Restriction Map of NVJ2/YPR091C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

NVJ2/YPR091C on chromosome XVI from coordinates 718468 to 716156.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 NheI CviJI |MaeI ||Cac8I ||Hin4II* ||| AluI ||| BmtI ||| CviJI ||| | SetI SetI Hpy166II AciI \\\ \ \ \ \ \ ATGGCTAGCTTGAAGGTATTTCTCGCAGTTTACTTGCTTGGCGGTATCACATTTTTGCCT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGATCGAACTTCCATAAAGAGCGTCAAATGAACGAACCGCCATAGTGTAAAAACGGA ///// / / / ||||| SetI Hpy166II AciI ||||CviJI ||||NheI ||||AluI |||MaeI ||Cac8I ||SetI |Hin4II* CviJI BmtI M A S L K V F L A V Y L L G G I T F L P W L A * R Y F S Q F T C L A V S H F C L G * L E G I S R S L L A W R Y H I F A F ----:----|----:----|----:----|----:----|----:----|----:----| X A L K F T N R A T * K S P P I V N K G X P * S S P I E R L K S A Q R Y * M K A H S A Q L Y K E C N V Q K A T D C K Q R TatI Bsp1407I |Csp6I ||RsaI ||| MaeIII ||| Tsp4CI* ||| | MseI HphI ||| | SetI AsuI* ||| | | BsiYI* AvaII ||| | | | Hin4II* |BmgT120I MnlI ||| | | | |TaqI \\ \ \\\ \ \ \ \\ TTGGTCCTTTTCACCCTCTATAAAATCCATTTATTGTACAGTAACCTTAAATCGGCATCG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AACCAGGAAAAGTGGGAGATATTTTAGGTAAATAACATGTCATTGGAATTTAGCCGTAGC / // / /// / / // / / | |AvaII MnlI ||| | | |MseI | TaqI | |AsuI* ||| | | BsiYI* Hin4II* | BmgT120I ||| | MaeIII HphI ||| SetI ||Bsp1407I ||Tsp4CI* ||TatI |Csp6I RsaI L V L F T L Y K I H L L Y S N L K S A S W S F S P S I K S I Y C T V T L N R H R G P F H P L * N P F I V Q * P * I G I E ----:----|----:----|----:----|----:----|----:----|----:----| K T R K V R * L I W K N Y L L R L D A D K P G K * G R Y F G N I T C Y G * I P M Q D K E G E I F D M * Q V T V K F R C R SfaNI | AluI | CviJI | |MaeI | ||SetI | |||MboI | |||MboII | |||| DpnI | |||| |FatI | |||| |BspHI | |||| |BstKTI EcoP15I | |||| ||CviAII |BstXI | |||| ||Hpy178III* || CviJI | |||| ||| NlaIII TspEI || | Cac8I \ \\\\ \\\ \ \ \\ \ \ AAGAAGGAGCTAGATCATGATACAGCAGACGAAATTGATGAGAAAACCAGACTTCTGGCT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTCCTCGATCTAGTACTATGTCGTCTGCTTTAACTACTCTTTTGGTCTGAAGACCGA /// ////// // / / / / / ||| |||||| |BspHI TspEI | | | Cac8I ||| |||||| |FatI | | CviJI ||| |||||| Hpy178III* | EcoP15I ||| |||||| CviAII BstXI ||| |||||MboI ||| ||||NlaIII ||| |||DpnI ||| ||BstKTI ||| |MaeI ||| MboII ||CviJI ||AluI |SfaNI SetI K K E L D H D T A D E I D E K T R L L A R R S * I M I Q Q T K L M R K P D F W L E G A R S * Y S R R N * * E N Q T S G S ----:----|----:----|----:----|----:----|----:----|----:----| F F S S S * S V A S S I S S F V L S R A S S P A L D H Y L L R F Q H S F W V E P L L L * I M I C C V F N I L F G S K Q S MseI |AhaIII* || Cac8I || | Cac8I || | |SapI || | |Ksp632I* || | ||AluI || | ||CviJI || | |||MaeI Hpy178III* || | ||||SetI MboII |NruI || | ||||| MwoI | SetI |FnuDII* || | ||||| | TspEI | |MmeI \\ \\ \ \\\\\ \ \ \ \\ CGCGATATAGACCCAGAGTTTAAAGCACGCAAGCTAGAAGAGCAATTAGGTGTCAAAGTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GCGCTATATCTGGGTCTCAAATTTCGTGCGTTCGATCTTCTCGTTAATCCACAGTTTCAA // // / / / // // / |Hpy178III* |MseI | | | |MwoI || MmeI FnuDII* | | | | |MaeI |MboII NruI | | | | Ksp632I* TspEI | | | | SapI SetI | | | CviJI | | | AluI | | Cac8I | | SetI | Cac8I AhaIII* R D I D P E F K A R K L E E Q L G V K V A I * T Q S L K H A S * K S N * V S K F R Y R P R V * S T Q A R R A I R C Q S F ----:----|----:----|----:----|----:----|----:----|----:----| R S I S G S N L A R L S S S C N P T L T E R Y L G L T * L V C A L L A I L H * L A I Y V W L K F C A L * F L L * T D F N MboI | DpnI | |BstKTI | || MaeIII | || Tsp45I Eco57I | || Tsp4CI* Eco57MI | || |BinI* | SspI Hpy188I MseI HphI | || || DdeI | | MboII | CviJI \ \ \ \\ \\ \ \ \ \ \ \ TTTAACAAGGGTTGGATCACCGTCACTAAGCAATATTATTATCATTCTTCAGAAGTGGCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTGTTCCCAACCTAGTGGCAGTGATTCGTTATAATAATAGTAAGAAGTCTTCACCGA / / // / / / / // / / / / | HphI || | | | | || | MboII Hpy188I CviJI MseI || | | | | || SspI || | | | | |Eco57MI || | | | | |Eco57I || | | | | DdeI || | | | Tsp45I || | | | MaeIII || | | BinI* || | Tsp4CI* || MboI |DpnI BstKTI F N K G W I T V T K Q Y Y Y H S S E V A L T R V G S P S L S N I I I I L Q K W L * Q G L D H R H * A I L L S F F R S G C ----:----|----:----|----:----|----:----|----:----|----:----| K L L P Q I V T V L C Y * * * E E S T A K * C P N S * R * * A I N N D N K L L P K V L T P D G D S L L I I I M R * F H S TfiI HinfI | Hpy188I | | BtsI | | | AlwNI ApoI | | | | CviRI* TspEI MboII | | | | | TspRI MwoI TspEI EcoRI | BsgI | | | | | | Hpy178III* BstAPI \ \ \ \ \ \ \ \ \ \ \ \ GTAATTTTGAAGAATTCTAATAATAATAAAGATTCAGACACTGCACTTCAAGAGCAAATC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CATTAAAACTTCTTAAGATTATTATTATTTCTAAGTCTGTGACGTGAAGTTCTCGTTTAG / / / / //// / / / TspEI | | BsgI |||AlwNI CviRI* | BstAPI | MboII ||TspRI | MwoI EcoRI ||BtsI Hpy178III* TspEI |Hpy188I ApoI HinfI TfiI V I L K N S N N N K D S D T A L Q E Q I * F * R I L I I I K I Q T L H F K S K S N F E E F * * * * R F R H C T S R A N L ----:----|----:----|----:----|----:----|----:----|----:----| T I K F F E L L L L S E S V A S * S C I Q L K S S N * Y Y Y L N L C Q V E L A F Y N Q L I R I I I F I * V S C K L L L D FatI |CviAII || NlaIII MboII CviRI* || | ApoI CviRI* | SetI | MseI || | TspEI \ \ \ \ \ \\ \ \ TTGCAAAGAACAGACTTGAAGAAAAAACAAAGGTTTTTTGCAGTATTAAGACATGGAAAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTTTCTTGTCTGAACTTCTTTTTTGTTTCCAAAAAACGTCATAATTCTGTACCTTTA / // / / / // CviRI* |SetI CviRI* | | |FatI MboII | | CviAII | NlaIII MseI L Q R T D L K K K Q R F F A V L R H G N C K E Q T * R K N K G F L Q Y * D M E I A K N R L E E K T K V F C S I K T W K F ----:----|----:----|----:----|----:----|----:----|----:----| K C L V S K F F F C L N K A T N L C P F R A F F L S S S F V F T K Q L I L V H F Q L S C V Q L F F L P K K C Y * S M S I AsuI* AvaII |BmgT120I CviRI* || FatI TfiI | ApoI || |CviAII HinfI | TspEI || || NlaIII \ \ \ \\ \\ \ TTGTTTTTGTATAAAGACGATTCTCAAAATGCAAATTTGGTCCATGCTATATCTTTACAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AACAAAAACATATTTCTGCTAAGAGTTTTACGTTTAAACCAGGTACGATATAGAAATGTT / / / / // // TspEI HinfI | | || |FatI ApoI TfiI | | || CviAII | | |NlaIII | | |AvaII | | |AsuI* | | BmgT120I | TspEI | ApoI CviRI* L F L Y K D D S Q N A N L V H A I S L Q C F C I K T I L K M Q I W S M L Y L Y K V F V * R R F S K C K F G P C Y I F T K ----:----|----:----|----:----|----:----|----:----|----:----| K N K Y L S S E * F A F K T W A I D K C N T K T Y L R N E F H L N P G H * I K V Q K Q I F V I R L I C I Q D M S Y R * L AsuI* |CviJI BfiI |HaeIII |TspDTI |BmgT120I ||SfaNI HphI ||NlaIV TaqI BsrI |||TspEI MboII \ \\\ \ \ \\\\ \ AACAGATTTATCACCATTTGGCCCCGTTTCGATGAACTGGGTAAGGAAGAATTGCCAGAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTCTAAATAGTGGTAAACCGGGGCAAAGCTACTTGACCCATTCCTTCTTAACGGTCTA / /// / / / // / HphI ||AsuI* TaqI BsrI TspDTI || MboII |BmgT120I BfiI |TspEI |NlaIV SfaNI HaeIII CviJI N R F I T I W P R F D E L G K E E L P D T D L S P F G P V S M N W V R K N C Q M Q I Y H H L A P F R * T G * G R I A R C ----:----|----:----|----:----|----:----|----:----|----:----| F L N I V M Q G R K S S S P L S S N G S F C I * * W K A G N R H V P Y P L I A L V S K D G N P G T E I F Q T L F F Q W I MlyI PleI MnlI |SfeI* | DdeI Hpy178III* SetI || MnlI \ \ \ \ \\ \ GCCTCGCTTTTCACTAAGAGAACTTGTATTGCTATTTTCAAGAATGACCTCGTTTCTATA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAGCGAAAAGTGATTCTCTTGAACATAACGATAAAAGTTCTTACTGGAGCAAAGATAT / / / / /// / MnlI DdeI | SetI ||| SfeI* Hpy178III* ||MnlI |PleI MlyI A S L F T K R T C I A I F K N D L V S I P R F S L R E L V L L F S R M T S F L * L A F H * E N L Y C Y F Q E * P R F Y R ----:----|----:----|----:----|----:----|----:----|----:----| A E S K V L L V Q I A I K L F S R T E I H R A K * * S F K Y Q * K * S H G R K * G R K E S L S S T N S N E L I V E N R Y TspRI |TfiI |HinfI HinfI TaqI BsrI || TaqI \ \ \ \\ \ GACTCTAAAAACCATAATGTTATCCTGCCACACTTCGACCCACTTACCAGTGCTGAATCG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAGATTTTTGGTATTACAATAGGACGGTGTGAAGCTGGGTGAATGGTCACGACTTAGC / / / / / HinfI TaqI TspRI | TaqI BsrI HinfI TfiI D S K N H N V I L P H F D P L T S A E S T L K T I M L S C H T S T H L P V L N R L * K P * C Y P A T L R P T Y Q C * I E ----:----|----:----|----:----|----:----|----:----|----:----| S E L F W L T I R G C K S G S V L A S D L S * F G Y H * G A V S R G V * W H Q I V R F V M I N D Q W V E V W K G T S F R MaeIII FatI Tsp45I |CviAII TspEI AluI Tsp4CI* HphI || NlaIII |TspDTI CviJI \ \ \\ \ \\ \ AATAACGGTGACATCTCTACCAATGACACTACACATGAATATCAATCACAATTCCATAGC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTGCCACTGTAGAGATGGTTACTGTGATGTGTACTTATAGTTAGTGTTAAGGTATCG / / / / // / / / / | | HphI | |FatI | | | CviJI | Tsp45I | CviAII | | | AluI | MaeIII NlaIII | | SetI Tsp4CI* | TspEI TspDTI N N G D I S T N D T T H E Y Q S Q F H S I T V T S L P M T L H M N I N H N S I A * R * H L Y Q * H Y T * I S I T I P * L ----:----|----:----|----:----|----:----|----:----|----:----| F L P S M E V L S V V C S Y * D C N W L S Y R H C R * W H C * V H I D I V I G Y I V T V D R G I V S C M F I L * L E M A FatI SetI |CviAII | MboII TaqI || NlaIII MboII \ \ \ \\ \ \ TCAAATCAGTTCTTCTTGTATTTCGATAATAACATGGACAAAGAAGATTGGTATTATCAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTTAGTCAAGAAGAACATAAAGCTATTATTGTACCTGTTTCTTCTAACCATAATAGTC / / / // / MboII TaqI | |FatI MboII | CviAII NlaIII S N Q F F L Y F D N N M D K E D W Y Y Q Q I S S S C I S I I T W T K K I G I I S K S V L L V F R * * H G Q R R L V L S V ----:----|----:----|----:----|----:----|----:----|----:----| E F * N K K Y K S L L M S L S S Q Y * * S L D T R R T N R Y Y C P C L L N T N D * I L E E Q I E I I V H V F F I P I I L MnlI | BsrI | |BinI* | || MboI | || BamHI | || XhoII MboI | || | DpnI BclI MnlI | || | NlaIV | DpnI |Tsp4CI* | || | |BstKTI | |BstKTI || TspEI | || | || BinI* \ \\ \\ \ \ \\ \ \\ \ TTGATCAATGCCTCTAAAAACAGTAATTCCCTCTCAACTGGTTTATTGGATCCTAATGTT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAGTTACGGAGATTTTTGTCATTAAGGGAGAGTTGACCAAATAACCTAGGATTACAA // / // / // / // / / || BclI || TspEI || | || | BinI* || MboI |Tsp4CI* || | || XhoII |DpnI MnlI || | || BamHI BstKTI || | || MboI || | |NlaIV || | |DpnI || | BstKTI || BinI* |BsrI MnlI L I N A S K N S N S L S T G L L D P N V * S M P L K T V I P S Q L V Y W I L M F D Q C L * K Q * F P L N W F I G S * C F ----:----|----:----|----:----|----:----|----:----|----:----| N I L A E L F L L E R E V P K N S G L T T S * H R * F C Y N G R L Q N I P D * H Q D I G R F V T I G E * S T * Q I R I N BbvI | DdeI AluI | | BbvII* CviJI | | | MboII | SetI | | | | MaeIII | | TseI | | | | | MfeI | | MwoI | | | | | TspEI | | |BisI | | | | | | Hin4I | | ||BlsI | | | | | | | TfiI | | |||AluI | | | | | | | HinfI | | |||CviJI | | | | | | | | Hpy178III* | | |||| SetI | | | | | | | | | EcoRV \ \ \\\\ \ \ \ \ \ \ \ \ \ \ \ TCAGCTAACGCAGCTCATTTGAAGACTAAGGATATGTTACAATTGATTCAGGATATCAAC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCGATTGCGTCGAGTAAACTTCTGATTCCTATACAATGTTAACTAAGTCCTATAGTTG / / / /// / / / / / / / / / | | | ||CviJI | | | | | | | | EcoRV | | | ||TseI | | | | | | | Hpy178III* | | | ||AluI | | | | | | HinfI | | | |BisI | | | | | | TfiI | | | BlsI | | | | | TspEI | | | SetI | | | | | MfeI | | MwoI | | | | MaeIII | CviJI | | | Hin4I | AluI | | BbvII* SetI | | MboII | DdeI BbvI S A N A A H L K T K D M L Q L I Q D I N Q L T Q L I * R L R I C Y N * F R I S T S * R S S F E D * G Y V T I D S G Y Q L ----:----|----:----|----:----|----:----|----:----|----:----| E A L A A * K F V L S I N C N I * S I L K L * R L E N S S * P Y T V I S E P Y * * S V C S M Q L S L I H * L Q N L I D V Hin4I |MseI ||HpaI ||HindII ||Hpy166II CviJI SapI ||| DdeI |MboII BsmI Ksp632I* \\\ \ \\ \ \ TCTACTGAAAATCAGTTAACTACTAAGTGGCTGAATGCTCTTCTTGGGAGATTATTTCTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGACTTTTAGTCAATTGATGATTCACCGACTTACGAGAAGAACCCTCTAATAAAGAA / // / / / / Hin4I |MseI | CviJI BsmI Ksp632I* Hpy166II | MboII SapI HindII DdeI HpaI S T E N Q L T T K W L N A L L G R L F L L L K I S * L L S G * M L F L G D Y F F Y * K S V N Y * V A E C S S W E I I S F ----:----|----:----|----:----|----:----|----:----|----:----| E V S F * N V V L H S F A R R P L N N R S * Q F D T L * * T A S H E E Q S I I E R S F I L * S S L P Q I S K K P S * K K FatI MaeII BspHI | SetI |CviAII | TaiI |Hpy178III* CviRI* CviRI* | | TspDTI || NlaIII | TspEI \ \ \ \ \\ \ \ \ TCTCTGCAACAAACTGATACGTTGAATAAGTTTATTCATGAGAAAATCTGCAAGAAATTG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGACGTTGTTTGACTATGCAACTTATTCAAATAAGTACTCTTTTAGACGTTCTTTAAC / / / / / // / / CviRI* | | TspDTI | |BspHI CviRI* TspEI | MaeII | |FatI TaiI | Hpy178III* SetI | CviAII NlaIII S L Q Q T D T L N K F I H E K I C K K L L C N K L I R * I S L F