Restriction Map of SUA7/YPR086W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

SUA7/YPR086W on chromosome XVI from coordinates 710101 to 711138.


AsuI* AvaII DraII PpuMI |NlaIV |BmgT120I Hpy188I MaeI Hin4II* || MboII | SspI \ \ \\ \ \ \ ATGATGACTAGGGAGAGCATAGATAAAAGAGCAGGAAGAAGGGGTCCTAATCTGAATATT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTACTGATCCCTCTCGTATCTATTTTCTCGTCCTTCTTCCCCAGGATTAGACTTATAA / / /// / / MaeI Hin4II* ||MboII | SspI ||PpuMI Hpy188I ||DraII ||AvaII ||AsuI* |BmgT120I NlaIV M M T R E S I D K R A G R R G P N L N I * * L G R A * I K E Q E E G V L I * I L D D * G E H R * K S R K K G S * S E Y C ----:----|----:----|----:----|----:----|----:----|----:----| X I V L S L M S L L A P L L P G L R F I X S S * P S C L Y F L L F F P D * D S Y H H S P L A Y I F S C S S P T R I Q I N MaeII AflIII |BtrI || SetI || TaiI || | BetI* || | BspMII* || | |HpaII || | |Hpy178III* || | || CviRI* || | || | AccI || | || | |Hpy166II Hin4II* \\ \ \\ \ \\ \ GTGCTGACGTGTCCGGAGTGCAAAGTCTACCCACCAAAAATCGTTGAAAGATTTAGTGAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CACGACTGCACAGGCCTCACGTTTCAGATGGGTGGTTTTTAGCAACTTTCTAAATCACTT / // / // / // / | || | || CviRI* |AccI Hin4II* | || | |BspMII* Hpy166II | || | |BetI* | || | Hpy178III* | || | HpaII | || AflIII | |MaeII | BtrI TaiI SetI V L T C P E C K V Y P P K I V E R F S E C * R V R S A K S T H Q K S L K D L V K A D V S G V Q S L P T K N R * K I * * R ----:----|----:----|----:----|----:----|----:----|----:----| T S V H G S H L T * G G F I T S L N L S Q A S T D P T C L R G V L F R Q F I * H H Q R T R L A F D V W W F D N F S K T F BsrI |HindII |Hpy166II || BssKI MaeI || SexAI | TatI Hpy188I || EcoRII FokI | |Csp6I | MmeI || | ScrFI | SduI | ||RsaI | | Hin4I || | BseBI BseGI | HgiAI* | ||ScaI | | Hin4I || | Eam1105I \ \ \ \ \\\ \ \ \ \\ \ \ GGGGATGTTGTATGTGCTCTATGTGGTCTAGTACTATCAGATAAACTGGTTGACACCAGG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCCCTACAACATACACGAGATACACCAGATCATGATAGTCTATTTGACCAACTGTGGTCC / / / / /// // / / /// / BseGI | FokI | ||| |MmeI | | ||| EcoRII HgiAI* | ||| Hpy188I | | ||| SexAI SduI | ||| Hin4I | | ||| BssKI | ||| Hin4I | | ||BseBI | ||TatI | | ||ScrFI | |Csp6I | | |SetI | ScaI | | Eam1105I | RsaI | Hpy166II MaeI | HindII BsrI G D V V C A L C G L V L S D K L V D T R G M L Y V L Y V V * Y Y Q I N W L T P G G C C M C S M W S S T I R * T G * H Q V ----:----|----:----|----:----|----:----|----:----|----:----| P S T T H A R H P R T S D S L S T S V L L P H Q I H E I H D L V I L Y V P Q C W P I N Y T S * T T * Y * * I F Q N V G P AclI MboI MaeII BclI | XmnI | DpnI | Hin4I | |BstKTI | Hin4I | || OliI SetI | |SetI | || MslI PshAI | Hpy188I | |TaiI | || | Tsp4CI* | HphI MnlI \ \ \ \\ \ \\ \ \ \ \ \ TCGGAGTGGAGAACGTTTTCAAATGATGATCACAACGGTGATGACCCAAGTCGTGTTGGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGCCTCACCTCTTGCAAAAGTTTACTACTAGTGTTGCCACTACTGGGTTCAGCACAACCA / / / / // / // // / Hpy188I | | MaeII || | |Tsp4CI* |HphI MnlI | | XmnI || | MslI PshAI | | AclI || | OliI | TaiI || BclI | SetI || MboI Hin4I |DpnI Hin4I BstKTI S E W R T F S N D D H N G D D P