ \ \ \ AAGTTAAGATACGGTAAAAGCCCTGAAGACTCTCCGTATCTGTGGGAAAGAATGTCCAAG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAATTCTATGCCATTTTCGGGACTTCTGAGAGGCATAGACACCCTTTCTTACAGGTTC / / / //// / / / | | Tsp4CI* |||PleI | | Eco57MI | BslFI ||MlyI | | Eco57I MseI |TspGWI | BbvII* CviJI | MboII HinfI K L R Y G K S P E D S P Y L W E R M S K S * D T V K A L K T L R I C G K E C P S V K I R * K P * R L S V S V G K N V Q V ----:----|----:----|----:----|----:----|----:----|----:----| L N L Y P L L G S S E G Y R H S L I D L * T L I R Y F G Q L S E T D T P F F T W L * S V T F A R F V R R I Q P F S H G L Hpy188I TspDTI |TspEI \ \\ TATATAGAAATGAACGCCAAGATATTTGACGGGTTCAGAATTGACAACTGCCATTCTACT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| ATATATCTTTACTTGCGGTTCTATAAACTGCCCAAGTCTTAACTGTTGACGGTAAGATGA / / / TspDTI | TspEI Hpy188I Y I E M N A K I F D G F R I D N C H S T I * K * T P R Y L T G S E L T T A I L L Y R N E R Q D I * R V Q N * Q L P F Y S ----:----|----:----|----:----|----:----|----:----|----:----| Y I S I F A L I N S P N L I S L Q W E V T Y L F S R W S I Q R T * F Q C S G N * I Y F H V G L Y K V P E S N V V A M R S FatI AflIII BspLU11I* |CviAII || NspI || NlaIII SspI MaeI BsiYI* SetI \\ \ \ \ \ \ CCAATACATGTTGGCGAATATTTCCTAGATTTGGCAAGAAAATACAACCCGAACCTATAT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTATGTACAACCGCTTATAAAGGATCTAAACCGTTCTTTTATGTTGGGCTTGGATATA / // / / / | || SspI BsiYI* SetI | |BspLU11I* MaeI | |AflIII | |FatI | CviAII NlaIII NspI P I H V G E Y F L D L A R K Y N P N L Y Q Y M L A N I S * I W Q E N T T R T Y M N T C W R I F P R F G K K I Q P E P I C ----:----|----:----|----:----|----:----|----:----|----:----| G I C T P S Y K R S K A L F Y L G F R Y E L V H Q R I N G L N P L F I C G S G I W Y M N A F I E * I Q C S F V V R V * I CviRI* | AluI NlaIV | CviJI | Hpy188I Tsp4CI* | | SetI | | MaeI |BseRI \ \ \ \ \ \ \\ GTCGTTGCAGAGCTGTTTTCTGGTTCCGAAACACTAGATTGTCTGTTTGTTGAACGGTTG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCAACGTCTCGACAAAAGACCAAGGCTTTGTGATCTAACAGACAAACAACTTGCCAAC / / / / / / / | | CviJI | Hpy188I MaeI Tsp4CI* | | AluI NlaIV BseRI | SetI CviRI* V V A E L F S G S E T L D C L F V E R L S L Q S C F L V P K H * I V C L L N G W R C R A V F W F R N T R L S V C * T V G ----:----|----:----|----:----|----:----|----:----|----:----| T T A S S N E P E S V S S Q R N T S R N H R Q L A T K Q N R F V L N D T Q Q V T D N C L Q K R T G F C * I T Q K N F P Q CviRI* |MwoI ||Cac8I ||BsrDI ||| BssKI ||| CviJI ||| EcoRII ||| | ScrFI ||| | BseBI ||| | | AsuI* XbaI MseI ||| | | AvaII MboII | MnlI ||| | | |BmgT120I |MaeI | | MnlI ||| | | || Ksp632I* |Hpy178III* | | |Hpy188I ||| | | || |Hpy188I || MboII \ \ \\ \\\ \ \ \\ \\ \\ \ GGTATCTCCTCTTTAATCAGAGAGGCAATGCAAGCCTGGTCCGAAGAAGAGTTGTCTAGA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAGAGGAGAAATTAGTCTCTCCGTTACGTTCGGACCAGGCTTCTTCTCAACAGATCT // // / / / / / /// / / /// || |Hpy188I | | | | | ||| Ksp632I* | ||XbaI || MnlI | | | | | ||Hpy188I | |Hpy178III* |MseI | | | | | ||AvaII | |MaeI MnlI | | | | | ||AsuI* | MboII | | | | | |BmgT120I MboII | | | | | EcoRII | | | | | BssKI | | | | BseBI | | | | ScrFI | | | CviJI | | Cac8I | CviRI* | BsrDI MwoI G I S S L I R E A M Q A W S E E E L S R V S P L * S E R Q C K P G P K K S C L D Y L L F N Q R G N A S L V R R R V V * I ----:----|----:----|----:----|----:----|----:----|----:----| P I E E K I L S A I C A Q D S S S N D L P Y R R K L * L P L A L R T R L L T T * T D G R * D S L C H L G P G F F L Q R S FauI |MslI ||FatI AsuI* |||BstXI |CviJI |||CviAII |HaeIII ||||MnlI |BmgT120I ||||| NlaIII || CviJI ||||| |AciI || |NlaIV Hin4I BseGI \\\\\ \\ \\ \\ \ \ TTAGTCCATAAGCATGGCGGGAGGCCCATTGGCTCCTATAAGTTTGTTCCTATGGATGAC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| AATCAGGTATTCGTACCGCCCTCCGGGTAACCGAGGATATTCAAACAAGGATACCTACTG / /// // / /// // / / | ||| || AciI ||AsuI* |NlaIV Hin4I BseGI | ||| |FatI || CviJI | ||| CviAII |BmgT120I | ||MnlI HaeIII | |NlaIII CviJI | |FauI | MslI BstXI L V H K H G G R P I G S Y K F V P M D D * S I S M A G G P L A P I S L F L W M T S P * A W R E A H W L L * V C S Y G * L ----:----|----:----|----:----|----:----|----:----|----:----| N T W L C P P L G M P E * L N T G I S S I L G Y A H R S A W Q S R Y T Q E * P H * D M L M A P P G N A G I L K N R H I V Hin4I | MseI | VspI MlyI | |TspEI PleI | || MnlI | BsaXI | || |MseI | BseRI FokI AciI | || ||AhaIII* | | HinfI \ \ \ \\ \\\ \ \ \ TTCTCATATCCTGCGGATATTAATTTAAACGAGGAGCATTGTTTCAACGACTCCAACGAT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AAGAGTATAGGACGCCTATAATTAAATTTGCTCCTCGTAACAAAGTTGCTGAGGTTGCTA / / / // /// // / | | AciI || ||MseI |BseRI HinfI | Hin4I || |AhaIII* |PleI FokI || TspEI BsaXI |MnlI MlyI VspI MseI F S Y P A D I N L N E E H C F N D S N D S H I L R I L I * T R S I V S T T P T I L I S C G Y * F K R G A L F Q R L Q R * ----:----|----:----|----:----|----:----|----:----|----:----| K E Y G A S I L K F S S C Q K L S E L S S R M D Q P Y * N L R P A N N * R S W R E * I R R I N I * V L L M T E V V G V I BsaBI |BsaXI ||MmeI ||| Hpy188I ||| | MboI ||| | | DpnI ||| | | |FatI ||| | | |BspHI ||| | | |BstKTI ||| | | ||CviAII ||| | | ||Hpy178III* ||| | | ||| TfiI ||| | | ||| HinfI MseI ||| | | ||| NlaIII |EciI ||| | | ||| | BsaXI || AciI AciI TspDTI \\\ \ \ \\\ \ \ \\ \ \ \ AACTCCATAAGATGTGTATCAGAGATCATGATTCCAAAGATTTTAACCGCCACTCCGCCA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAGGTATTCTACACATAGTCTCTAGTACTAAGGTTTCTAAAATTGGCGGTGAGGCGGT / / / //// // / / / / // | | | |||| || HinfI | | AciI |TspDTI | | | |||| || BsaXI | MseI AciI | | | |||| || TfiI EciI | | | |||| |BspHI | | | |||| |FatI | | | |||| Hpy178III* | | | |||| CviAII | | | |||MboI | | | ||NlaIII | | | |DpnI | | | BstKTI | | Hpy188I | BsaBI | MmeI BsaXI N S I R C V S E I M I P K I L T A T P P T P * D V Y Q R S * F Q R F * P P L R H L H K M C I R D H D S K D F N R H S A T ----:----|----:----|----:----|----:----|----:----|----:----| L E M L H T D S I M I G F I K V A V G G Y S W L I H I L S * S E L S K L R W E A V G Y S T Y * L D H N W L N * G G S R W BsaXI | FatI | |CviAII | || NlaIII | || | Tsp4CI* | || | |Csp6I | || | ||RsaI | || | ||| FatI | || | ||| |CviAII MnlI | || | ||| || NlaIII | BciVI | || | ||| || |MslI TspDTI | Tsp4CI* \ \\ \ \\\ \\ \\ \ \ \ CACGCTTTATTCATGGACTGTACCCATGATAATGAAACTCCCTTTGAAAAAAGAACAGTG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| GTGCGAAATAAGTACCTGACATGGGTACTATTACTTTGAGGGAAACTTTTTTCTTGTCAC / / // / // / /// / / / BsaXI | || | || | ||MslI TspDTI | Tsp4CI* | || | || | |FatI | BciVI | || | || | CviAII TspRI | || | || NlaIII MnlI | || | |Csp6I | || | RsaI | || Tsp4CI* | |FatI | CviAII NlaIII H A L F M D C T H D N E T P F E K R T V T L Y S W T V P M I M K L P L K K E Q W R F I H G L Y P * * * N S L * K K N S G ----:----|----:----|----:----|----:----|----:----|----:----| C A K N M S Q V W S L S V G K S F L V T V R K I * P S Y G H Y H F E R Q F F F L V S * E H V T G M I I F S G K F F S C H TseI |BisI ||BlsI MboI ||XcmI XhoII |||CviRI* |TsoI |||| MwoI ||DpnI TspRI |||| | CviJI |||BstKTI | BbvI |||| | | EciI AciI |||| BinI* \ \ \\\\ \ \ \ \ \\\\ \ GAGGATACTTTGCCCAATGCTGCATTGGTGGCTCTTTGCTCGTCCGCCATTGGATCTGTT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTATGAAACGGGTTACGACGTAACCACCGAGAAACGAGCAGGCGGTAACCTAGACAA / /// / / / / // / BbvI ||| MwoI CviJI AciI | || XhoII ||CviRI* EciI | || MboI ||TseI | |DpnI |BisI | BstKTI XcmI TsoI BlsI E D T L P N A A L V A L C S S A I G S V R I L C P M L H W W L F A R P P L D L F G Y F A Q C C I G G S L L V R H W I C L ----:----|----:----|----:----|----:----|----:----|----:----| S S V K G L A A N T A R Q E D A M P D T P P Y K A W H Q M P P E K S T R W Q I Q L I S Q G I S C Q H S K A R G G N S R N Hpy99I |ApoI |TspEI || XmnI || | BdaI ApoI MaeIII BdaI CviJI || | BdaI TspEI Tsp45I TspRI BdaI \ \\ \ \ \ \ \ \ TATGGCTACGACGAAATTTTTCCACATTTACTGAATTTGGTCACTGAAAAAAGACATTAT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| ATACCGATGCTGCTTTAAAAAGGTGTAAATGACTTAAACCAGTGACTTTTTTCTGTAATA / / / /// / / / / | | Hpy99I ||BdaI | | Tsp45I BdaI | CviJI ||BdaI | | MaeIII BdaI BinI* |TspEI | TspRI |ApoI TspEI XmnI ApoI Y G Y D E I F P H L L N L V T E K R H Y M A T T K F F H I Y * I W S L K K D I M W L R R N F S T F T E F G H * K K T L * ----:----|----:----|----:----|----:----|----:----|----:----| * P * S S I K G C K S F K T V S F L C * K H S R R F K E V N V S N P * Q F F V N I A V V F N K W M * Q I Q D S F F S M I BsrI | CviJI | | TaqI CviJI ApoI | | | BsiYI* HaeIII TspEI | | | | MnlI | TsoI EcoRI \ \ \ \ \ \ \ \ GACATTTCTACGCCTACTGGTAGCCCCTCGATAGGAATAACCAAAGTCAAGGCCACTTTG 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTAAAGATGCGGATGACCATCGGGGAGCTATCCTTATTGGTTTCAGTTCCGGTGAAAC / / / / / / | | | TaqI MnlI HaeIII | | BsiYI* CviJI | CviJI TsoI BsrI D I S T P T G S P S I G I T K V K A T L T F L R L L V A P R * E * P K S R P L * H F Y A Y W * P L D R N N Q S Q G H F E ----:----|----:----|----:----|----:----|----:----|----:----| S M E V G V P L G E I P I V L T L A V K H C K * A * Q Y G R S L F L W L * P W K V N R R R S T A G R Y S Y G F D L G S Q HinfI | DdeI | | BbvII* | | |Hpy188I | | || MboII | | || | FatI | | || | CviRI* | | || | |HphI MlyI | | || | |CviAII TaqI PleI | | || | ||EcoT22I \ \ \ \ \\ \ \\\ AATTCGATTAGAACGAGTATAGGAGAAAAGGCGTATGACATTGAAGACTCAGAAATGCAT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGCTAATCTTGCTCATATCCTCTTTTCCGCATACTGTAACTTCTGAGTCTTTACGTA / / // /// // / // | TaqI |PleI ||| || | |BseMII EcoRI MlyI ||| || | |CviAII TspEI ||| || | BspCNI ApoI ||| || CviRI* ||| || NlaIII ||| || NspI ||| || HphI ||| |EcoT22I ||| BbvII* ||| MboII ||DdeI |Hpy188I HinfI N S I R T S I G E K A Y D I E D S E M H I R L E R V * E K R R M T L K T Q K C M F D * N E Y R R K G V * H * R L R N A C ----:----|----:----|----:----|----:----|----:----|----:----| F E I L V L I P S F A Y S M S S E S I C S N S * F S Y L L F P T H C Q L S L F A I R N S R T Y S F L R I V N F V * F H M NspI NlaIII BspCNI |BseMII ||CviRI* ||| BssKI ||| EcoRII ||| |SecI* ||| ||ScrFI ||| ||BseBI ||| ||| AsuI* ||| ||| SfaNI ||| ||| |BmgT120I ||| ||| ||CviJI MseI ||| ||| ||HaeIII |BseGI ||| ||| |||BsrI || BetI* ||| ||| |||| TatI || BspMII* ||| ||| |||| |Csp6I || |HpaII ||| ||| |||| ||RsaI Hin4I || |Hpy178III* ||| ||| |||| ||TspDTI Hin4I || || FokI SetI \\\ \\\ \\\\ \\\ \ \\ \\ \ \ GTGCATCACCAGGGCCAGTACATTACTTTTCATCGTATGGATGTTAAATCCGGAAAAGGT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CACGTAGTGGTCCCGGTCATGTAATGAAAAGTAGCATACCTACAATTTAGGCCTTTTCCA / / / ///// /// / / / // / / | CviRI* | ||||| ||TatI Hin4I | MseI || | Hin4I FatI | ||||| |Csp6I Hin4I BseGI || | Hin4I | ||||| RsaI || FokI | ||||TspDTI || SetI | |||SfaNI |BspMII* | ||AsuI* |BetI* | |BmgT120I Hpy178III* | |HaeIII HpaII | |CviJI | EcoRII | BssKI | SecI* | BsrI BseBI ScrFI V H H Q G Q Y I T F H R M D V K S G K G C I T R A S T L L F I V W M L N P E K V A S P G P V H Y F S S Y G C * I R K R L ----:----|----:----|----:----|----:----|----:----|----:----| T C * W P W Y M V K * R I S T L D P F P H A D G P G T C * K E D Y P H * I R F L H M V L A L V N S K M T H I N F G S F T Csp6I Hin4I ApoI FokI Hin4I TspEI Hpy188I |RsaI |BseGI | TspDTI BsmAI \\ \\ \ \ \ TGGTACTTGATAGCAAGGATGAAATTTTCTGACAATGATGACCCTAACGAGACTTTACCA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| ACCATGAACTATCGTTCCTACTTTAAAAGACTGTTACTACTGGGATTGCTCTGAAATGGT // / / / / / / / |Csp6I | | | | FokI BsmAI TspRI