M R K S A R N * S A T N * Y V E * V Y S * E N L Q E I E ----:----|----:----|----:----|----:----|----:----|----:----| E R C C V S V N F L N I * S F I Q L F N K E A V F Q Y T S Y T * E H S F R C S I R Q L L S I R Q I L K N M L F D A L F Q TaqII | SalI | |TaqI | |AccI | |SetI BssKI | ||HindII SecI* | ||Hpy166II EcoRII | ||| MaeII |PasI | ||| |BtrI |SecI* | ||| ||Hpy99I ||ScrFI | ||| |||SetI ||BseBI BseGI FokI | ||| |||TaiI \\\ \ \ \ \\\ \\\\ AATAAAATAAAAACCCCAGGGTTCTTGGATGATTTGGTTGTTGAAAAGGTCGACGTGGGT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTTATTTTTGGGGTCCCAAGAACCTACTAAACCAACAACTTTTCCAGCTGCACCCA /// / / / ////// ||EcoRII BseGI | | |||||MaeII ||BssKI | | ||||BtrI ||SecI* | | |||SalI |SecI* | | ||AccI |PasI | | ||TaqI BseBI | | ||TaiI ScrFI | | ||SetI | | |Hpy166II | | |HindII | | Hpy99I | SetI TaqII FokI N K I K T P G F L D D L V V E K V D V G I K * K P Q G S W M I W L L K R S T W V * N K N P R V L G * F G C * K G R R G * ----:----|----:----|----:----|----:----|----:----|----:----| F L I F V G P N K S S K T T S F T S T P S Y F L F G L T R P H N P Q Q F P R R P I F Y F G W P E Q I I Q N N F L D V H T TspEI |BseMII BseMII ||BspCNI |BspCNI ||| MnlI HphI || SetI ||| | Hpy178III* SduI || | Hpy178III* ||| | |DdeI HgiAI* || | |DdeI ||| | |SauI* TaqI |HphI || | || MnlI ||| | |BsmAI | DdeI \\ \\ \ \\ \ \\\ \ \\ \ \ GATAGTGCTCCATTATTCACCTCTCCTGAGTTATTAGAATTGTCTCCTGAGGGTTCGACT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTATCACGAGGTAATAAGTGGAGAGGACTCAATAATCTTAACAGAGGACTCCCAAGCTGA / // // / / / // / / // / | |HphI || SetI | MnlI || TspEI | |BsmAI TaqI | HphI |BspCNI | DdeI || MnlI | SauI* HgiAI* BseMII | |BspCNI | DdeI SduI | BseMII Hpy178III* Hpy178III* D S A P L F T S P E L L E L S P E G S T I V L H Y S P L L S Y * N C L L R V R L * C S I I H L S * V I R I V S * G F D * ----:----|----:----|----:----|----:----|----:----|----:----| S L A G N N V E G S N N S N D G S P E V H Y H E M I * R E Q T I L I T E Q P N S I T S W * E G R R L * * F Q R R L T R S BsaBI | TaqI | | MaeII | | | Hpy99I | | | |SetI | | | |TaiI TspEI MwoI \ \ \ \\ \ \ AAGATTGCTATCGACGTTCAATACAGGGGAAACTTGACAATTATTATTGCGACAAAGGCG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTAACGATAGCTGCAAGTTATGTCCCCTTTGAACTGTTAATAATAACGCTGTTTCCGC / / / / / / / DdeI | | | MaeII TspEI MwoI | | TaqI | | TaiI | | SetI | Hpy99I BsaBI K I A I D V Q Y R G N L T I I I A T K A R L L S T F N T G E T * Q L L L R Q R R D C Y R R S I Q G K L D N Y Y C D K G E ----:----|----:----|----:----|----:----|----:----|----:----| L I A I S T * Y L P F K V I I I A V F A * S Q * R R E I C P F S S L * * Q S L P L N S D V N L V P S V Q C N N N R C L R MboI | DpnI | |BstKTI | || MaeII | || | SetI | || | TaiI MseI | || | BinI* MnlI SetI CviRI* TspEI \ \ \\ \ \ \ \ \ \ AGTATTAACTTGGGATCACGTTTCAAACAAAGGGAGGTTTCTTTGCAGTTGTCCATAAAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TCATAATTGAACCCTAGTGCAAAGTTTGTTTCCCTCCAAAGAAACGTCAACAGGTATTTT / // / / / / / / MseI || | | | MnlI SetI CviRI* || | | BinI* || | MaeII || MboI || TaiI || SetI |DpnI BstKTI S I N L G S R F K Q R E V S L Q L S I K V L T W D H V S N K G R F L C S C P * K Y * L G I T F Q T K G G F F A V V H K N ----:----|----:----|----:----|----:----|----:----|----:----| L I L K P D R K L C L S T E K C N D M F S Y * S P I V N * V F P P K K A T T W L T N V Q S * T E F L P L N R Q L Q G Y F BetI* |HpaII || AsuI* MnlI || AvaII |BccI ApoI || |BmgT120I || ApoI MseI TspEI || || Hpy166II MseI SetI || TspEI \ \ \\ \\ \ \ \ \\ \ ATTAAAGAATTTTCCGGTCCACTTTTATTTTTAATCAAACCACCTCCATCTAACAGAATT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTTCTTAAAAGGCCAGGTGAAAATAAAAATTAGTTTGGTGGAGGTAGATTGTCTTAA // / //// / / / / / |MseI | |||Hpy166II MseI SetI | BccI TspEI TspEI | |||AvaII MnlI ApoI | |||AsuI* | ||BmgT120I | |BetI* | HpaII TspEI ApoI I K E F S G P L L F L I K P P P S N R I L K N F P V H F Y F * S N H L H L T E F * R I F R S T F I F N Q T T S I * Q N L ----:----|----:----|----:----|----:----|----:----|----:----| I L S N E P G S K N K I L G G G D L L I F * L I K R D V K I K L * V V E M * C F N F F K G T W K * K * D F W R W R V S N CviJI | SduI SetI TspEI | HgiJII* \ \ \ \ TGGTATGCTTTTCGCACCGAACCTATAATGGATTTTGAAATTGAGCCCATTGTCAGTTCA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| ACCATACGAAAAGCGTGGCTTGGATATTACCTAAAACTTTAACTCGGGTAACAGTCAAGT / // / SetI || CviJI |HgiJII* |SduI TspEI W Y A F R T E P I M D F E I E P I V S S G M L F A P N L * W I L K L S P L S V Q V C F S H R T Y N G F * N * A H C Q F K ----:----|----:----|----:----|----:----|----:----|----:----| Q Y A K R V S G I I S K S I S G M T L E K T H K E C R V * L P N Q F Q A W Q * N P I S K A G F R Y H I K F N L G N D T * MaeII | SetI | TaiI BslFI | |MaeIII | Hin4II* TspEI | ||Hpy99I BceAI | |CviJI \ \ \\\ \ \ \\ AGTAAATTATCATACAACGTCGTTACTAACGCTATAAAGAGTAAGTTTGCCGAAGCCGTG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTTAATAGTATGTTGCAGCAATGATTGCGATATTTCTCATTCAAACGGCTTCGGCAC / // / / / / / TspEI || MaeII MaeIII BceAI | CviJI |Hpy99I | BslFI TaiI Hin4II* SetI S K L S Y N V V T N A I K S K F A E A V V N Y H T T S L L T L * R V S L P K P * * I I I Q R R Y * R Y K E * V C R S R E ----:----|----:----|----:----|----:----|----:----|----:----| L L N D Y L T T V L A I F L L N A S A T L Y I I M C R R * * R * L S Y T Q R L R T F * * V V D N S V S Y L T L K G F G H MaeI | PleI | |MlyI | || Csp6I | || |RsaI HinfI | || || Tsp4CI* BseGI FokI SetI \ \ \\ \\ \ \ \ \ AAGGAGTCCCTAGTTGTACCGTTTATGGATGATATTGTTTTTTATCCAACACCTAATGAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTCAGGGATCAACATGGCAAATACCTACTATAACAAAAAATAGGTTGTGGATTACTT / // /// / / / / | || ||Tsp4CI* BseGI FokI SetI MnlI | || |Csp6I | || RsaI | |PleI | |MlyI | MaeI HinfI K E S L V V P F M D D I V F Y P T P N E R S P * L Y R L W M I L F F I Q H L M K G V P S C T V Y G * Y C F L S N T * * S ----:----|----:----|----:----|----:----|----:----|----:----| F S D R T T G N I S S I T K * G V G L S S P T G L Q V T * P H Y Q K K D L V * H L L G * N Y R K H I I N N K I W C R I F BinI* |BseMII ||BspCNI ||| MnlI ||| MboI ||| BamHI ||| XhoII ||| |EcoP15I ||| ||DpnI ||| ||NlaIV ||| |||BstKTI ||| ||||Hpy178III* ||| |||||DdeI ||| |||||SauI* ||| |||||| BseRI ||| |||||| |BinI* ||| |||||| || TseI ||| |||||| || |MnlI ||| |||||| || |BisI ||| |||||| || ||BlsI ||| |||||| || |||AciI ||| |||||| || |||NspBII* ||| |||||| || ||||BisI ||| |||||| || |||||BlsI ||| |||||| || ||||||TauI ||| |||||| || ||||||| BbvI MnlI ||| |||||| || ||||||| |MwoI |AccI ||| |||||| || ||||||| || BbvI ||BssNAI ||| |||||| || ||||||| || CviJI ||Hpy166II ||| |||||| || ||||||| || | SduI ||| MmeI ||| |||||| || ||||||| || | Cac8I ||| |TspDTI ||| |||||| || ||||||| || | HgiJII* ||| ||SetI ||| |||||| || ||||||| || | | BtsI ||| ||| MnlI ||| |||||| || ||||||| || | | | MwoI \\\ \\\ \ \\\ \\\\\\ \\ \\\\\\\ \\ \ \ \ \ GTATACAGAGGTGGTATTTGGGAGGAGCAGGATCCTGAGGCAGCGGCGAGGGCTCGCACT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CATATGTCTCCACCATAAACCCTCCTCGTCCTAGGACTCCGTCGCCGCTCCCGAGCGTGA // // / /// / ////// ///////// / / /// || || MnlI ||| | |||||| ||||||||| | | ||BbvI || |TspDTI ||| | |||||| ||||||||| | | |MwoI || MmeI ||| | |||||| ||||||||| | | Cac8I || SetI ||| | |||||| ||||||||| | | TspRI |AccI ||| | |||||| ||||||||| | | BtsI Hpy166II ||| | |||||| ||||||||| | CviJI BssNAI ||| | |||||| ||||||||| | BbvI ||| | |||||| ||||||||| HgiJII* ||| | |||||| ||||||||| SduI ||| | |||||| ||||||||MwoI ||| | |||||| |||||||BisI ||| | |||||| |||||||AciI ||| | |||||| ||||||BlsI ||| | |||||| |||||NspBII* ||| | |||||| |||||TseI ||| | |||||| |||||TauI ||| | |||||| ||||BisI ||| | |||||| |||BlsI ||| | |||||| ||MnlI ||| | |||||| |BinI* ||| | |||||| SauI* ||| | |||||| DdeI ||| | |||||Hpy178III* ||| | ||||BseRI ||| | |||XhoII ||| | |||BamHI ||| | |||MboI ||| | ||EcoP15I ||| | |NlaIV ||| | |DpnI ||| | BstKTI ||| MnlI ||BinI* |BspCNI BseMII V Y R G G I W E E Q D P E A A A R A R T Y T E V V F G R S R I L R Q R R G L A L I Q R W Y L G G A G S * G S G E G S H C ----:----|----:----|----:----|----:----|----:----|----:----| T Y L P P I Q S S C S G S A A A L A R V L I C L H Y K P P A P D Q P L P S P E C Y V S T T N P L L L I R L C R R P S A S TseI |BisI ||BlsI ||TspRI |||AciI ||||BisI |||||BlsI ||||||TseI ||||||TauI ||||||MwoI |||||||BisI ||||||||BlsI |||||||||CviJI |||||||||| DdeI |||||||||| | Hpy188I |||||||||| | | BbvI |||||||||| | | | MnlI |||||||||| | | | | BspCNI |||||||||| | | | | |BseMII XmnI |||||||||| | | | | || FalI |MnlI |||||||||| | | | | || FalI TspDTI || Hpy178III* |||||||||| | | | | || SpeI |DdeI || | FalI |||||||||| | | | | || |MaeI |Bpu10I DdeI || | FalI \\\\\\\\\\ \ \ \ \ \\ \\ \\ \ \\ \ \ GCTGCGGCAGCCTCAGATATGAATAATACTAGTGCTAAGGAACACTTAGAAGCACTTCAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGCCGTCGGAGTCTATACTTATTATGATCACGATTCCTTGTGAATCTTCGTGAAGTT ///// /// // / // // / / / / / ||||| ||| |DdeI | |BseMII || Bpu10I DdeI | FalI Hpy178III* ||||| ||| | | BspCNI || DdeI | FalI ||||| ||| | | BbvI |TspDTI XmnI ||||| ||| | | FalI |SpeI MnlI ||||| ||| | | FalI MaeI ||||| ||| | MnlI ||||| ||| Hpy188I ||||| ||CviJI ||||| ||TseI ||||| |BisI ||||| BlsI ||||BisI ||||AciI |||BlsI ||MwoI ||TseI ||TauI |BisI BlsI A A A A S D M N N T S A K E H L E A L Q L R Q P Q I * I I L V L R N T * K H F K C G S L R Y E * Y * C * G T L R S T S R ----:----|----:----|----:----|----:----|----:----|----:----| A A A A E S I F L V L A L S C K S A S * Q Q P L R L Y S Y Y * H * P V S L L V E S R C G * I H I I S T S L F V * F C K L EciI |HinfI || TaqI || |TspDTI || ||TfiI CviJI || ||HinfI | SmlI || ||| PleI | AflII CviJI AciI || ||| |MlyI | |MseI HaeIII \ \\ \\\ \\ \ \\ \ GAGGGCGGAATGAAAACCCAGAGTCGAATCAAAAAAGCCTTAAGGCCAGAGAGAAAGAAA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCCGCCTTACTTTTGGGTCTCAGCTTAGTTTTTTCGGAATTCCGGTCTCTCTTTCTTT / / // / // / // / AciI EciI || | |PleI | || HaeIII || | |MlyI | || CviJI || | HinfI | |AflII || | TfiI | |SmlI || TaqI | MseI |HinfI CviJI TspDTI E G G M K T Q S R I K K A L R P E R K K R A E * K P R V E S K K P * G Q R E R K G R N E N P E S N Q K S L K A R E K E R ----:----|----:----|----:----|----:----|----:----|----:----| S P P I F V W L R I L F A K L G S L F F L P R F S F G S D F * F L R L A L S F S L A S H F G L T S D F F G * P W L S L F SetI | MboI | BglII | XhoII | | DpnI | | |BstKTI | | || HindII | | || Hpy166II | | || | Hpy178III* | | || | | HgaI GsuI | | || | | | SfaNI Eco57MI \ \ \\ \ \ \ \ \ GAAAACCTAAAAGATCTTGTTGACGCATCTGGAGTGGCAACGAAAACTACAACCCAGACA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTGGATTTTCTAGAACAACTGCGTAGACCTCACCGTTGCTTTTGATGTTGGGTCTGT / // / / / / / / SetI || | Hpy166II | | SfaNI Eco57MI || | HindII | HgaI GsuI || XhoII Hpy178III* || BglII || MboI |DpnI BstKTI E N L K D L V D A S G V A T K T T T Q T K T * K I L L T H L E W Q R K L Q P R Q K P K R S C * R I W S G N E N Y N P D N ----:----|----:----|----:----|----:----|----:----|----:----| S F R F S R T S A D P T A V F V V V W V L F G L L D Q Q R M Q L P L S F * L G S F V * F I K N V C R S H C R F S C G L C PshAI | MaeIII Hpy188I | Tsp45I AciI | ApoI | Tsp4CI* | FnuDII* BsrI | TspEI BsiYI* \ \ \ \ \ \ \ \ ACAGTCACAACCGCGACTAATGATGATGTTTCCAGTTCTGAAAATTCTACCAAGTCAAGG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCAGTGTTGGCGCTGATTACTACTACAAAGGTCAAGACTTTTAAGATGGTTCAGTTCC // / / / / / / || | FnuDII* BsrI Hpy188I TspEI BsiYI* || | AciI ApoI || Tsp45I || MaeIII |Tsp4CI* PshAI T V T T A T N D D V S S S E N S T K S R Q S Q P R L M M M F P V L K I L P S Q G S H N R D * * * C F Q F * K F Y Q V K E ----:----|----:----|----:----|----:----|----:----|----:----| V T V V A V L S S T E L E S F E V L D L L L * L R S * H H H K W N Q F N * W T L C D C G R S I I I N G T R F I R G L * P Hpy178III* | ApoI | TspEI Hpy178III* XmnI | EcoRI | BccI TspEI \ \ \ \ \ \ AAATACTTCAAGAATTCAATCAAGAAAATCGGTAGATGGTATAAGGATAATGTTGGTAAT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTTATGAAGTTCTTAAGTTAGTTCTTTTAGCCATCTACCATATTCCTATTACAACCATTA / / / / / XmnI | EcoRI | BccI | TspEI Hpy178III* | ApoI Hpy178III* K Y F K N S I K K I G R W Y K D N V G N N T S R I Q S R K S V D G I R I M L V I I L Q E F N Q E N R * M V * G * C W * F ----:----|----:----|----:----|----:----|----:----|----:----| F Y K L F E I L F I P L H Y L S L T P L S I S * S N L * S F R Y I T Y P Y H Q Y F V E L I * D L F D T S P I L I I N T I TaqI FokI TfiI | MaeIII MboII | Hpy178III* HinfI | Tsp45I | BseGI | |TspDTI | Hin4I \ \ \ \ \ \\ \ \ TCGAGTGACACCGAAGATATGGATGAAATAGATGTTCAAGATAAGAAAAATGACGATTCA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTCACTGTGGCTTCTATACCTACTTTATCTACAAGTTCTATTCTTTTTACTGCTAAGT / / / // / // / / | TaqI Tsp45I |BseGI | |Hpy178III* | HinfI TspEI MaeIII MboII | FokI | TfiI TspDTI Hin4I S S D T E D M D E I D V Q D K K N D D S R V T P K I W M K * M F K I R K M T I Q E * H R R Y G * N R C S R * E K * R F S ----:----|----:----|----:----|----:----|----:----|----:----| E L S V S S I S S I S T * S L F F S S E N S H C R L Y P H F L H E L Y S F H R N R T V G F I H I F Y I N L I L F I V I * TfiI EcoP15I HinfI |Hin4I | Hpy188I || BseGI BsmAI | | FokI || | AjuI Eco31I \ \ \ \\ \ \ \ GCAGATGAGAGAGAATCAGATAATCCTATCCTTACATCCAATCCAAAAATGATTTCTAAT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCTACTCTCTCTTAGTCTATTAGGATAGGAATGTAGGTTAGGTTTTTACTAAAGATTA // / // |Hpy188I Hin4I |BseGI HinfI FokI EcoP15I TfiI AjuI A D E R E S D N P I L T S N P K M I S N Q M R E N Q I I L S L H P I Q K * F L I R * E R I R * S Y P Y I Q S K N D F * * ----:----|----:----|----:----|----:----|----:----|----:----| A S S L S D S L G I R V D L G F I I E L L L H S L I L Y D * G * M W D L F S K * C I L S F * I I R D K C G I W F H N R I AjuI FalI BsaXI FalI | Tsp4CI* |BsrI | Hin4II* ||AjuI StuI | | MseI ||| Csp6I XmnI | | | AjuI ||| |RsaI CviJI | | | FalI Hin4II* BsaXI ||| |Hin4II* HaeIII | | | FalI | MaeI Hin4II* \\\ \\ \ \ \ \ \ \ \ \ AGGAGACCAGTACCAAGAAGGCCTTCACAACCGTTAAATACACTATCTCCAAAACTAGAA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTCTGGTCATGGTTCTTCCGGAAGTGTTGGCAATTTATGTGATAGAGGTTTTGATCTT / / / /// / / / / / / / / | | BsrI ||Csp6I | | | | MseI | | Hin4II* | AjuI |RsaI | | | FalI | BsaXI Eco31I Hin4II* | | | FalI | MaeI BsmAI | | | AjuI Hin4II* FalI | | Hin4II* FalI | | Tsp4CI* AjuI | BsaXI HaeIII CviJI XmnI StuI R R P V P R R P S Q P L N T L S P K L E G D Q Y Q E G L H N R * I H Y L Q N * K E T S T K K A F T T V K Y T I S K T R R ----:----|----:----|----:----|----:----|----:----|----:----| L L G T G L L G E C G N F V S D G F S S Y S V L V L F A K V V T L Y V I E L V L P S W Y W S P R * L R * I C * R W F * F DdeI | ApoI Tsp4CI* BseMII | TspEI | Hpy99I |BspCNI | TspRI BsrI | |CviJI \\ \ \ \ \ \\ GGCAGGAAGGAAAAAGACACTGAGAATTTTCCAGTTCCACCGTCGGCTTCAAATATGAAT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTCCTTCCTTTTTCTGTGACTCTTAAAAGGTCAAGGTGGCAGCCGAAGTTTATACTTA // / / // / / || TspRI DdeI |BsrI | CviJI |BspCNI TspEI Tsp4CI* BseMII ApoI Hpy99I G R K E K D T E N F P V P P S A S N M N A G R K K T L R I F Q F H R R L Q I * M Q E G K R H * E F S S S T V G F K Y E C ----:----|----:----|----:----|----:----|----:----|----:----| P L F S F S V S F K G T G G D A E F I F L C S P F L C Q S N E L E V T P K L Y S A P L F F V S L I K W N W R R S * I H I BciVI |TfiI |HinfI || MnlI BsmI TspDTI XmnI || | DdeI \ \ \ \\ \ \ GCTTCAAAGATGTTTGCGAACAAAGAAAATAGAAAGTTTTCTGTATCCTCAAATGATTCT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGTTTCTACAAACGCTTGTTTCTTTTATCTTTCAAAAGACATAGGAGTTTACTAAGA / / / / / / BsmI TspDTI XmnI | | HinfI | | TfiI | MnlI BciVI A S K M F A N K E N R K F S V S S N D S L Q R C L R T K K I E S F L Y P Q M I L F K D V C E Q R K * K V F C I L K * F S ----:----|----:----|----:----|----:----|----:----|----:----| A E F I N A F L S F L F N E T D E F S E H K L S T Q S C L F Y F T K Q I R L H N S * L H K R V F F I S L K R Y G * I I R BspCNI |BseMII || BinI* || | MboI || | | DpnI || | | |BstKTI || | | || FatI || | | || |CviAII || | | || || HphI || | | || || NlaIII || | | || || | HindIII || | | || || | | BdaI || | | || || | | BdaI AluI Hpy188I || | | || || | | AluI CviJI |ApoI || | | || || | | CviJI | SetI |TspEI || | | || || | | | SetI | |SmlI |EcoRI || | | || || | | | | Bce83I* | || HindIII \\ \\ \ \ \\ \\ \ \ \ \ \ \ \\ \ CAGAATTCGCTCAAAAATGGTGATCCCCATGTGAAAGCTTCAAAACTTGAAAGCTCTCAA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTTAAGCGAGTTTTTACCACTAGGGGTACACTTTCGAAGTTTTGAACTTTCGAGAGTT // / // / // / / // / / / / / // |DdeI | || | || | | || | | HindIII | CviJI |SmlI | | || | || | | || | | Bce83I* | AluI SetI | | || | || | | || | CviJI SetI | | || | || | | || | AluI | | || | || | | || SetI | | || | || | | || BdaI | | || | || | | || BdaI | | || | || | | |FatI | | || | || | | CviAII | | || | || | | HphI | | || | || | NlaIII | | || | || MboI | | || | |DpnI | | || | BstKTI | | || BinI* | | |BseMII | | BspCNI | EcoRI | TspEI | ApoI Hpy188I Q N S L K N G D P H V K A S K L E S S Q R I R S K M V I P M * K L Q N L K A L K E F A Q K W * S P C E S F K T * K L S S ----:----|----:----|----:----|----:----|----:----|----:----| * F E S L F P S G W T F A E F S S L E * E S N A * F H H D G H S L K L V Q F S