S R V G R S G E R F Q M M I T T V M T Q V V L V G V E N V F K * * S Q R * * P K S C W * ----:----|----:----|----:----|----:----|----:----|----:----| D S H L V N E F S S * L P S S G L R T P T P T S F T K L H H D C R H H G L D H Q R L P S R K * I I I V V T I V W T T N T MboI | DpnI | |BstKTI | || Hpy188I CviJI HphI BccI MnlI SetI | || | BinI* \ \ \ \ \ \ \\ \ \ GAGGCTTCAAATCCTCTTTTAGATGGGAATAACCTATCTACAAGGATCGGAAAGGGTGAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCGAAGTTTAGGAGAAAATCTACCCTTATTGGATAGATGTTCCTAGCCTTTCCCACTT / / / / / // / / | HphI BccI MnlI SetI || | BinI* CviJI || Hpy188I || MboI |DpnI BstKTI E A S N P L L D G N N L S T R I G K G E R L Q I L F * M G I T Y L Q G S E R V K G F K S S F R W E * P I Y K D R K G * N ----:----|----:----|----:----|----:----|----:----|----:----| S A E F G R K S P F L R D V L I P F P S H P K L D E K L H S Y G I * L S R F P H L S * I R K * I P I V * R C P D S L T F SecI* DsaI* | MslI TfiI | HphI HinfI | | HphI | TspGWI TstI BccI \ \ \ \ \ \ \ ACCACGGATATGAGATTCACCAAAGAACTGAATAAGGCACAAGGAAAAAATGTGATGGAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTGCCTATACTCTAAGTGGTTTCTTGACTTATTCCGTGTTCCTTTTTTACACTACCTA /// / / / ||HphI TspGWI TstI BccI |MslI HinfI DsaI* TfiI SecI* HphI T T D M R F T K E L N K A Q G K N V M D P R I * D S P K N * I R H K E K M * W I H G Y E I H Q R T E * G T R K K C D G * ----:----|----:----|----:----|----:----|----:----|----:----| V V S I L N V L S S F L A C P F F T I S F W P Y S I * W L V S Y P V L F F H S P G R I H S E G F F Q I L C L S F I H H I TseI AluI CviJI |BisI ||BlsI ||SetI |||CviRI* FatI ||||TspDTI |BbvI TatI ||||| MwoI |SfaNI TseI TstI |Csp6I ||||| EcoP15I |CviAII |BisI | BbvI ||RsaI ||||| | DdeI || NlaIII ||BlsI \ \ \\\ \\\\\ \ \ \\ \ \\\ AAAAAGGATAATGAAGTACAAGCTGCATTTGCTAAGATTACCATGCTATGTGATGCTGCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTCCTATTACTTCATGTTCGACGTAAACGATTCTAATGGTACGATACACTACGACGA / / //// //// / / / /// /// TstI | |||| |||| | DdeI | ||SfaNI ||TseI | |||| |||| EcoP15I | ||BbvI |BisI | |||| |||CviRI* | |FatI BlsI | |||| |||MwoI | CviAII | |||| |||TseI NlaIII | |||| ||TspDTI | |||| ||BisI | |||| |BlsI | |||| CviJI | |||| AluI | |||SetI | ||TatI | |Csp6I | RsaI BbvI K K D N E V Q A A F A K I T M L C D A A K R I M K Y K L H L L R L P C Y V M L L K G * * S T S C I C * D Y H A M * C C * ----:----|----:----|----:----|----:----|----:----|----:----| L F S L S T C A A N A L I V M S H S A A Y F P Y H L V L Q M Q * S * W A I H H Q F L I I F Y L S C K S L N G H * T I S S StyI SecI* TspEI MboII | MwoI \ \ \ \ GAATTACCGAAGATTGTGAAAGATTGTGCCAAGGAAGCATATAAACTTTGCCACGATGAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAATGGCTTCTAACACTTTCTAACACGGTTCCTTCGTATATTTGAAACGGTGCTACTT / / / / TspEI MboII | SecI* | StyI MwoI E L P K I V K D C A K E A Y K L C H D E N Y R R L * K I V P R K H I N F A T M K I T E D C E R L C Q G S I * T L P R * K ----:----|----:----|----:----|----:----|----:----|----:----| S N G F I T F S Q A L S A Y L S Q W S S Q I V S S Q S L N H W P L M Y V K G R H F * R L N H F I T G L F C I F K A V I F TseI CviJI |BisI ||BlsI