RsaI | | | TspDTI BsrI | | Hpy188I | TspEI | ApoI BseGI W Y L I A R M K F S D N D D P N E T L P G T * * Q G * N F L T M M T L T R L Y H V L D S K D E I F * Q * * P * R D F T T ----:----|----:----|----:----|----:----|----:----|----:----| Q Y K I A L I F N E S L S S G L S V K G N T S S L L S S I K Q C H H G * R S K V P V Q Y C P H F K R V I I V R V L S * W TspRI BspCNI BsrI | MseI SetI DdeI SetI |BseMII \ \ \ \ \ \ \\ CCAGTGGTGTTAAACCAATCCACCTGTTCTCTCAGGTTTTCGTATGCTTTGGAAAGAGTT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCACCACAATTTGGTTAGGTGGACAAGAGAGTCCAAAAGCATACGAAACCTTTCTCAA / / // // MseI SetI |DdeI |BseMII SetI BspCNI P V V L N Q S T C S L R F S Y A L E R V Q W C * T N P P V L S G F R M L W K E L S G V K P I H L F S Q V F V C F G K S W ----:----|----:----|----:----|----:----|----:----|----:----| G T T N F W D V Q E R L N E Y A K S L T V L P T L G I W R N E * T K T H K P F L W H H * V L G G T R E P K R I S Q F S N BtgZI |TspDTI || TspDTI || | Hpy99I Hin4II* ApoI || | | ApoI TspEI | AluI TspEI || | | TspEI MseI SetI | MseI | CviJI \ \\ \ \ \ \ \ \ \ \ \ GGCGATGAAATTCCCAACGACGATAAATTCATTAAAGGTATTCCCACGAAATTAAAGGAG 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCTACTTTAAGGGTTGCTGCTATTTAAGTAATTTCCATAAGGGTGCTTTAATTTCCTC / /// / / // // // / | ||| BtgZI | |SetI || || CviJI | ||TspDTI | MseI || || AluI | |Hpy99I TspEI || |SetI | TspDTI ApoI || Hin4II* TspEI |MseI ApoI TspEI G D E I P N D D K F I K G I P T K L K E A M K F P T T I N S L K V F P R N * R S R * N S Q R R * I H * R Y S H E I K G A ----:----|----:----|----:----|----:----|----:----|----:----| P S S I G L S S L N M L P I G V F N F S Q R H F E W R R Y I * * L Y E W S I L P A I F N G V V I F E N F T N G R F * L L TfiI MboII HinfI | BdaI | DdeI | BdaI SetI | | BcgI | | Bce83I* \ \ \ \ \ \ \ CTTGAAGGGTTTGACATTTCTTATGATGATTCTAAGAAGATTTCAACGATAAAACTGCCC 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTTCCCAAACTGTAAAGAATACTACTAAGATTCTTCTAAAGTTGCTATTTTGACGGG / // / / / | |DdeI | | Bce83I* | BcgI | BdaI HinfI | BdaI TfiI MboII L E G F D I S Y D D S K K I S T I K L P L K G L T F L M M I L R R F Q R * N C P * R V * H F L * * F * E D F N D K T A Q ----:----|----:----|----:----|----:----|----:----|----:----| S S P N S M E * S S E L F I E V I F S G A Q L T Q C K K H H N * S S K L S L V A K F P K V N R I I I R L L N * R Y F Q G MboI XhoII |TspDTI ||DpnI |||BstKTI ||||MnlI ||||| BinI* ||||| | BdaI ApoI ||||| | BdaI Hpy166II TspEI BcgI ||||| | | BsmAI | TfiI EcoRI |SmlI ||||| | | Eco31I BstXI | HinfI \ \\ \\\\\ \ \ \ \ \ \ AATGAATTCCCTCAAGGATCTATTGCCATTTTTGAGACCCAACAGAATGGTGTGGACGAA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTAAGGGAGTTCCTAGATAACGGTAAAAACTCTGGGTTGTCTTACCACACCTGCTT / / //// // / / / EcoRI | |||| |BinI* Eco31I BstXI Hpy166II TspEI | |||| BdaI BsmAI BcgI | |||| BdaI ApoI | |||XhoII | |||MboI | ||MnlI | |DpnI | BstKTI TspDTI SmlI N E F P Q G S I A I F E T Q Q N G V D E M N S L K D L L P F L R P N R M V W T N * I P S R I Y C H F * D P T E W C G R I ----:----|----:----|----:----|----:----|----:----|----:----| L S N G * P D I A M K S V W C F P T S S W H I G E L I * Q W K Q S G V S H H P R I F E R L S R N G N K L G L L I T H V F HinfI SetI | XbaI | MseI | |MaeI DdeI | |AhaIII* | |Hpy178III* | MboI | || MwoI | || DrdI | | DpnI | || | CviJI MlyI | || |HinfI | | |BstKTI PsiI SetI | || | HaeIII PleI | || || TspGWI \ \ \\ \ \ \ \\ \ \ \ \ \\ \\ \ TCCTTAGATCATTTTATAAGGTCAGGTGCTTTAAAGGCCACTTCAAGTTTGACTCTAGAG 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAATCTAGTAAAATATTCCAGTCCACGAAATTTCCGGTGAAGTTCAAACTGAGATCTC / /// / / / / /// / // // // | ||| MboI | SetI SetI ||| HaeIII |PleI || |TspGWI | ||DpnI PsiI ||| CviJI MlyI || |XbaI | |BstKTI ||MseI || Hpy178III* | DdeI |AhaIII* || MaeI HinfI MwoI |DrdI TfiI HinfI S L D H F I R S G A L K A T S S L T L E P * I I L * G Q V L * R P L Q V * L * S L R S F Y K V R C F K G H F K F D S R V ----:----|----:----|----:----|----:----|----:----|----:----| D K S * K I L D P A K F A V E L K V R S I R L D N * L T L H K L P W K L N S E L G * I M K Y P * T S * L G S * T Q S * L BcgI MboII | Hin6I | |GlaI | ||HhaI | ||MroNI | ||SgrAI | ||Cfr10I | ||Hin4II* | ||Sse232I* ApoI | |||HpaII PleI | |||HaeII TspEI CviJI | ||||NaeI |MlyI |HpaII | ||||Cac8I \\ \\ \ \\\\\ TCAATAAATTCCGTCTTGTATCGTAGTGAGCCGGAAGAATACGATGTTAGCGCCGGCGAA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTATTTAAGGCAGAACATAGCATCACTCGGCCTTCTTATGCTACAATCGCGGCCGCTT / / / / / // //// /// / HinfI | TspEI | HpaII || |||| ||| SetI | ApoI CviJI || |||| ||Sse232I* PleI || |||| ||Cfr10I MlyI || |||| ||SgrAI || |||| ||MroNI || |||| |HpaII || |||| Cac8I || |||| NaeI || |||Hin6I || ||Hin4II* || ||GlaI || |HhaI || HaeII |MboII BcgI S I N S V L Y R S E P E E Y D V S A G E Q * I P S C I V V S R K N T M L A P A K N K F R L V S * * A G R I R C * R R R R ----:----|----:----|----:----|----:----|----:----|----:----| D I F E T K Y R L S G S S Y S T L A P S T L L N R R T D Y H A P L I R H * R R R * Y I G D Q I T T L R F F V I N A G A F TstI CviRI* BcgI |TstI |TspEI || TspGWI SetI || BsiYI* CviJI || | SetI \ \\ \ \ \\ \ \ GGTGGTGCTTATATTATTCCTAATTTTGGAAAGCCTGTGTATTGTGGTCTGCAAGGTTGG 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCACGAATATAATAAGGATTAAAACCTTTCGGACACATAACACCAGACGTTCCAACC / / / / / / /// | | | TspEI CviJI | ||SetI | | BsiYI* | |TspGWI | BcgI | CviRI* TstI TstI G G A Y I I P N F G K P V Y C G L Q G W V V L I L F L I L E S L C I V V C K V G W C L Y Y S * F W K A C V L W S A R L G ----:----|----:----|----:----|----:----|----:----|----:----| P P A * I I G L K P F G T Y Q P R C P Q L H H K Y * E * N Q F A Q T N H D A L N T T S I N N R I K S L R H I T T Q L T P CviRI* | AjuI | ApoI | TspEI | TspRI MseI TspEI FokI BseGI DdeI | |MnlI \ \ \ \ \ \ \\ GTTTCCGTATTAAGAAAAATTGTGTTTTACAATGATTTAGCACATCCCCTCAGTGCAAAT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGGCATAATTCTTTTTAACACAAAATGTTACTAAATCGTGTAGGGGAGTCACGTTTA / / / / / / / / / MseI TspEI FokI BseGI | | | | BspCNI | | | MnlI | | CviRI* | DdeI | AjuI TspRI V S V L R K I V F Y N D L A H P L S A N F P Y * E K L C F T M I * H I P S V Q I F R I K K N C V L Q * F S T S P Q C K F ----:----|----:----|----:----|----:----|----:----|----:----| T E T N L F I T N * L S K A C G R L A F P K R I L F F Q T K C H N L V D G * H L N G Y * S F N H K V I I * C M G E T C I AccI MseI |Hpy166II |BspCNI || MseI ||BseMII CviJI AjuI || |TspEI SfeI* \\\ \ \ \\ \\ \ TTAAGAAATGGACATTGGGCTTTAGACTACACTATCAGTAGACTTAATTACTATAGCGAT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| AATTCTTTACCTGTAACCCGAAATCTGATGTGATAGTCATCTGAATTAATGATATCGCTA / / / / // / / / | MseI | AjuI |AccI | TspEI SfeI* BseMII CviJI | MseI TspEI Hpy166II ApoI L R N G H W A L D Y T I S R L N Y Y S D * E M D I G L * T T L S V D L I T I A M K K W T L G F R L H Y Q * T * L L * R * ----:----|----:----|----:----|----:----|----:----|----:----| K L F P C Q A K S * V I L L S L * * L S N L F H V N P K L S C * * Y V * N S Y R * S I S M P S * V V S D T S K I V I A I TfiI HinfI | BtgZI | | TspDTI | | | BbvI | | | | CviRI* | | | | | MwoI | | | | | | TspDTI | | | | | | |TseI | | | | | | |CviJI | | | | | | ||BisI | | | | | | ||BsrI BsgI | | | | | | |||BlsI | SetI MaeIII \ \ \ \ \ \ \\\\ \ \ \ GAAGCAGGAATCAATGAAGTGCAGAACTGGCTGCGTTCAAGGTTTGATAGAGTGAAAAAG 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGTCCTTAGTTACTTCACGTCTTGACCGACGCAAGTTCCAAACTATCTCACTTTTTC // / / / / ///// // || BtgZI | | | ||||TseI |SetI |TspDTI | | | |||BisI BsgI HinfI | | | ||BlsI TfiI | | | |CviJI | | | BsrI | | TspDTI | MwoI CviRI* BbvI E A G I N E V Q N W L R S R F D R V K K K Q E S M K C R T G C V Q G L I E * K S S R N Q * S A E L A A F K V * * S E K V ----:----|----:----|----:----|----:----|----:----|----:----| S A P I L S T C F Q S R E L N S L T F F H L L F * H L A S S A A N L T Q Y L S F F C S D I F H L V P Q T * P K I S H F L AluI CviJI | SetI BsrI FokI | | DdeI SduI | MseI SfaNI | | | BfiI BseSI | |TspEI BseGI | MnlI \ \ \ \ \ \ \\ \ \ \ TTACCGAGCTACTTAGTGCCCAGTTATTTCGCCTTAATTATCGGCATCCTCTATGGTTGT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| AATGGCTCGATGAATCACGGGTCAATAAAGCGGAATTAATAGCCGTAGGAGATACCAACA / / / / // / // / / / | | | | || BsrI || | BseGI SfaNI | | | | |BseSI || TspEI MnlI | | | | |SduI |MseI | | | | DdeI FokI | | | BfiI | | CviJI | | AluI | SetI MaeIII L P S Y L V P S Y F A L I I G I L Y G C Y R A T * C P V I S P * L S A S S M V V T E L L S A Q L F R L N Y R H P L W L L ----:----|----:----|----:----|----:----|----:----|----:----| N G L * K T G L * K A K I I P M R * P Q T V S S S L A W N N R R L * R C G R H N * R A V * H G T I E G * N D A D E I T T TatI AluI Bsp1407I CviJI |Csp6I MseI BslFI | SetI SspI ||RsaI \ \ \ \ \ \\\ TGTCGCTTAAAAGCAATACAGCTAATGTCCCGTAATATTGGTAAATCTACATTGTTTGTA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| ACAGCGAATTTTCGTTATGTCGATTACAGGGCATTATAACCATTTAGATGTAACAAACAT / / / / / // MseI | | CviJI SspI |Csp6I | | AluI RsaI | SetI BslFI C R L K A I Q L M S R N I G K S T L F V V A * K Q Y S * C P V I L V N L H C L Y S L K S N T A N V P * Y W * I Y I V C T ----:----|----:----|----:----|----:----|----:----|----:----| Q R K F A I C S I D R L I P L D V N N T N D S L L L V A L T G Y Y Q Y I * M T Q T A * F C Y L * H G T I N T F R C Q K Y HindII Hpy166II | SetI HindIII | | TspDTI | AluI | | | MnlI | CviJI BccI | | | BssKI | | SetI | Hpy178III* Hpy178III* | | | EcoRII \ \ \ \ \ \ \ \ \ \ CAAAGCTTATCTATGACATCAATCCAGATGGTTTCCAGAATGAAGTCAACCTCTATTTTA 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCGAATAGATACTGTAGTTAGGTCTACCAAAGGTCTTACTTCAGTTGGAGATAAAAT / / / / / / / // / / | | | HindIII | Hpy178III* | |SetI | MnlI | | CviJI BccI | | TspDTI | | AluI | Hpy166II | SetI | HindII Bsp1407I Hpy178III* TatI Q S L S M T S I Q M V S R M K S T S I L K A Y L * H Q S R W F P E * S Q P L F Y K L I Y D I N P D G F Q N E V N L Y F T ----:----|----:----|----:----|----:----|----:----|----:----| C L K D I V D I W I T E L I F D V E I K V F S I * S M L G S P K W F S T L R * K L A * R H C * D L H N G S H L * G R N * BccI |TseI |CviJI ||BisI ||SfeI* Hpy166II |||BlsI | FatI ScrFI XmnI ||||CviRI* | |CviAII BseBI |BbvI ||||| PstI | || NlaIII \ \\ \\\\\ \ \ \\ \ CCAGGCGAAAATGTTCCATCTATGGCTGCAGGGTTGCCACACTTTAGCGTAAACTACATG 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCCGCTTTTACAAGGTAGATACCGACGTCCCAACGGTGTGAAATCGCATTTGATGTAC / / / / //// / / / // | | XmnI BbvI |||| SfeI* | | |FatI | EcoRII |||CviRI* | | CviAII | BssKI |||TseI | NlaIII BseBI ||BisI Hpy166II ScrFI |BlsI |PstI CviJI BccI P G E N V P S M A A G L P H F S V N Y M Q A K M F H L W L Q G C H T L A * T T * R R K C S I Y G C R V A T L * R K L H E ----:----|----:----|----:----|----:----|----:----|----:----| G P S F T G D I A A P N G C K L T F * M V L R F H E M * P Q L T A V S * R L S C W A F I N W R H S C P Q W V K A Y V V H MnlI TspDTI | DdeI SetI MseI SetI \ \ \ \ \ \ AGATGTTGGGGGAGAGATGTATTCATATCGCTAAGAGGTATGCTATTAACAACAGGTAGA 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| TCTACAACCCCCTCTCTACATAAGTATAGCGATTCTCCATACGATAATTGTTGTCCATCT / / // / / TspDTI MnlI |SetI MseI SetI DdeI R C W G R D V F I S L R G M L L T T G R D V G G E M Y S Y R * E V C Y * Q Q V D M L G E R C I H I A K R Y A I N N R * I ----:----|----:----|----:----|----:----|----:----|----:----| L H Q P L S T N M D S L P I S N V V P L S I N P S L H I * I A L L Y A I L L L Y S T P P S I Y E Y R * S T H * * C C T S AluI CviJI | SetI | | AluI | | CviJI FatI | | | SetI |CviAII | | | | TspDTI || NlaIII | | | | | MaeI || | MseI | | | | | | CviJI CviRI* || | |TspEI \ \ \ \ \ \ \ \ \\ \ \\ TTTGATGAAGCTAAAGCTCATATACTAGCCTTTGCAAAGACTTTGAAGCATGGTTTAATT 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTACTTCGATTTCGAGTATATGATCGGAAACGTTTCTGAAACTTCGTACCAAATTAA / / / / / // / / // / / | | | | TspDTI |CviJI CviRI* | |FatI | TspEI | | | CviJI MaeI | | MseI | | | AluI | CviAII | | SetI NlaIII | CviJI | AluI SetI F D E A K A H I L A F A K T L K H G L I L M K L K L I Y * P L Q R L * S M V * F * * S * S S Y T S L C K D F E A W F N S ----:----|----:----|----:----|----:----|----:----|----:----| N S S A L A * I S A K A F V K F C P K I I Q H L * L E Y V L R Q L S K S A H N L K I F S F S M Y * G K C L S Q L M T * N FokI | AvaI | |BmeT110I | || BbvI | || SfaNI | || | BsiI* | || | | Hpy178III* | || | | | MwoI | || | | | | TseI | || | | | | |BisI | || | | | | ||BlsI | || | | | | ||MboII | || | | | | |||BssKI Cfr10I | || | | | | |||EcoRII |HpaII | || | | | | |||| ScrFI SfaNI ||BseGI | || | | | | |||| BseBI \ \\\ \ \\ \ \ \ \ \\\\ \ CCAAACTTGCTGGATGCCGGTAGAAACCCGAGATATAATGCTCGTGATGCTGCCTGGTTC 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTGAACGACCTACGGCCATCTTTGGGCTCTATATTACGAGCACTACGACGGACCAAG / / // /// / / / /// / / SfaNI | |Cfr10I ||AvaI | | | ||| | EcoRII | HpaII |BmeT110I | | | ||| | BssKI BseGI FokI | | | ||| BseBI | | | ||| ScrFI | | | ||TseI | | | |BisI | | | MboII | | | BlsI | | Hpy178III* | | BsiI* | MwoI SfaNI BbvI P N L L D A G R N P R Y N A R D A A W F Q T C W M P V E T R D I M L V M L P G S K L A G C R * K P E I * C S * C C L V L ----:----|----:----|----:----|----:----|----:----|----:----| G F K S S A P L F G L Y L A R S A A Q N E L S A P H R Y F G S I Y H E H H Q R T W V Q Q I G T S V R S I I S T I S G P E CviRI* | Cac8I | | AluI | | CviJI | | | TatI | | | SetI | | | Bsp1407I | | | |Csp6I BccI | | | ||RsaI | Hpy178III* SspI \ \ \ \\\ \ \ \ TTCTTGCAAGCTGTACAGGATTATGTTTATATTGTTCCTGATGGCGAAAAAATATTACAA 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| AAGAACGTTCGACATGTCCTAATACAAATATAACAAGGACTACCGCTTTTTTATAATGTT / / / /// / / / | | | ||Bsp1407I | Hpy178III* SspI | | | ||TatI BccI | | | |Csp6I | | | RsaI | | CviJI | | AluI | Cac8I | SetI CviRI* F L Q A V Q D Y V Y I V P D G E K I L Q S C K L Y R I M F I L F L M A K K Y Y K L A S C T G L C L Y C S * W R K N I T R ----:----|----:----|----:----|----:----|----:----|----:----| K K C A T C S * T * I T G S P S F I N C R R A L Q V P N H K Y Q E Q H R F F I V E Q L S Y L I I N I N N R I A F F Y * L FokI | SfeI* | | BinI* | | | MboI | | | | DpnI | | | | |BstKTI BsrI | | | | ||StyI TfiI TspRI | | | | ||SecI* MaeIII HinfI | BseGI | | | | ||| BaeI \ \ \ \ \ \ \ \ \\\ \ GAGCAAGTAACAAGGAGATTCCCACTGGATGATACTTACATTCCTGTAGATGATCCAAGG 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGTTCATTGTTCCTCTAAGGGTGACCTACTATGAATGTAAGGACATCTACTAGGTTCC / / / / / // // / / MaeIII HinfI | BseGI | || || | SecI* TspRI BsrI | || || | StyI TfiI | || || MboI | || || BaeI | || |DpnI | || BstKTI | |SfeI* | BinI* FokI E Q V T R R F P L D D T Y I P V D D P R S K * Q G D S H W M I L T F L * M I Q G A S N K E I P T G * Y L H S C R * S K G ----:----|----:----|----:----|----:----|----:----|----:----| S C T V L L N G S S S V * M G T S S G L L A L L L S I G V P H Y K C E Q L H D L L L Y C P S E W Q I I S V N R Y I I W P TspDTI |FatI MaeI ||CviAII | Csp6I |||Cac8I | |MnlI |||| SphI | |RsaI MboI |||| NspI | || StyI | DpnI BseRI |||| NlaIII | || SecI* | |BstKTI |ApoI |||| |StyI MaeIII | || | SetI | ||BaeI |TspEI |||| |SecI* \ \ \\ \ \ \ \\\ \\ \\\\ \\ GCATTTAGTTACTCTAGTACCTTGGAGGAGATCATTTATGAAATTTTGAGTAGGCATGCC 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAAATCAATGAGATCATGGAACCTCCTCTAGTAAATACTTTAAAACTCATCCGTACGG / //// / / // / / / / / /// | |||| | | || MboI BseRI TspEI | | ||FatI | |||| | | |DpnI ApoI | | |CviAII | |||| | | BstKTI | | Cac8I | |||| | BaeI | NlaIII | |||| SecI* | NspI | |||| StyI | SphI | |||Csp6I TspDTI | ||RsaI | ||SetI | |MnlI | MaeI MaeIII A F S Y S S T L E E I I Y E I L S R H A H L V T L V P W R R S F M K F * V G M P I * L L * Y L G G D H L * N F E * A C Q ----:----|----:----|----:----|----:----|----:----|----:----| A N L * E L V K S S I M * S I K L L C A P M * N S * Y R P P S * K H F K S Y A H C K T V R T G Q L L D N I F N Q T P M G TspEI | MseI CviRI* | | ApoI | AsuI* | | TspEI | AvaII | | | MnlI | |BmgT120I | | | | Hpy188I | ||SetI MboI | | | | | BspMI | ||| ApoI | DpnI | | | | | | CviJI | ||| TspEI | |BstKTI \ \ \ \ \ \ \ \ \\\ \ \ \\ AAGGGAATTAAATTCAGAGAGGCTAATGCAGGTCCAAATTTAGATCGTGTTATGACTGAT 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCCTTAATTTAAGTCTCTCCGATTACGTCCAGGTTTAAATCTAGCACAATACTGACTA / /// // // // // / // / SecI* ||| || || || |AvaII | || MboI StyI ||| || || || |AsuI* | |DpnI ||| || || || | | BstKTI ||| || || || | TspEI ||| || || || | ApoI ||| || || || BmgT120I ||| || || |SetI ||| || || CviRI* ||| || |BspMI ||| || CviJI ||| |Hpy188I ||| TspEI ||| ApoI ||MnlI |MseI TspEI K G I K F R E A N A G P N L D R V M T D R E L N S E R L M Q V Q I * I V L * L I G N * I Q R G * C R S K F R S C Y D * * ----:----|----:----|----:----|----:----|----:----|----:----| L P I L N L S A L A P G F K S R T I V S W P F * I * L P * H L D L N L D H * S Q L S N F E S L S I C T W I * I T N H S I SalI |TaqI |AccI ||HindII ||Hpy166II ||| TspDTI ||| | CviJI ||| | |BsrI ||| | ||MseI ||| | |||TspEI ||| | |||| FatI ||| | |||| |CviAII ApoI ||| | |||| || NlaIII TspEI ||| | |||| || | MboI | FatI ||| | |||| || | XhoII | |CviAII ||| | |||| || | | DpnI MseI | || NlaIII ||| | |||| || | | |BstKTI | TspDTI | || |TaqI ||| | |||| || | | ||DdeI \ \ \ \\ \\ \\\ \ \\\\ \\ \ \ \\\ AAAGGGTTTAATGTTGAAATTCATGTCGATTGGTCGACTGGCTTAATTCATGGTGGATCT 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCCCAAATTACAACTTTAAGTACAGCTAACCAGCTGACCGAATTAAGTACCACCTAGA / / / // / /// // / / // // / | MseI | || TaqI ||| || | | || || XhoII TspDTI | |FatI ||| || | | || || MboI | CviAII ||| || | | || |DpnI NlaIII ||| || | | || BstKTI TspEI ||| || | | |FatI ApoI ||| || | | CviAII ||| || | NlaIII ||| || | TspEI ||| || MseI ||| |CviJI ||| BsrI ||SalI |AccI |TaqI Hpy166II HindII TspDTI K G F N V E I H V D W S T G L I H G G S K G L M L K F M S I G R L A * F M V D L R V * C * N S C R L V D W L N S W W I S ----:----|----:----|----:----|----:----|----:----|----:----| L P N L T S I * T S Q D V P K I * P P D Y L T * H Q F E H R N T S Q S L E H H I F P K I N F N M D I P R S A * N M T S R Tsp4CI* | BspCNI | |BseMII | ||Csp6I TaqII | |||BccI | BccI BinI* | |||RsaI | | BseGI FokI HphI AlwNI \ \ \\\\ \ \ \ \ \ \ CAGTATAACTGTGGTACTTGGATGGATAAGATGGGTGAAAGTGAAAAAGCAGGGTCTGTT 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| GTCATATTGACACCATGAACCTACCTATTCTACCCACTTTCACTTTTTCGTCCCAGACAA / / /// // / // / / / | | ||| || | |BccI FokI HphI AlwNI | | ||| || | BseGI | | ||| || TaqII | | ||| |Csp6I | | ||| |BccI | | ||| RsaI | | ||BseMII | | |BspCNI | | Tsp4CI* | BinI* DdeI Q Y N C G T W M D K M G E S E K A G S V S I T V V L G W I R W V K V K K Q G L L V * L W Y L D G * D G * K * K S R V C W ----:----|----:----|----:----|----:----|----:----|----:----| * Y L Q P V Q I S L I P S L S F A P D T E T Y S H Y K S P Y S P H F H F L L T Q L I V T T S P H I L H T F T F F C P R N BsiYI* | NlaIV | |CviJI PfoI | ||AciI BssKI | ||BisI EcoRII | |||BlsI CviJI | ScrFI | |||TaqII | MseI | BseBI BccI | ||||TauI | |AhaIII* \ \ \ \ \\\\\ \ \\ GGTATTCCTGGAACACCCAGAGATGGAGCCGCAATAGAAATCAATGGGCTTTTAAAAAGT 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAAGGACCTTGTGGGTCTCTACCTCGGCGTTATCTTTAGTTACCCGAAAATTTTTCA / / / / ///// / // | | | BsiYI* ||||AciI | |MseI | | BccI |||BisI | AhaIII* | EcoRII ||BlsI CviJI | BssKI |TaqII | PfoI |CviJI BseBI |TauI ScrFI NlaIV G I P G T P R D G A A I E I N G L L K S V F L E H P E M E P Q * K S M G F * K V Y S W N T Q R W S R N R N Q W A F K K C ----:----|----:----|----:----|----:----|----:----|----:----| P I G P V G L S P A A I S I L P S K F L Q Y E Q F V W L H L R L L F * H A K L F T N R S C G S I S G C Y F D I P K * F T Hpy188I |Esp3I MseI SetI MseI |BsmAI \ \ \ \\ GCTTTAAGGTTTGTTATTGAACTAAAAAACAAGGGATTGTTTAAGTTTTCCGATGTGGAG 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAATTCCAAACAATAACTTGATTTTTTGTTCCCTAACAAATTCAAAAGGCTACACCTC / / / / MseI MseI | BsmAI SetI | Esp3I Hpy188I A L R F V I E L K N K G L F K F S D V E L * G L L L N * K T R D C L S F P M W R F K V C Y * T K K Q G I V * V F R C G D ----:----|----:----|----:----|----:----|----:----|----:----| A K L N T I S S F F L P N N L N E S T S H K L T Q * Q V L F C P I T * T K R H P S * P K N N F * F V L S Q K L K G I H L MboI | BdaI | BdaI | DpnI Hpy178III* | |TaqI | BdaI FauI | |ClaI TspRI | BdaI | MnlI | |BstKTI | TfiI | |TspEI | |HgaI | || BceAI | HinfI | || TaqI | || AciI | || |BinI* | | TspEI | || AsuII \ \\ \ \ \\ \\ \ \ \ \ \\ \ ACGCAGGACGGCGGGAGGATCGATTTCACTGAATGGAATCAATTACTTCAAGACAATTTC 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| TGCGTCCTGCCGCCCTCCTAGCTAAAGTGACTTACCTTAGTTAATGAAGTTCTGTTAAAG // // /// // / / / / / / |MnlI || ||| || | BceAI | TspEI | TspEI FauI || ||| || | BinI* HinfI Hpy178III* || ||| || TspRI TfiI BdaI || ||| |ClaI BdaI || ||| |TaqI || ||| MboI || ||DpnI || |BstKTI || BdaI || BdaI |HgaI AciI T Q D G G R I D F T E W N Q L L Q D N F R R T A G G S I S L N G I N Y F K T I S A G R R E D R F H * M E S I T S R Q F R ----:----|----:----|----:----|----:----|----:----|----:----| V C S P P L I S K V S H F * N S * S L K S A P R R S S R N * Q I S D I V E L C N R L V A P P D I E S F P I L * K L V I E Hin4I | MnlI | | BetI* | | BspMII* | | |BinI* | | |HpaII | | |Hpy178III* | | || MboI | | || BamHI | | || XhoII | | || | DpnI | | || | NlaIV | | || | |SfaNI | | || | |BstKTI | | || | || BinI* | | || | || | BccI | | || | || | | CviRI* | | || | || | | | BseGI | | || | || | | | | Hin4I | | || | || | | | | | FokI | | || | || | | | | | |MaeII | | || | || | | | | | ||BtrI | | || | || | | | | | ||| SetI | | || | || | | | | | ||| TaiI | | || | || | | | | | ||| | TaqII | | || | || | | | | | ||| | |Hin6I | | || | || | | | | | ||| | ||GlaI | | || | || | | | | | ||| | ||Eco47III | | || | || | | | | | ||| | |||HhaI | | || | || | | | | | ||| | ||||HaeII \ \ \\ \ \\ \ \ \ \ \ \\\ \ \\\\\ GAAAAAAGATATTATGTTCCGGAGGATCCATCACAGGATGCAGATTATGACGTGAGCGCT 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTTTCTATAATACAAGGCCTCCTAGGTAGTGTCCTACGTCTAATACTGCACTCGCGA / / / /// // / / / / / / /// //// AsuII Hin4I MnlI ||| || | | | | CviRI* | ||| |||Hin6I TaqI ||| || | | | | Hin4I | ||| ||Eco47III ||| || | | | | BseGI | ||| ||GlaI ||| || | | | BccI | ||| |HhaI ||| || | | BinI* | ||| HaeII ||| || | SfaNI | ||TaqII ||| || XhoII | ||FokI ||| || BamHI | |MaeII ||| || MboI | BtrI ||| |NlaIV TaiI ||| |DpnI SetI ||| BstKTI ||BspMII* ||BetI* |Hpy178III* |HpaII BinI* E K R Y Y V P E D P S Q D A D Y D V S A K K D I M F R R I H H R M Q I M T * A L K K I L C S G G S I T G C R L * R E R * ----:----|----:----|----:----|----:----|----:----|----:----| S F L Y * T G S S G D C S A S * S T L A R F F I N H E P P D M V P H L N H R S R F F S I I N R L I W * L I C I I V H A S TatI Bsp1407I Hpy178III* |Csp6I | BdaI TspEI MseI ||RsaI | BdaI CviJI \ \ \\\ \ \ \ AAATTGGGTGTTAATAGACGGGGGATATACAGAGATTTGTACAAATCAGGAAAGCCTTAT 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAACCCACAATTATCTGCCCCCTATATGTCTCTAAACATGTTTAGTCCTTTCGGAATA / / /// / / / TspEI MseI ||| | | CviJI ||| | Hpy178III* ||| BdaI ||| BdaI ||Bsp1407I ||TatI |Csp6I RsaI K L G V N R R G I Y R D L Y K S G K P Y N W V L I D G G Y T E I C T N Q E S L M I G C * * T G D I Q R F V Q I R K A L * ----:----|----:----|----:----|----:----|----:----|----:----| L N P T L L R P I Y L S K Y L D P F G * * I P H * Y V P S I C L N T C I L F A K F Q T N I S P P Y V S I Q V F * S L R I FatI |CviAII || NlaIII || |MslI ApoI || || BstXI MseI TspEI || || Tsp4CI* MboII | BdaI || || | HgiCI* BseMII |TspDTI | BdaI || || | | NlaIV |BspCNI \\ \ \ \\ \\ \ \ \ \\ GAAGATTATCAGTTAAGACCAAATTTTGCTATTGCCATGACTGTGGCACCAGAGTTATTT 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTAATAGTCAATTCTGGTTTAAAACGATAACGGTACTGACACCGTGGTCTCAATAAA / / / / / //// / / // | MseI | TspEI | |||| | | |BspCNI TspDTI | ApoI | |||| | | BseMII MboII BdaI | |||| | HgiCI* BdaI | |||| NlaIV | |||Tsp4CI* | ||MslI | |FatI | CviAII | BstXI NlaIII E D Y Q L R P N F A I A M T V A P E L F K I I S * D Q I L L L P * L W H Q S Y L R L S V K T K F C Y C H D C G T R V I C ----:----|----:----|----:----|----:----|----:----|----:----| S S * * N L G F K A I A M V T A G S N N H L N D T L V L N Q * Q W S Q P V L T I F I I L * S W I K S N G H S H C W L * K DdeI Bpu10I | FatI | |CviAII | ||Cac8I AsuI* | ||| SphI AvaII | ||| NspI MnlI |TspDTI | ||| NlaIII | SmlI |BmgT120I | ||| | HphI BsrDI | AflII ||SetI | ||| | |MwoI | CviRI* | |MseI |||BsrI \ \\\ \ \\ \ \ \ \\ \\\\ GTGCCTGAGCATGCCATAAAAGCAATCACCATTGCAGATGAAGTCTTAAGAGGTCCAGTA 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| CACGGACTCGTACGGTATTTTCGTTAGTGGTAACGTCTACTTCAGAATTCTCCAGGTCAT // /// // / / / //// /// / || ||| |HphI BsrDI CviRI* MnlI |||| ||| SetI || ||| MwoI |||| ||AvaII || ||FatI |||| ||AsuI* || |CviAII |||| |BmgT120I || Cac8I |||| BsrI |NlaIII |||TspDTI |NspI ||SetI |SphI |AflII Bpu10I |SmlI DdeI MseI V P E H A I K A I T I A D E V L R G P V C L S M P * K Q S P L Q M K S * E V Q * A * A C H K S N H H C R * S L K R S S R ----:----|----:----|----:----|----:----|----:----|----:----| T G S C A M F A I V M A S S T K L P G T Q A Q A H W L L L * W Q L H L R L L D L H R L M G Y F C D G N C I F D * S T W Y Tsp4CI* Csp6I TspGWI | Csp6I SetI |RsaI |TspEI | |RsaI \ \\ \\ \ \\ GGTATGCGTACTTTAGACCCAAGCGATTACAATTACCGTCCGTACTACAACAACGGAGAA 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| CCATACGCATGAAATCTGGGTTCGCTAATGTTAATGGCAGGCATGATGTTGTTGCCTCTT // / / / // |Csp6I TspGWI | | |Csp6I RsaI | | RsaI | Tsp4CI* TspEI G M R T L D P S D Y N Y R P Y Y N N G E V C V L * T Q A I T I T V R T T T T E K Y A Y F R P K R L Q L P S V L Q Q R R R ----:----|----:----|----:----|----:----|----:----|----:----| P I R V K S G L S * L * R G Y * L L P S L Y A Y K L G L R N C N G D T S C C R L T H T S * V W A I V I V T R V V V V S F BseMII |StyI |SecI* |BspCNI || AsuI* TfiI || DraII HinfI || |CviJI | Hpy188I || |HaeIII | | TspGWI || |BmgT120I | | | MboII FokI MnlI || || DdeI | | | | BseGI | SetI |HphI || || | BsiYI* \ \ \ \ \ \ \ \\ \\ \\ \ \ GATTCGGATGATTTTGCCACCTCAAAGGGTAGAAACTATCACCAAGGCCCTGAGTGGGTC 4270 4280 4290 4300 4310 4320 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAGCCTACTAAAACGGTGGAGTTTCCCATCTTTGATAGTGGTTCCGGGACTCACCCAG /// // / / // // //// / / ||| |BseGI SetI FokI |HphI || |||| | DdeI ||| MboII MnlI || |||| BsiYI* ||TspGWI || |||DraII |Hpy188I || |||AsuI* HinfI || ||BmgT120I TfiI || |HaeIII || |CviJI || SecI* || StyI |BspCNI BseMII D S D D F A T S K G R N Y H Q G P E W V I R M I L P P Q R V E T I T K A L S G S F G * F C H L K G * K L S P R P * V G L ----:----|----:----|----:----|----:----|----:----|----:----| S E S S K A V E F P L F * * W P G S H T L N P H N Q W R L P Y F S D G L G Q T P I R I I K G G * L T S V I V L A R L P D Hpy166II | BbvI MseI | MaeII |AhaIII* | | SetI CviJI CviJI MseI BceAI BccI || BsrI | | TaiI \ \ \ \ \ \\ \ \ \ \ TGGCTTTACGGCTACTTTTTAAGAGCGTTCCATCATTTCCACTTTAAAACCAGTCCACGT 4330 4340 4350 4360 4370 4380 ----:----|----:----|----:----|----:----|----:----|----:----| ACCGAAATGCCGATGAAAAATTCTCGCAAGGTAGTAAAGGTGAAATTTTGGTCAGGTGCA / / / / / // / // / CviJI CviJI MseI BceAI BccI || BsrI || MaeII |MseI |TaiI AhaIII* |SetI Hpy166II W L Y G Y F L R A F H H F H F K T S P R G F T A T F * E R S I I S T L K P V H V A L R L L F K S V P S F P L * N Q S T L ----:----|----:----|----:----|----:----|----:----|----:----| Q S * P * K K L A N W * K W K L V L G R R A K R S S K L L T G D N G S * F W D V P K V A V K * S R E M M E V K F G T W T Hpy188I | TseI | Hin4I | |BisI | ||FokI MnlI | ||BlsI | Hin4I | ||BsmI BseGI BccI | | TspEI SfeI* \ \\\ \ \ \ \ \ \ TGTCAGAATGCTGCCAAAGAGAAACCATCCTCTTATTTGTATCAACAATTATACTACAGA 4390 4400 4410 4420 4430 4440 ----:----|----:----|----:----|----:----|----:----|----:----| ACAGTCTTACGACGGTTTCTCTTTGGTAGGAGAATAAACATAGTTGTTAATATGATGTCT / // //// / / / // / / | || |||| FokI BseGI | |MnlI TspEI SfeI* | || |||TseI | Hin4I | || ||BisI BccI | || |BlsI | || BsmI | |Hin4I | Hpy188I BbvI C Q N A A K E K P S S Y L Y Q Q L Y Y R V R M L P K R N H P L I C I N N Y T T D S E C C Q R E T I L L F V S T I I L Q I ----:----|----:----|----:----|----:----|----:----|----:----| Q * F A A L S F G D E * K Y * C N Y * L N D S H Q W L S V M R K N T D V I I S C T L I S G F L F W G R I Q I L L * V V S AluI CviJI CviJI MseI HaeIII | SetI \ \ \ \ TTAAAAGGCCATAGAAAATGGATTTTTGAAAGTGTGTGGGCAGGATTGACAGAGCTAACC 4450 4460 4470 4480 4490 4500 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTTCCGGTATCTTTTACCTAAAAACTTTCACACACCCGTCCTAACTGTCTCGATTGG / / / / MseI HaeIII | CviJI CviJI | AluI SetI L K G H R K W I F E S V W A G L T E L T * K A I E N G F L K V C G Q D * Q S * P K R P * K M D F * K C V G R I D R A N Q ----:----|----:----|----:----|----:----|----:----|----:----| N F P W L F H I K S L T H A P N V S S V I L L G Y F I S K Q F H T P L I S L A L * F A M S F P N K F T H P C S Q C L * G TsoI Bce83I* | MlyI | PleI | |CviRI* Cac8I | || HphI | BssKI | || | HinfI | CviJI | || | | SmlI | EcoRII | || | | BsrDI | | ScrFI BccI | || | | | CviJI | | BseBI \ \ \\ \ \ \ \ \ \ \ AATAAAGATGGTGAAGTATGCAATGACTCAAGCCCCACGCAAGCCTGGAGTTCTGCTTGT 4510 4520 4530 4540 4550 4560 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTCTACCACTTCATACGTTACTGAGTTCGGGGTGCGTTCGGACCTCAAGACGAACA / / /// / / // / / / / BccI Bce83I* ||| | | |CviJI | | | EcoRII TsoI ||| | | SmlI | | | BssKI ||| | HinfI | | BseBI ||| BsrDI | | ScrFI ||HphI | CviJI |CviRI* Cac8I |PleI MlyI N K D G E V C N D S S P T Q A W S S A C I K M V K Y A M T Q A P R K P G V L L V * R W * S M Q * L K P H A S L E F C L F ----:----|----:----|----:----|----:----|----:----|----:----| L L S P S T H L S E L G V C A Q L E A Q W Y L H H L I C H S L G W A L R S N Q K I F I T F Y A I V * A G R L G P T R S T MboI GsuI BglII FokI XhoII | TfiI Eco57MI | HinfI | DpnI | | Hpy178III* | |BstKTI SfaNI BseGI | | | MboII \ \\ \ \ \ \ \ \ TTGTTAGATCTATTTTATGATTTATGGGATGCCTACGAAGATGATTCCTGA 4570 4580 4590 4600 4610 ----:----|----:----|----:----|----:----|----:----|- AACAATCTAGATAAAATACTAAATACCCTACGGATGCTTCTACTAAGGACT / // / / / / / // | || XhoII SfaNI BseGI | | |Hpy178III* | || BglII | | MboII | || MboI | HinfI | |DpnI | TfiI | BstKTI FokI Eco57MI GsuI L L D L F Y D L W D A Y E D D S * C * I Y F M I Y G M P T K M I P X V R S I L * F M G C L R R * F L X ----:----|----:----|----:----|----:----|----:----|- K N S R N * S K H S A * S S S E Q N T L D I K H N I P H R R L H N R Q * I * K I I * P I G V F I I G S # Enzymes that cut Frequency Isoschizomers AccI 3 FblI,XmiI AciI 11 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 1 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 5 DraI AjuI 1 AluI 18 AluBI AlwNI 1 CaiI ApaI 1 ApoI 20 AcsI,XapI AsuI* 10 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 3 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 5 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 1 BbvI 6 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 15 Bce83I* 3 BpuEI BceAI 3 BcgI 3 BciVI 2 BfuI BdaI 10 BetI* 3 BsaWI BfiI 2 BmrI,BmuI BglII 2 BinI* 7 AlwI,BspPI,AclWI BisI 8 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 8 BmeT110I 3 BmgT120I 10 BplI 2 Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BsaXI 3 BseBI 9 Bst2UI,BstNI,BstOI,MvaI BseGI 15 BstF5I,BtsCI BseMII 7 BseRI 3 BseSI 3 BaeGI,BstSLI BseYI 2 BsgI 1 BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 11 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 5 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp120I 1 PspOMI Bsp1407I 3 BsrGI,BstAUI BspCNI 7 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 2 BfuAI,Acc36I,BveI BspMII* 2 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 2 AccBSI,MbiI BsrDI 3 BseMI,Bse3DI BsrI 12 BseNI,Bse1I,BsrSI BssKI 10 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 16 BstXI 3 BtgZI 5 BtrI 3 BmgBI,AjiI BtsI 1 Cac8I 6 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 3 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 13 CviQI,RsaNI CviAII 17 CviJI 59 CviKI-1 CviRI* 21 HpyCH4V DdeI 12 BstDEI,HpyF3I DpnI 16 MalI DraII 1 EcoO109I DrdI 3 AasI,DseDI DsaI* 1 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI EciI 2 Ecl136II 1 EcoICRI Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 3 AcuI Eco57MI 5 EcoNI 1 BstENI,XagI EcoRI 4 EcoRII 9 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI FalI 2 FatI 17 FauI 2 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 15 GlaI 4 GsaI 2 GsuI 2 BpmI HaeII 3 BstH2I HaeIII 8 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 4 Eco24I,EcoT38I,FriOI,BanII HhaI 4 BstHHI,CfoI,AspLEI Hin4I 12 Hin4II* 4 HpyAV Hin6I 4 HinP1I,HspAI HindII 4 HincII HindIII 1 HinfI 17 HpaII 7 HapII,BsiSI,MspI HphI 8 AsuHPI Hpy166II 11 Hpy8I Hpy178III* 23 Hpy188III Hpy188I 14 Hpy99I 3 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 10 FspBI,BfaI,XspI MaeII 9 HpyCH4IV MaeIII 8 MboI 16 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 15 MfeI 1 MunI MlyI 7 SchI MmeI 2 MnlI 26 MroNI 1 NgoMIV MseI 38 Tru1I,Tru9I MslI 5 RseI,SmiMI MwoI 7 HpyF10VI,BstMWI NaeI 1 PdiI NlaIII 17 Hin1II,Hsp92II,FaeI NlaIV 8 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspI 6 BstNSI,XceI PfoI 1 PleI 7 PpsI PpiI 1 PsiI 1 AanI PspXI 1 PstI 2 RsaI 13 AfaI SacI 1 Psp124BI,SstI SalI 1 SapI 1 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 10 BmrFI,MspR9I,Bme1390I SduI 7 MhlI,Bsp1286I SecI* 8 BseDI,BssECI,BsaJI SetI 53 SfaNI 7 LweI SfeI* 6 BstSFI,SfcI,BfmI SgrAI 1 SmlI 5 SmoI SnaBI 1 Eco105I,BstSNI SpeI 1 BcuI,AhlI SphI 2 PaeI,BbuI Sse232I* 1 MreI SspI 6 StyI 5 Eco130I,EcoT14I,ErhI,BssT1I TaiI 9 TaqI 11 TaqII 3 TatI 4 TauI 2 TfiI 10 PfeI TseI 6 ApeKI TsoI 6 Tsp45I 3 NmuCI Tsp4CI* 16 HpyCH4III,TaaI,Bst4CI TspDTI 21 TspEI 42 TasI,Tsp509I,Sse9I TspGWI 6 TspRI 11 TscAI TstI 1 Tth111I 2 PflFI,PsyI,AspI VspI 1 PshBI,AseI XbaI 2 XcmI 1 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 6 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AlfI AloI ApaLI AscI Asp718I AvrII BarI BbvCI BclI BglI BmtI BsePI BspOI BssNAI Bst1107I BstAPI BstZ17I Cfr9I CspCI DinI DraIII EcoP15I EgeI EheI EspI* FseI FspAI HpaI KasI KpnI MauBI McrI* MluI MstI* NarI NcoI NdeI NheI NmeAIII NotI NspBII* OliI PacI PasI PflMI PmaCI PmeI PpuMI PshAI PsrI PvuI PvuII RsrII SacII SanDI ScaI SexAI SfiI SfoI SgfI SgrDI SmaI SplI* SrfI Sse8387I StuI SwaI TspMI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769