Restriction Map of GRS2/YPR081C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

GRS2/YPR081C on chromosome XVI from coordinates 703970 to 702114.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.15867

EMBOSS_001 TatI |MnlI |Csp6I MseI TspEI Hpy188I TspEI ||RsaI Hin4II* SetI \ \ \ \ \\\ \ \ ATGCCGTTAATGTCCAATTCGGAAAGAGATAAATTGGAAAGTACATTGAGGAGAAGGTTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGCAATTACAGGTTAAGCCTTTCTCTATTTAACCTTTCATGTAACTCCTCTTCCAAA / // / / /// / / MseI |Hpy188I | | ||| Hin4II* SetI TspEI | | ||TatI | | |Csp6I | | RsaI | MnlI TspEI M P L M S N S E R D K L E S T L R R R F C R * C P I R K E I N W K V H * G E G F A V N V Q F G K R * I G K Y I E E K V F ----:----|----:----|----:----|----:----|----:----|----:----| X G N I D L E S L S L N S L V N L L L N X A T L T W N P F L Y I P F Y M S S F T H R * H G I R F S I F Q F T C Q P S P K AsuI* DraII |BmgT120I ||CviJI ||HaeIII BseRI MnlI SetI ||| BssKI \ \ \ \\\ \ TTCTACACACCCTCGTTTGAGATATATGGTGGTGTGTCAGGTTTATTTGATTTAGGGCCT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AAGATGTGTGGGAGCAAACTCTATATACCACCACACAGTCCAAATAAACTAAATCCCGGA / / / // BseRI MnlI SetI |DraII |AsuI* BmgT120I HaeIII CviJI F Y T P S F E I Y G G V S G L F D L G P S T H P R L R Y M V V C Q V Y L I * G L L H T L V * D I W W C V R F I * F R A S ----:----|----:----|----:----|----:----|----:----|----:----| K * V G E N S I Y P P T D P K N S K P G K R C V R T Q S I H H H T L N I Q N L A E V C G R K L Y I T T H * T * K I * P R HpaII |ScrFI TfiI |CauII* HinfI Eco57I || MnlI CviRI* | TaqI Tsp4CI* Eco57MI \\ \ \ \ \ \ \ CCGGGTTGTCAGTTGCAAAATAACTTGATTCGACTGTGGCGAGAACATTTTATTATGGAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGCCCAACAGTCAACGTTTTATTGAACTAAGCTGACACCGCTCTTGTAAAATAATACCTT / / / / / / / / | | MnlI CviRI* | | Tsp4CI* Eco57MI | BssKI | TaqI Eco57I CauII* HinfI HpaII TfiI ScrFI P G C Q L Q N N L I R L W R E H F I M E R V V S C K I T * F D C G E N I L L W K G L S V A K * L D S T V A R T F Y Y G R ----:----|----:----|----:----|----:----|----:----|----:----| G P Q * N C F L K I R S H R S C K I I S E P N D T A F Y S S E V T A L V N * * P R T T L Q L I V Q N S Q P S F M K N H F FatI |CviAII || NspI || NlaIII AsuI* || |MboII |BmgT120I || || BccI ||CviJI || || | SetI ||HaeIII BbvII* \\ \\ \ \ \\\ \ GAAAACATGCTTCAGGTTGATGGGCCAATGCTAACTCCTTACGATGTGTTGAAGACTTCT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTGTACGAAGTCCAACTACCCGGTTACGATTGAGGAATGCTACACAACTTCTGAAGA / // // // | || |BccI |AsuI* | || SetI BmgT120I | |MboII HaeIII | |FatI CviJI | CviAII NlaIII NspI E N M L Q V D G P M L T P Y D V L K T S K T C F R L M G Q C * L L T M C * R L L K H A S G * W A N A N S L R C V E D F W ----:----|----:----|----:----|----:----|----:----|----:----| S F M S * T S P G I S V G * S T N F V E L F C A E P Q H A L A L E K R H T S S K F V H K L N I P W H * S R V I H Q L S R FatI MboII |CviAII || NspI || NlaIII || |AccI || ||Hpy166II || ||| ApoI FokI BsiYI* BfiI || ||| TspEI BseGI | DdeI | BsrI |SfeI* \\ \\\ \ \ \ \ \ \ \\ GGGCATGTAGACAAATTTACTGATTGGATGTGCCGAAATCCTAAGACTGGGGAATACTAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCCGTACATCTGTTTAAATGACTAACCTACACGGCTTTAGGATTCTGACCCCTTATGATG // // // / / // / / || || |AccI TspEI BseGI |DdeI BsrI BfiI || || | ApoI BsiYI* || || Hpy166II FokI || |FatI || CviAII |NlaIII |NspI BbvII* MboII G H V D K F T D W M C R N P K T G E Y Y G M * T N L L I G C A E I L R L G N T T A C R Q I Y * L D V P K S * D W G I L Q ----:----|----:----|----:----|----:----|----:----|----:----| P C T S L N V S Q I H R F G L V P S Y * Q A H L C I * Q N S T G F D * S Q P I S P M Y V F K S I P H A S I R L S P F V V MmeI DrdI | MaeII BceAI | | SetI | BsaBI | | TaiI CviJI | |BseGI \ \ \ \ \ \\ AGAGCAGACCATTTGATTGAACAGACGTTGAAAAAACGGCTGTTGGACAAGGATGTCAAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCGTCTGGTAAACTAACTTGTCTGCAACTTTTTTGCCGACAACCTGTTCCTACAGTTA / / / / / / /// SfeI* | | MaeII CviJI | ||BsaBI | TaiI | |BseGI | SetI | BceAI MmeI DrdI R A D H L I E Q T L K K R L L D K D V N E Q T I * L N R R * K N G C W T R M S I S R P F D * T D V E K T A V G Q G C Q S ----:----|----:----|----:----|----:----|----:----|----:----| L A S W K I S C V N F F R S N S L S T L C L L G N S Q V S T S F V A T P C P H * S C V M Q N F L R Q F F P Q Q V L I D I BseMII |BspCNI || BdaI || BdaI || |AsuI* || |AvaII || |DraII || |PpuMI || ||NlaIV || ||BmgT120I TspDTI || ||| Hpy178III* FokI | SspI || ||| |DdeI \ \ \ \\ \\\ \\ CCACAGGATATGAAAAATATGGAGAAAATATTGACCACGATTGACGGGTTTTCGGGTCCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGTCCTATACTTTTTATACCTCTTTTATAACTGGTGCTAACTGCCCAAAAGCCCAGGA / / / // / /// / FokI | SspI || | ||| Hpy178III* TspDTI || | ||PpuMI || | ||DraII || | ||AvaII || | ||AsuI* || | |BmgT120I || | NlaIV || BdaI || BdaI |BspCNI BseMII P Q D M K N M E K I L T T I D G F S G P H R I * K I W R K Y * P R L T G F R V L T G Y E K Y G E N I D H D * R V F G S * ----:----|----:----|----:----|----:----|----:----|----:----| G C S I F F I S F I N V V I S P N E P G D V P Y S F Y P S F I S W S Q R T K P D W L I H F I H L F Y Q G R N V P K R T R BdaI BdaI | BinI* | |MseI | |VspI | || MboI | || | DpnI FatI | || | |BstKTI |CviAII | || | ||BsrI TfiI || CviRI* | || | ||| MaeIII HinfI || NlaIII | || | ||| Tsp45I \ \\ \ \ \\ \ \\\ \ GAGTTGAATCTCGTCATGCAGGAATATAACATTAATGATCCAGTCACTAACGATGTTTTA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTCAACTTAGAGCAGTACGTCCTTATATTGTAATTACTAGGTCAGTGATTGCTACAAAAT / / / // / / / // / / DdeI | | |CviRI* BdaI | | || MboI Tsp45I | | |FatI BdaI | | |DpnI MaeIII | | CviAII | | |BsrI | NlaIII | | BstKTI HinfI | VspI TfiI | MseI BinI* E L N L V M Q E Y N I N D P V T N D V L S * I S S C R N I T L M I Q S L T M F * V E S R H A G I * H * * S S H * R C F R ----:----|----:----|----:----|----:----|----:----|----:----| S N F R T M C S Y L M L S G T V L S T K Q T S D R * A P I Y C * H D L * * R H K L Q I E D H L F I V N I I W D S V I N * NlaIV |CviJI || DdeI || SauI* || | Hpy178III* || | | Hin4II* || | | |MfeI MseI || | | |AjuI |TspEI TaqI || | | |TspEI HgaI || AjuI AsuII TspEI || | | || MnlI \ \\ \ \ \ \\ \ \ \\ \ GACGCACTAACTTCCTTTAATTTGATGTTCGAAACTAAAATTGGAGCCTCAGGACAATTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCGTGATTGAAGGAAATTAAACTACAAGCTTTGATTTTAACCTCGGAGTCCTGTTAAC / // / / / // //// / // | || TspEI AsuII | || |||| | |BseMII | |MseI TaqI | || |||| | BspCNI | AjuI | || |||| | TspEI HgaI | || |||| | MfeI | || |||| MnlI | || |||Hin4II* | || ||Hpy178III* | || |SauI* | || |DdeI | || AjuI | |CviJI | NlaIV TspEI D A L T S F N L M F E T K I G A S G Q L T H * L P L I * C S K L K L E P Q D N * R T N F L * F D V R N * N W S L R T I E ----:----|----:----|----:----|----:----|----:----|----:----| S A S V E K L K I N S V L I P A E P C N L R V L K R * N S T R F * F Q L R L V I V C * S G K I Q H E F S F N S G * S L Q BspCNI |BseMII || StuI || CviJI || HaeIII || | BsgI || | |EcoNI || | ||DdeI || | |||BsiYI* || | |||| BsmAI AlwNI || | |||| | CviJI |Hin4I TspEI || | |||| | HaeIII || CviRI* TspEI TspEI | Hin4I \\ \ \\\\ \ \ \\ \ \ \ \ \ AAGGCCTTTCTAAGGCCAGAGACTGCACAAGGACAATTTCTCAATTTCAACAAATTATTG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGGAAAGATTCCGGTCTCTGACGTGTTCCTGTTAAAGAGTTAAAGTTGTTTAATAAC / / / / / / /// / / / / // | | | | | | ||AlwNI CviRI* TspEI | Hin4I |AjuI | | | | | | |Hin4I TspEI TspEI | | | | | | BsmAI | | | | | HaeIII | | | | | CviJI | | | | DdeI | | | EcoNI | | BsiYI* | BsgI HaeIII CviJI StuI K A F L R P E T A Q G Q F L N F N K L L R P F * G Q R L H K D N F S I S T N Y W G L S K A R D C T R T I S Q F Q Q I I G ----:----|----:----|----:----|----:----|----:----|----:----| F A K R L G S V A C P C N R L K L L N N S P R E L A L S Q V L V I E * N * C I I L G K * P W L S C L S L K E I E V F * Q StyI SecI* | TspGWI | | Eco57I AluI | | Eco57MI AjuI | | | ApoI CviJI AjuI | | | TspEI | SetI Hpy188I \ \ \ \ \ \ \ \ GAAATCAACCAAGGGAAAATTCCGTTTGCTTCAGCTTCCATTGGTAAGTCATTCAGAAAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAGTTGGTTCCCTTTTAAGGCAAACGAAGTCGAAGGTAACCATTCAGTAAGTCTTTG / // / / / / / | |SecI* TspEI | | CviJI Hpy188I | |StyI ApoI | | AluI | Eco57MI | SetI | Eco57I AjuI TspGWI E I N Q G K I P F A S A S I G K S F R N K S T K G K F R L L Q L P L V S H S E T N Q P R E N S V C F S F H W * V I Q K R ----:----|----:----|----:----|----:----|----:----|----:----| S I L W P F I G N A E A E M P L D N L F P F * G L S F E T Q K L K W Q Y T M * F F D V L P F N R K S * S G N T L * E S V BsiYI* |BsiYI* ApoI || CviJI TspEI || | MseI MseI TspEI \ \\ \ \ \ \ GAAATTTCCCCCAGAAGTGGGCTTTTAAGGGTAAGAGAGTTTTTAATGGCAGAAATTGAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAAAGGGGGTCTTCACCCGAAAATTCCCATTCTCTCAAAAATTACCGTCTTTAACTC / // / / / // / TspEI |BsiYI* CviJI MseI MseI || TspGWI ApoI BsiYI* |HgiAI* |SduI TspEI E I S P R S G L L R V R E F L M A E I E K F P P E V G F * G * E S F * W Q K L S N F P Q K W A F K G K R V F N G R N * A ----:----|----:----|----:----|----:----|----:----|----:----| S I E G L L P S K L T L S N K I A S I S R F K G W F H A K L P L L T K L P L F Q F N G G S T P K * P Y S L K * H C F N L MaeIII Tsp45I SduI | FatI TspGWI | |CviAII HgiAI* | || NspI | BinI* | || CviRI* | | MboI | || NlaIII TspDTI | | | DpnI | || | ApoI MnlI | TfiI | | | |BstKTI | || | TspEI |MseI | HinfI \ \ \ \\ \ \\ \ \ \\ \ \ CACTTTGTTGATCCGTTGAATAAGTCACATGCAAAATTCAATGAAGTGTTAAATGAGGAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GTGAAACAACTAGGCAACTTATTCAGTGTACGTTTTAAGTTACTTCACAATTTACTCCTC / // / // // / / / / | || MboI || |CviRI* TspEI | | TspDTI | |DpnI || |FatI ApoI | MseI | BstKTI || CviAII MnlI BinI* |Tsp45I |MaeIII NlaIII NspI H F V D P L N K S H A K F N E V L N E E T L L I R * I S H M Q N S M K C * M R R L C * S V E * V T C K I Q * S V K * G D ----:----|----:----|----:----|----:----|----:----|----:----| C K T S G N F L D C A F N L S T N F S S A S Q Q D T S Y T V H L I * H L T L H P V K N I R Q I L * M C F E I F H * I L L TstI BseRI HphI BsaXI \ \ \ ATTCCACTACTATCACGCAGATTACAGGAAAGTGGTGAAGTCCAACTGCCTGTGAAAATG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGGTGATGATAGTGCGTCTAATGTCCTTTCACCACTTCAGGTTGACGGACACTTTTAC / / / / / | BseRI HphI | BsaXI HinfI TstI TfiI I P L L S R R L Q E S G E V Q L P V K M F H Y Y H A D Y R K V V K S N C L * K * S T T I T Q I T G K W * S P T A C E N D ----:----|----:----|----:----|----:----|----:----|----:----| I G S S D R L N C S L P S T W S G T F I S E V V I V C I V P F H H L G V A Q S F N W * * * A S * L F T T F D L Q R H F H ApoI TspEI EcoRI | BtsI | TspRI SfeI* | | Hpy178III* |MnlI | | | BsaXI TspDTI || MmeI | | | | TstI | TspDTI \\ \ \ \ \ \ \ \ \ ACTATAGGAGAGGCAGTGAATTCTGGAATGGTAGAAAATGAAACATTGGGATATTTTATG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGATATCCTCTCCGTCACTTAAGACCTTACCATCTTTTACTTTGTAACCCTATAAAATAC / / / / / / // / / | | | TspRI | | |BsaXI | TspDTI | | SfeI* | | |TstI TspDTI | MmeI | | Hpy178III* MnlI | EcoRI | TspEI | ApoI BtsI T I G E A V N S G M V E N E T L G Y F M L * E R Q * I L E W * K M K H W D I L W Y R R G S E F W N G R K * N I G I F Y G ----:----|----:----|----:----|----:----|----:----|----:----| V I P S A T F E P I T S F S V N P Y K I S * L L P L S N Q F P L F H F M P I N * S Y S L C H I R S H Y F I F C Q S I K H MboI | DpnI | |BstKTI ApoI TspEI SspI | || BinI* TspEI Hpy188I \ \ \ \\ \ \ \ GCAAGAGTTCATCAATTTTTGTTGAATATTGGGATCAACAAGGACAAATTCAGATTTCGC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTCTCAAGTAGTTAAAAACAACTTATAACCCTAGTTGTTCCTGTTTAAGTCTAAAGCG / / // / / // TspEI SspI || MboI BinI* |Hpy188I |DpnI TspEI BstKTI ApoI A R V H Q F L L N I G I N K D K F R F R Q E F I N F C * I L G S T R T N S D F A K S S S I F V E Y W D Q Q G Q I Q I S P ----:----|----:----|----:----|----:----|----:----|----:----| A L T * * N K N F I P I L L S L N L N R P L L E D I K T S Y Q S * C P C I * I E C S N M L K Q Q I N P D V L V F E S K A Tsp4CI* | MmeI | |ApoI MwoI | |TspEI BstAPI | || MseI Cac8I MboII |TspDTI | || BslFI \ \ \\ \ \\ \ CAGCATTTGAAGAATGAAATGGCACACTATGCCACAGATTGTTGGGACGGTGAAATTTTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGTAAACTTCTTACTTTACCGTGTGATACGGTGTCTAACAACCCTGCCACTTTAAAAT / / / / / / / / Cac8I | | TspDTI | MmeI | HphI | BstAPI Tsp4CI* | MseI | MwoI TspEI MboII ApoI Q H L K N E M A H Y A T D C W D G E I L S I * R M K W H T M P Q I V G T V K F * A F E E * N G T L C H R L L G R * N F N ----:----|----:----|----:----|----:----|----:----|----:----| W C K F F S I A C * A V S Q Q S P S I K G A N S S H F P V S H W L N N P R H F K L M Q L I F H C V I G C I T P V T F N * TstI | MwoI | | AciI | | |BisI | | ||BlsI TatI | | |||TauI Tsp4CI* HphI TstI | | |||CviJI MseI Bsp1407I \ \ \ \ \\\\ \ \ ACATCGTATGGTTGGATTGAATGTGTCGGTTGTGCTGACAGGGCGGCTTTTGATTTAACT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAGCATACCAACCTAACTTACACAGCCAACACGACTGTCCCGCCGAAAACTAAATTGA // / / //// / / |BslFI | MwoI |||CviJI | Tsp4CI* TstI TstI ||BisI MseI ||AciI |BlsI TauI T S Y G W I E C V G C A D R A A F D L T H R M V G L N V S V V L T G R L L I * L I V W L D * M C R L C * Q G G F * F N C ----:----|----:----|----:----|----:----|----:----|----:----| V D Y P Q I S H T P Q A S L A A K S K V L M T H N S Q I H R N H Q C P P K Q N L C R I T P N F T D T T S V P R S K I * S AluI Csp6I Hpy188I CviJI |RsaI | MboII |MaeI ||Hpy166II | |Tsp4CI* ||SetI \\\ \ \\ \\\ GTACACTCCAAGAAAACGGGAAGAAGTCTGACGGTAAAGCAAAAGCTAGATACACCAAAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CATGTGAGGTTCTTTTGCCCTTCTTCAGACTGCCATTTCGTTTTCGATCTATGTGGTTTT /// / // / / / ||Bsp1407I | |Tsp4CI* | | MaeI ||TatI | MboII | CviJI |Hpy166II Hpy188I | AluI |Csp6I SetI RsaI V H S K K T G R S L T V K Q K L D T P K Y T P R K R E E V * R * S K S * I H Q K T L Q E N G K K S D G K A K A R Y T K R ----:----|----:----|----:----|----:----|----:----|----:----| T C E L F V P L L R V T F C F S S V G F Q V S W S F P F F D S P L A F A L Y V L Y V G L F R S S T Q R Y L L L * I C W F MboI Hpy188I | DpnI ApoI | |TaqI TspEI | |BstKTI | XmnI | || BinI* \ \ \ \\ \ GAAAGAACCGAGTGGGTTGTGGAAGTGAATAAGAAATTTTTCGGATCGAAGTTCAAACAG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCTTGGCTCACCCAACACCTTCACTTATTCTTTAAAAAGCCTAGCTTCAAGTTTGTC // / // // / || | || || BinI* || | || |TaqI || | || MboI || | |DpnI || | BstKTI || Hpy188I |TspEI |ApoI XmnI E R T E W V V E V N K K F F G S K F K Q K E P S G L W K * I R N F S D R S S N R K N R V G C G S E * E I F R I E V Q T E ----:----|----:----|----:----|----:----|----:----|----:----| S L V S H T T S T F L F N K P D F N L C L F F R T P Q P L S Y S I K R I S T * V F S G L P N H F H I L F K E S R L E F L TspEI | MseI BssKI | VspI SecI* | | TaqI EcoRII TspEI FokI | | | TfiI ApoI | ScrFI | BseGI | TspDTI | | | HinfI TspEI | BseBI | | MnlI | |FatI \ \ \ \ \ \ \ \ \ \ \ \\ AAAGCAAAATTAATCGAATCTGTTTTGTCAAAATTTTCCCAGGATGAATTGATTAGGAGG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCGTTTTAATTAGCTTAGACAAAACAGTTTTAAAAGGGTCCTACTTAACTAATCCTCC // / / / /// / // / // || | HinfI TspEI ||| | |TspEI | |NlaIII || | TfiI ApoI ||| | MnlI | FokI || TaqI ||| BseGI TspDTI |VspI ||EcoRII |MseI ||BssKI TspEI |SecI* BseBI ScrFI K A K L I E S V L S K F S Q D E L I R R K Q N * S N L F C Q N F P R M N * L G G S K I N R I C F V K I F P G * I D * E A ----:----|----:----|----:----|----:----|----:----|----:----| F