Restriction Map of MET16/YPR167C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

MET16/YPR167C on chromosome XVI from coordinates 877632 to 876847.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.7942

EMBOSS_001 Tsp4CI* | MboI SetI MmeI | | DpnI BbvII* TspEI | | |BstKTI | MboII | MaeIII | | || MslI | |TspDTI | Tsp45I | | || BinI* \ \\ \ \ \ \ \\ \ ATGAAGACCTATCATTTGAATAATGATATAATTGTCACACAAGAACAGTTGGATCATTGG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTCTGGATAGTAAACTTATTACTATATTAACAGTGTGTTCTTGTCAACCTAGTAACC / / / / / / // / // SetI TspDTI MmeI | Tsp45I | || | |BinI* BbvII* | MaeIII | || | MslI MboII TspEI | || MboI | |DpnI | BstKTI Tsp4CI* M K T Y H L N N D I I V T Q E Q L D H W * R P I I * I M I * L S H K N S W I I G E D L S F E * * Y N C H T R T V G S L E ----:----|----:----|----:----|----:----|----:----|----:----| X F V * * K F L S I I T V C S C N S * Q X S S R D N S Y H Y L Q * V L V T P D N H L G I M Q I I I Y N D C L F L Q I M P TspDTI |AluI FatI MaeIII |CviJI CviRI* | HphI || SetI |CviAII | AclI || | MwoI || NlaIII | MaeII \\ \ \ \\ \ \ \ AATGAACAACTAATCAAGCTGGAAACGCCACAGGAGATTATTGCATGGTCTATCGTAACG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTGTTGATTAGTTCGACCTTTGCGGTGTCCTCTAATAACGTACCAGATAGCATTGC // / / / // / // || | MwoI | |FatI | |MaeII || CviJI | CviAII | |AclI || AluI CviRI* | MaeIII |SetI NlaIII TaiI TspDTI SetI HphI N E Q L I K L E T P Q E I I A W S I V T M N N * S S W K R H R R L L H G L S * R * T T N Q A G N A T G D Y C M V Y R N V ----:----|----:----|----:----|----:----|----:----|----:----| F S C S I L S S V G C S I I A H D I T V S H V V L * A P F A V P S * Q M T * R L I F L * D L Q F R W L L N N C P R D Y R CviJI |BsrI || CspCI CspCI || |MaeIII SetI | SetI CviRI* || ||Hin4I TaqI TaiI | | MnlI BtsI | TspRI TsoI || ||Hin4I ClaI \ \ \ \ \ \ \ \ \\ \\\ \ TTTCCTCACCTTTTCCAAACCACTGCATTTGGTTTGACTGGCTTGGTTACTATCGATATG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGGAGTGGAAAAGGTTTGGTGACGTAAACCAAACTGACCGAACCAATGATAGCTATAC / / / / / /// / / CspCI MnlI TspRI CviRI* TsoI ||CspCI | ClaI SetI BtsI |CviJI | TaqI |Hin4I MaeIII |Hin4I BsrI F P H L F Q T T A F G L T G L V T I D M F L T F S K P L H L V * L A W L L S I C S S P F P N H C I W F D W L G Y Y R Y V ----:----|----:----|----:----|----:----|----:----|----:----| N G * R K W V V A N P K V P K T V I S I T E E G K G F W Q M Q N S Q S P * * R Y K R V K E L G S C K T Q S A Q N S D I H AluI CviJI | SetI FatI | | Hpy188I |CviAII | | | Hin4I || NspI | | | Hin4I || NlaIII CviRI* \ \ \ \ \\ \ \ TTGTCAAAGCTATCTGAAAAATACTACATGCCAGAACTATTATTTATAGACACTTTGCAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AACAGTTTCGATAGACTTTTTATGATGTACGGTCTTGATAATAAATATCTGTGAAACGTG / / // / // / | | |Hpy188I | |FatI CviRI* | | Hin4I | CviAII | | Hin4I NlaIII | CviJI NspI | AluI SetI L S K L S E K Y Y M P E L L F I D T L H C Q S Y L K N T T C Q N Y Y L * T L C T V K A I * K I L H A R T I I Y R H F A P ----:----|----:----|----:----|----:----|----:----|----:----| N D F S D S F Y * M G S S N N I S V K C T T L A I Q F I S C A L V I I * L C K A Q * L * R F