BbvI |||BseGI Hin4II* TspDTI | FokI |||CviRI* SfaNI CviRI* \ \ \ \ \\\\ \ \ AAAACTTTGAAGGGGAAATCAATGGAGAGTATAATGGCTGCATCCATACTGATTGGTTGC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGAAACTTCCCCTTTAGTTACCTCTCATATTACCGACGTAGGTATGACTAACCAACG / / / / //// / / | TspDTI | FokI |||CviRI* SfaNI CviRI* Hin4II* BbvI |||TseI ||BisI |BseGI |BlsI CviJI K T L K G K S M E S I M A A S I L I G C K L * R G N Q W R V * W L H P Y * L V A N F E G E I N G E Y N G C I H T D W L Q ----:----|----:----|----:----|----:----|----:----|----:----| F V K F P F D I S L I I A A D M S I P Q F F K S P S I L P S Y L P Q M W V S Q N F S Q L P F * H L T Y H S C G Y Q N T A MseI MaeII |AhaIII* |BtrI || Eco57I FatI || SetI || Eco57MI MseI |CviAII || TaiI MwoI || | BsrI VspI || NlaIII \\ \ \ \\ \ \ \ \\ \ AGACGTGCTGAAGTGGCAAGGACTTTTAAAGAAATCCAGTCATTAATCCATGTCAAAACT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGCACGACTTCACCGTTCCTGAAAATTTCTTTAGGTCAGTAATTAGGTACAGTTTTGA / // / // / / / // | || MwoI |MseI BsrI | | |FatI | |MaeII Eco57MI | | CviAII | BtrI AhaIII* | NlaIII TaiI Eco57I VspI SetI MseI R R A E V A R T F K E I Q S L I H V K T D V L K W Q G L L K K S S H * S M S K L T C * S G K D F * R N P V I N P C Q N * ----:----|----:----|----:----|----:----|----:----|----:----| L R A S T A L V K L S I W D N I W T L V C V H Q L P L S K * L F G T M L G H * F S T S F H C P S K F F D L * * D M D F S MnlI | MseI MseI | | MboII |AhaIII* | | |TspDTI BccI \\ \ \ \\ \ AAAGAGTTTGGTAAAACTTTAAACATAATGAAGAACATTTTAAGAGGCAAGAGCGAAGAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTCAAACCATTTTGAAATTTGTATTACTTCTTGTAAAATTCTCCGTTCTCGCTTCTA // / // / |MseI MnlI |MseI BccI AhaIII* TspDTI MboII K E F G K T L N I M K N I L R G K S E D K S L V K L * T * * R T F * E A R A K M R V W * N F K H N E E H F K R Q E R R W ----:----|----:----|----:----|----:----|----:----|----:----| L S N P L V K F M I F F M K L P L L S S * L T Q Y F K L C L S S C K L L C S R L F L K T F S * V Y H L V N * S A L A F I ApaLI | CviRI* BssKI | Hpy166II SecI* | | SduI EcoRII Hpy178III* | | BseSI | ScrFI |MboII MboII | | HgiAI* SetI | BseBI \\ \ \ \ \ \ \ \ GGTTTCTTGAAGATTGATACCGATAATATGAGTGGTGCACAAAACCTAACTTATATACCC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAAGAACTTCTAACTATGGCTATTATACTCACCACGTGTTTTGGATTGAATATATGGG / / / / / / / / | Hpy178III* MboII | | | SetI SetI MboII | | ApaLI | Hpy166II | CviRI* HgiAI* BseSI SduI G F L K I D T D N M S G A Q N L T Y I P V S * R L I P I I * V V H K T * L I Y P F L E D * Y R * Y E W C T K P N L Y T Q ----:----|----:----|----:----|----:----|----:----|----:----| P K K F I S V S L I L P A C F R V * I G H N R S S Q Y R Y Y S H H V F G L K Y V T E Q L N I G I I H T T C L V * S I Y G EcoP15I |SfaNI CviRI* || CviJI | MaeIII SetI || |SfaNI | Tsp45I AciI \ \\ \\ \ \ \ AGGTTTTGTTCGCATCTGGGCTTACCGATGCAAGTCACTACTTCTGCTGAATATACCGCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TCCAAAACAAGCGTAGACCCGAATGGCTACGTTCAGTGATGAAGACGACTTATATGGCGT /// / // / / / / ||EcoRII | || | CviRI* Tsp45I AciI ||BssKI | || SfaNI MaeIII |SecI* | |SfaNI BseBI | CviJI ScrFI EcoP15I R F C S H L G L