E L I R E F I T I G M H F S * F K F A R L SetI BbvII* |DdeI || Hpy188I || |TfiI AluI MseI || |HinfI MseI CviJI | BdaI || |MboII |BspCNI | SetI | BdaI || || MnlI ||BseMII CviJI BceAI \ \ \ \ \\ \\ \ \\\ \ \ GCTTTTGTTAAGAAGACCTCTCAGAATCGTTTTAATGACGGCTTTTTCAAGCAAGATTTA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAAACAATTCTTCTGGAGAGTCTTAGCAAAATTACTGCCGAAAAAGTTCGTTCTAAAT / / // / // // // / / / | | |MseI SetI || || || MseI CviJI BceAI | | BdaI || || |BseMII | | BdaI || || BspCNI | HindIII || |HinfI CviJI || |TfiI AluI || MnlI |BbvII* |MboII |DdeI Hpy188I A F V K K T S Q N R F N D G F F K Q D L L L L R R P L R I V L M T A F S S K I * F C * E D L S E S F * * R L F Q A R F R ----:----|----:----|----:----|----:----|----:----|----:----| A K T L F V E * F R K L S P K K L C S K L K Q * S S R E S D N * H R S K * A L N S K N L L G R L I T K I V A K E L L I * MboII | CviJI | | SduI ApoI | | HgiJII* TspEI | | | Tsp4CI* \ \ \ \ \ GAATTTGAAGAACAGCGAGAGCCCAAACTGTGA 2290 2300 2310 ----:----|----:----|----:----|--- CTTAAACTTCTTGTCGCTCTCGGGTTTGACACT / // / / TspEI || CviJI Tsp4CI* ApoI |HgiJII* |SduI MboII E F E E Q R E P K L * N L K N S E S P N C X I * R T A R A Q T V X ----:----|----:----|----:----|--- S N S S C R S G L S H L I Q L V A L A W V T F K F F L S L G F Q S # Enzymes that cut Frequency Isoschizomers AccI 2 FblI,XmiI AciI 5 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AhaIII* 1 DraI AjuI 2 AluI 9 AluBI AlwNI 1 CaiI ApoI 10 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BamHI 2 BbvI 4 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 2 Bce83I* 1 BpuEI BceAI 2 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BdaI 2 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 7 AlwI,BspPI,AclWI BisI 6 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 6 BmgT120I 4 BmtI 1 BspOI Bpu10I 1 BsaBI 1 Bse8I,BseJI BsaXI 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 7 BseRI 1 BsgI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 7 BspHI 2 CciI,PagI,RcaI BsrI 6 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 1 BstKTI 8 BstXI 1 BtrI 1 BmgBI,AjiI BtsI 2 Cac8I 5 BstC8I Csp6I 3 CviQI,RsaNI CviAII 7 CviJI 24 CviKI-1 CviRI* 7 HpyCH4V DdeI 14 BstDEI,HpyF3I DpnI 8 MalI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 2 EcoP15I 3 EcoRI 3 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FalI 4 FatI 7 FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 GsuI 1 BpmI HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 3 Eco24I,EcoT38I,FriOI,BanII Hin4I 2 Hin4II* 7 HpyAV HindII 3 HincII HindIII 2 HinfI 12 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 14 Hpy188III Hpy188I 7 Hpy99I 4 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 6 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 7 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 13 MfeI 1 MunI MlyI 3 SchI MmeI 2 MnlI 17 MseI 12 Tru1I,Tru9I MwoI 7 HpyF10VI,BstMWI NheI 1 AsuNHI NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspBII* 1 MspA1I PasI 1 PleI 3 PpsI PshAI 1 BstPAI,BoxI RsaI 3 AfaI SalI 1 SapI 2 LguI,PciSI,BspQI SauI* 2 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 28 SfaNI 3 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 2 SmoI SpeI 1 BcuI,AhlI SspI 1 StuI 1 Eco147I,PceI,SseBI,AatI TaiI 5 TaqI 10 TaqII 1 TatI 1 TauI 2 TfiI 9 PfeI TseI 4 ApeKI Tsp45I 4 NmuCI Tsp4CI* 9 HpyCH4III,TaaI,Bst4CI TspDTI 8 TspEI 24 TasI,Tsp509I,Sse9I TspRI 4 TscAI XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 4 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflIII AgeI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BarI BbvCI BcgI BglI BmeT110I BplI BsaAI BsePI BseSI BseYI BsiI* Bsp120I BspLU11I* BspMI BspMII* BsrBI BsrDI BstEII BtgZI CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I Ecl136II Eco47III EcoICRI EcoNI EcoT22I EgeI EheI Esp3I EspI* FauI FseI FspAI GlaI GsaI HaeII HgiCI* HhaI Hin6I HinP1I HspAI KasI KpnI MauBI McrI* MluI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NmeAIII NotI NsiI NspI OliI PacI PflMI PfoI PmaCI PmeI PpiI PpuMI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SanDI ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StyI SwaI TsoI TspGWI TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769