F V V H W F * * K Y V S Q V MseI CviJI \ \ CATTTCCCACAAACTTTAACACTAAAAAACGAGATTGAGAAAAAATACTACCAGCCTAAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAAGGGTGTTTGAAATTGTGATTTTTTGCTCTAACTCTTTTTTATGATGGTCGGATTT / / MseI CviJI H F P Q T L T L K N E I E K K Y Y Q P K I S H K L * H * K T R L R K N T T S L K F P T N F N T K K R D * E K I L P A * K ----:----|----:----|----:----|----:----|----:----|----:----| W K G C V K V S F F S I S F F Y * W G L G N G V F K L V L F R S Q S F I S G A * M E W L S * C * F V L N L F F V V L R F BseGI | MnlI | BsaBI | |TfiI | |HinfI | |BseGI MaeII | || FokI |BsaAI BccI | || Hin4I MwoI || SetI | CviJI | || | Hpy188I BstAPI || TaiI | |HpaII | || | | FokI | TaqI \\ \ \ \\ \ \\ \ \ \ \ \ AATCAAACCATTCACGTATATAAGCCGGATGGATGTGAATCGGAGGCAGATTTTGCCTCG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTTTGGTAAGTGCATATATTCGGCCTACCTACACTTAGCCTCCGTCTAAAACGGAGC / // // / / // // / // / | |MaeII || | | || || | |BstAPI TaqI | BsaAI || | | || || | |MwoI TaiI || | | || || | FokI SetI || | | || || FokI || | | || |Hpy188I || | | || HinfI || | | || TfiI || | | |BsaBI || | | BseGI || | | Hin4I || | | MnlI || | BseGI || HpaII |CviJI BccI N Q T I H V Y K P D G C E S E A D F A S I K P F T Y I S R M D V N R R Q I L P R S N H S R I * A G W M * I G G R F C L E ----:----|----:----|----:----|----:----|----:----|----:----| F * V M * T Y L G S P H S D S A S K A E F D F W E R I Y A P H I H I P P L N Q R I L G N V Y I L R I S T F R L C I K G R BsgI CfrI | BalI Csp6I | CviJI MnlI Hin4I |RsaI | HaeIII \ \ \\ \ \ AAATACGGGGATTTCTTATGGGAGAAAGATGATGACAAGTACGATTATCTGGCCAAAGTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTTATGCCCCTAAAGAATACCCTCTTTCTACTACTGTTCATGCTAATAGACCGGTTTCAC / / // / / / | Hin4I |Csp6I | | CfrI MnlI RsaI | HaeIII | CviJI | BalI BsgI K Y G D F L W E K D D D K Y D Y L A K V N T G I S Y G R K M M T S T I I W P K W I R G F L M G E R * * Q V R L S G Q S G ----:----|----:----|----:----|----:----|----:----|----:----| F Y P S K K H S F S S S L Y S * R A L T S I R P N R I P S L H H C T R N D P W L F V P I E * P L F I I V L V I I Q G F H NlaIV | SetI | |CviRI* | || BspMI | || |MwoI AluI | || |DraIII CviJI Hpy166II | || |BstAPI | SetI MslI | BsrI \ \\ \\ \ \ \ \ \ GAACCTGCACATCGTGCCTACAAAGAGCTACATATAAGTGCTGTGTTTACTGGTAGAAGA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGGACGTGTAGCACGGATGTTTCTCGATGTATATTCACGACACAAATGACCATCTTCT / / / / / / / / / | | | BspMI | CviJI MslI | BsrI | | BstAPI | AluI Hpy166II | | DraIII SetI | | MwoI | CviRI* NlaIV SetI E P A H R A Y K E L H I S A V F T G R R N L H I V P T K S Y I * V L C L L V E E T C T S C L Q R A T Y K C C V Y W * K K ----:----|----:----|----:----|----:----|----:----|----:----| S G A C R A * L S S C I L A T N V P L L P V Q V D H R C L A V Y L H Q T * Q Y F F R C M T G V F L * M Y T S H K S T S S AciI Cac8I | BsrBI | | FauI MboII | | | Tsp4CI* TfiI | SetI | | | | TaqI MseI HinfI \ \ \ \ \ \ \ \ \ AAATCACAAGGTTCTGCCCGCTCCCAACTGTCGATTATTGAAATAGACGAACTTAATGGA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGTGTTCCAAGACGGGCGAGGGTTGACAGCTAATAACTTTATCTGCTTGAATTACCT // / / // / / |SetI | BsrBI || TaqI MseI MboII | AciI |Tsp4CI* Cac8I FauI K S Q G S A R S Q L S I I E I D E L N G N H K V L P A P N C R L L K * T N L M E I T R F C P L P T V D Y * N R R T * W N ----:----|----:----|----:----|----:----|----:----|----:----| F D C P E A R E W S D I I S I S S S L P F I V L N Q G S G V T S * Q F L R V * H F * L T R G A G L Q R N N F Y V F K I S MboI BclI | DpnI BspMI | |XcmI |MaeII MseI | |BstKTI || SetI SetI | ||MfeI || TaiI | SfaNI MseI | ||TspEI || |TaqI | | Tsp4CI* \ \ \\\ \\ \\ \ \ \ ATCTTAAAAATAAATCCATTGATCAATTGGACGTTCGAGCAGGTTAAACAGTATATAGAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAATTTTTATTTAGGTAACTAGTTAACCTGCAAGCTCGTCCAATTTGTCATATATCTA / / // / / / // / / / / / | MseI || | | | || | SetI | | SfaNI HinfI || | | | || TaqI | Tsp4CI* TfiI || | | | |BspMI MseI || | | | MaeII || | | TaiI || | | SetI || | TspEI || | MfeI || BclI || MboI |XcmI |DpnI BstKTI I L K I N P L I N W T F E Q V K Q Y I D S * K * I H * S I G R S S R L N S I * M L K N K S I D Q L D V R A G * T V Y R C ----:----|----:----|----:----|----:----|----:----|----:----| I K F I F G N I L Q V N S C T L C Y I S F R L F L D M S * N S T R A P * V T Y L D * F Y I W Q D I P R E L L N F L I Y I AsuI* AvaII |BmgT120I || StyI || SecI* || | SetI || | | BinI* || | | | BsaBI || | | | |MboI || | | | |XhoII Csp6I || | | | || DpnI CviRI* |RsaI || | | | || |BstKTI \ \\ \\ \ \ \ \\ \\ GCAAACAATGTACCATACAACGAACTTTTGGACCTTGGATATAGATCCATTGGTGATTAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTGTTACATGGTATGTTGCTTGAAAACCTGGAACCTATATCTAGGTAACCACTAATG / // /// / / / // / CviRI* |Csp6I ||| | | | || XhoII RsaI ||| | | | || MboI ||| | | | |DpnI ||| | | | BstKTI ||| | | BsaBI ||| | BinI* ||| SecI* ||| StyI ||AvaII ||AsuI* |BmgT120I SetI A N N V P Y N E L L D L G Y R S I G D Y Q T M Y H T T N F W T L D I D P L V I T K Q C T I Q R T F G P W I * I H W * L P ----:----|----:----|----:----|----:----|----:----|----:----| A F L T G Y L S S K S R P Y L D M P S * H L C H V M C R V K P G Q I Y I W Q H N C V I Y W V V F K Q V K S I S G N T I V HphI | MboII | |BccI HphI Hin4II* SetI | || Hin4II* MboII \ \ \ \ \\ \ \ CATTCCACACAACCCGTCAAGGAAGGTGAAGATGAGAGAGCAGGAAGATGGAAGGGCAAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAGGTGTGTTGGGCAGTTCCTTCCACTTCTACTCTCTCGTCCTTCTACCTTCCCGTTC / / / / / / / / HphI Hin4II* SetI | | | Hin4II* MboII | | BccI | MboII HphI H S T Q P V K E G E D E R A G R W K G K I P H N P S R K V K M R E Q E D G R A R F H T T R Q G R * R * E S R K M E G Q G ----:----|----:----|----:----|----:----|----:----|----:----| W E V C G T L S P S S S L A P L H F P L G N W V V R * P L H L H S L L F I S P C M G C L G D L F T F I L S C S S P L A L ApoI TspEI EcoRI | FatI | BspHI | |TaqII | |CviAII | |Hpy178III* | || NlaIII | || | CviJI | || | | Cac8I | || | | | CviJI | || | | | | TfiI | || | | | | HinfI | || | | | | | TspDTI | || | | | | | | Hin6I | || | | | | | | FnuDII* | || | | | | | | |GlaI | || | | | | | | ||HhaI | || | | | | | | |||TspEI | || | | | | | | |||| SfaNI CviJI | || | | | | | | |||| |MseI HaeIII TspDTI | || | | | | | | |||| ||AhaIII* \ \ \ \\ \ \ \ \ \ \ \\\\ \\\ GCCAAGACCGAGTGTGGAATTCATGAAGCCAGCCGATTCGCGCAATTTTTAAAGCAAGAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTCTGGCTCACACCTTAAGTACTTCGGTCGGCTAAGCGCGTTAAAAATTTCGTTCTA / / // // / / / / / /// / /// HaeIII TspDTI || || | | | | | ||| | ||SfaNI CviJI || || | | | | | ||| | |MseI || || | | | | | ||| | AhaIII* || || | | | | | ||| TspEI || || | | | | | ||Hin6I || || | | | | | |GlaI || || | | | | | FnuDII* || || | | | | | HhaI || || | | | | HinfI || || | | | | TfiI || || | | | TspDTI || || | | CviJI || || | Cac8I || || CviJI || |BspHI || |FatI || Hpy178III* || CviAII |NlaIII |EcoRI |TspEI |ApoI TaqII A K T E C G I H E A S R F A Q F L K Q D P R P S V E F M K P A D S R N F * S K M Q D R V W N S * S Q P I R A I F K A R C ----:----|----:----|----:----|----:----|----:----|----:----| A L V S H P I * S A L R N A C N K F C S P W S R T H F E H L W G I R A I K L A L G L G L T S N M F G A S E R L K * L L I MaeI \ GCCTAG ----:- CGGATC / MaeI A * P X L X ----:- A * H R G L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AclI 1 Psp1406I AhaIII* 1 DraI AluI 3 AluBI ApoI 1 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 2 BclI 1 FbaI,Ksp22I BinI* 2 AlwI,BspPI,AclWI BmgT120I 1 BsaAI 1 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BseGI 2 BstF5I,BtsCI BsgI 1 BspHI 1 CciI,PagI,RcaI BspMI 2 BfuAI,Acc36I,BveI BsrBI 1 AccBSI,MbiI BsrI 2 BseNI,Bse1I,BsrSI BstAPI 2 BstKTI 3 BtsI 1 Cac8I 2 BstC8I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 2 CviQI,RsaNI CspCI 1 CviAII 3 CviJI 10 CviKI-1 CviRI* 5 HpyCH4V DpnI 3 MalI DraIII 1 AdeI EcoRI 1 FatI 3 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 1 HaeIII 2 BsnI,BsuRI,BshFI,PhoI HhaI 1 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 2 HpyAV Hin6I 1 HinP1I,HspAI HinfI 3 HpaII 1 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 1 Hpy188III Hpy188I 2 MaeI 1 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 3 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MfeI 1 MunI MmeI 1 MnlI 3 MseI 5 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI RsaI 2 AfaI SecI* 1 BseDI,BssECI,BsaJI SetI 13 SfaNI 2 LweI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 4 TaqII 1 TfiI 3 PfeI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 4 TasI,Tsp509I,Sse9I TspRI 1 TscAI XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BamHI BarI BbvCI BbvI Bce83I* BceAI BcgI BciVI BdaI BetI* BfiI BglI BglII BisI BlsI BmeT110I BmtI BplI Bpu10I BsaXI BseBI BseMII BsePI BseRI BseSI BseYI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspLU11I* BspMII* BspOI BsrDI BssKI BssNAI Bst1107I Bst2UI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI CauII* Cfr10I Cfr9I DdeI DinI DraII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI Fnu4HI FseI FspAI GsaI GsuI HaeII HgaI HgiAI* HgiCI* HgiJII* HindII HindIII HpaI Hpy99I KasI KpnI Ksp632I* MauBI McrI* MluI MlyI Mph1103I MroNI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I SwaI TatI TauI TseI TspGWI TspMI TstI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769