P M Q V T T S A E Y T A G F V R I W A Y R C K S L L L L N I P Q V L F A S G L T D A S H Y F C * I Y R K ----:----|----:----|----:----|----:----|----:----|----:----| L N Q E C R P K G I C T V V E A S Y V A W T K N A D P S V S A L * * K Q Q I Y R P K T R M Q A * R H L D S S R S F I G C MboI | DpnI | |BstKTI | || BspMI | || | TspEI | || | | CviRI* | || | | | SetI \ \\ \ \ \ \ AAGAAATGTAAAGAGATCAAAGAAATTGCAGGTAAATCCCCTATTACTATCGCTGTTGTT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTACATTTCTCTAGTTTCTTTAACGTCCATTTAGGGGATAATGATAGCGACAACAA // / / /// || MboI | ||SetI |DpnI | |CviRI* BstKTI | TspEI BspMI K K C K E I K E I A G K S P I T I A V V R N V K R S K K L Q V N P L L L S L L F E M * R D Q R N C R * I P Y Y Y R C C F ----:----|----:----|----:----|----:----|----:----|----:----| F F H L S I L S I A P L D G I V I A T T L S I Y L S * L F Q L Y I G * * * R Q Q L F T F L D F F N C T F G R N S D S N N BinI* | MboI AsuI* | XhoII AciI |BbvI | Hpy188I | TseI |BmgT120I BccI | | DpnI | |BisI ||CviJI FokI | BseGI | | |BstKTI | ||BlsI ||HaeIII \ \ \ \ \ \\ \ \\\ \\\ TCCATCTATCTAAACATCCTGCTCTTTCAGATCCCTATTACCGCAGCGAAAGTGGGCCAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTAGATAGATTTGTAGGACGAGAAAGTCTAGGGATAATGGCGTCGCTTTCACCCGGTT / // / / // / //// // // FokI |BseGI | | || XhoII |||TseI || |SetI BccI | | || MboI ||BisI || BbvI | | |DpnI |BlsI |AsuI* | | BstKTI AciI BmgT120I | Hpy188I HaeIII BinI* CviJI S I Y L N I L L F Q I P I T A A K V G Q P S I * T S C S F R S L L P Q R K W A K H L S K H P A L S D P Y Y R S E S G P N ----:----|----:----|----:----|----:----|----:----|----:----| E M * R F M R S K * I G I V A A F T P W K W R D L C G A R E S G * * R L S L P G G D I * V D Q E K L D R N G C R F H A L Acc65I HgiCI* |Csp6I ||RsaI SetI ||SetI BccI | CviRI* ||NlaIV | MaeIII | | MaeIII ||| TsoI | |Eco57I | | |Hin4II* ||| KpnI | |Eco57MI BsmAI \ \ \\ \\\ \ \ \\ \ ACCTTGCAAGTTACTGAAGGTACCATCAAATCTGGTTACAAGATACTTTATGAGCATAGA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TGGAACGTTCAATGACTTCCATGGTAGTTTAGACCAATGTTCTATGAAATACTCGTATCT / / / / / /// // / / | | | | | ||HgiCI* || MaeIII BsmAI | | | | | ||Acc65I |Eco57MI | | | | | |Csp6I |Eco57I | | | | | NlaIV BccI | | | | | RsaI | | | | | TsoI | | | | KpnI | | | SetI | | MaeIII | Hin4II* CviRI* T L Q V T E G T I K S G Y K I L Y E H R P C K L L K V P S N L V T R Y F M S I E L A S Y * R Y H Q I W L Q D T L * A * R ----:----|----:----|----:----|----:----|----:----|----:----| V K C T V S P V M L D P * L I S * S C L F R A L * Q L Y W * I Q N C S V K H A Y G Q L N S F T G D F R T V L Y K I L M S HindIII | AluI | CviJI | |AlfI | |AlfI | |BinI* | ||SetI | ||| MboI | ||| BamHI | ||| XhoII | ||| | DpnI | ||| | NlaIV | ||| | |BstKTI | ||| | ||AciI | ||| | ||| TseI | ||| | ||| |BisI | ||| | ||| ||BlsI | ||| | ||| ||BinI* BssKI | ||| | ||| |||AluI |HpaII | ||| | ||| |||CviJI AlfI ||ScrFI | ||| | ||| |||| SetI BbvI AlfI ||CauII* \ \\\ \ \\\ \\\\ \ \ \ \\\ GACAAGCTTGTGGATCCGCAGCTTATTGCTAATGGTGTAGTGTCTTTGGATAACTTACCG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTCGAACACCTAGGCGTCGAATAACGATTACCACATCACAGAAACCTATTGAATGGC /// / // / //// / / / ||| | || | |||BinI* BbvI AlfI CauII* ||| | || | |||CviJI AlfI HpaII ||| | || | |||TseI ScrFI ||| | || | |||AluI ||| | || | ||BisI ||| | || | |BlsI ||| | || | |SetI ||| | || | AciI ||| | || XhoII ||| | || BamHI ||| | || MboI ||| | |NlaIV ||| | |DpnI ||| | BstKTI ||| HindIII ||| BinI* ||CviJI ||AluI |AlfI |AlfI SetI D K L V D P Q L I A N G V V S L D N L P T S L W I R S L L L M V * C L W I T Y R Q A C G S A A Y C * W C S V F G * L T G ----:----|----:----|----:----|----:----|----:----|----:----| S L S T S G C S I A L P T T D K S L K G L C A Q P D A A * Q * H H L T K P Y S V V L K H I R L K N S I T Y H R Q I V * R GGCGTTGAAAAGAAATAA 1030 ----:----|----:--- CCGCAACTTTTCTTTATT / BssKI G V E K K * A L K R N X R * K E I X ----:----|----:--- P T S F F Y P R Q F S I A N F L F L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 3 BspACI,SsiI AclI 1 Psp1406I AflIII 1 AhaIII* 2 DraI AlfI 2 AluI 3 AluBI ApaLI 1 Alw44I,VneI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BamHI 1 BbvI 5 BseXI,BstV1I,Lsp1109I BccI 5 BclI 1 FbaI,Ksp22I BetI* 1 BsaWI BinI* 4 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmgT120I 2 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseSI 1 BaeGI,BstSLI BsmAI 1 Alw26I,BstMAI BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 2 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstKTI 5 BtrI 2 BmgBI,AjiI CauII* 1 BcnI,BpuMI,NciI,AsuC2I Csp6I 3 CviQI,RsaNI CviAII 2 CviJI 7 CviKI-1 CviRI* 8 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 5 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco57I 2 AcuI Eco57MI 2 EcoP15I 2 EcoRII 2 AjnI,Psp6I,PspGI FatI 2 FokI 3 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4I 2 Hin4II* 4 HpyAV HindII 1 HincII HindIII 1 HinfI 1 HpaII 2 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 5 KpnI 1 MaeI 2 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 3 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MmeI 1 MnlI 3 MseI 4 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I OliI 1 AleI PpuMI 1 Psp5II,PspPPI PshAI 1 BstPAI,BoxI RsaI 3 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 13 SexAI 1 MabI SfaNI 4 LweI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TatI 2 TfiI 1 PfeI TseI 5 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 2 TasI,Tsp509I,Sse9I TspGWI 1 TstI 1 VspI 1 PshBI,AseI XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AcyI AflII AgeI AjuI AloI AlwNI ApaI ApoI AscI AsuII AvaI AvrII BaeI BalI BarI BbvCI BbvII* Bce83I* BceAI BcgI BciVI BdaI BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseMII BsePI BseRI BseYI BsgI BsiI* BsiYI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtsI Cac8I Cfr10I Cfr9I CfrI ClaI CspCI DinI DraIII DrdI EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HgaI HgiJII* HhaI Hin6I HinP1I HpaI Hpy99I HspAI KasI Ksp632I* MauBI McrI* MfeI MluI MlyI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SchI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqI TaqII TauI TspMI TspRI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769