A F N I S D T K D F N E W S S N I L L S L L I L R I Q K T L I K G P H I S * S F C F * D F R N Q * F K G L I F Q N P P CfrI BsrI | BalI | MboII | CviJI | |TspDTI | HaeIII | || Tsp4CI* | | MboI CviAII | || | ApoI SetI | | | DpnI | NlaIII | || | TspEI HphI | | | |BstKTI \ \ \ \\ \ \ \ \ \ \ \\ CATGAAGAACTGGAAAAGAACGGTGAATTTACCTGTCAAGTAAATGGCCAGATCGTAAAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GTACTTCTTGACCTTTTCTTGCCACTTAAATGGACAGTTCATTTACCGGTCTAGCATTTT // / / / // / / / // / |FatI | | Tsp4CI* || HphI | | || MboI CviAII | TspDTI |SetI | | |DpnI | MboII TspEI | | BstKTI BsrI ApoI | CfrI HaeIII CviJI BalI H E E L E K N G E F T C Q V N G Q I V K M K N W K R T V N L P V K * M A R S * N * R T G K E R * I Y L S S K W P D R K T ----:----|----:----|----:----|----:----|----:----|----:----| C S S S S F F P S N V Q * T F P W I T F A H L V P F S R H I * R D L L H G S R L M F F Q F L V T F K G T L Y I A L D Y F BbvII* | MboII TatI MaeI | CviRI* |Csp6I | TsoI MaeIII | |TspDTI ||RsaI \ \ \ \ \\ \\\ CTAGATAGCAGTTTGGTTACTATCAAAATGAAGACAACTTTGCAACATATACGAGAGTAC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GATCTATCGTCAAACCAATGATAGTTTTACTTCTGTTGAAACGTTGTATATGCTCTCATG // / // /// |MaeI MaeIII |CviRI* ||TatI TsoI TspDTI |Csp6I BbvII* RsaI MboII L D S S L V T I K M K T T L Q H I R E Y * I A V W L L S K * R Q L C N I Y E S T R * Q F G Y Y Q N E D N F A T Y T R V H ----:----|----:----|----:----|----:----|----:----|----:----| S S L L K T V I L I F V V K C C I R S Y V L Y C N P * * * F S S L K A V Y V L T * I A T Q N S D F H L C S Q L M Y S L V CviJI | SduI MboII | HgiJII* | CviRI* | | BsiYI* SetI | | TaqI PpiI | | | MnlI | PpiI | | | SfaNI \ \ \ \ \ \ \ \ \ \ \ ATTCCTAATGTCATTGAGCCCTCGTTCGGTTTAGGTCGTATCATATACTGCATCTTCGAC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGGATTACAGTAACTCGGGAGCAAGCCAAATCCAGCATAGTATATGACGTAGAAGCTG / / / / / / / / / / PpiI | | BsiYI* | | PpiI MboII CviRI* TaqI | CviJI | SetI HgiJII* MnlI SduI I P N V I E P S F G L G R I I Y C I F D F L M S L S P R S V * V V S Y T A S S T S * C H * A L V R F R S Y H I L H L R P ----:----|----:----|----:----|----:----|----:----|----:----| M G L T M S G E N P K P R I M Y Q M K S C E * H * Q A R T R N L D Y * I S C R R N R I D N L G R E T * T T D Y V A D E V MnlI HinfI | Hpy178III* | |MboII Hin4I | || PleI Hin4I | || |MlyI Hin4I | TaqI | || ||CviJI Hin4I \ \ \ \\ \\\ \ CATTGTTTCCAAGTTCGAGTGGATAGTGAGTCAAGAGGCTTCTTCTCTTTTCCATTACAG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GTAACAAAGGTTCAAGCTCACCTATCACTCAGTTCTCCGAAGAAGAGAAAAGGTAATGTC / / / / // / // / | Hin4I TaqI | || | || Hin4I | Hin4I | || | || Hin4I SfaNI | || | |CviJI | || | PleI | || | MlyI | || Hpy178III* | |MboII | HinfI MnlI H C F Q V R V D S E S R G F F S F P L Q I V S K F E W I V S Q E A S S L F H Y R L F P S S S G * * V K R L L L F S I T D ----:----|----:----|----:----|----:----|----:----|----:----| W Q K W T R T S L S D L P K K E K G N C G N N G L E L P Y H T L L S R R K E M V M T E L N S H I T L * S A E E R K W * L Hin6I |GlaI ||HhaI |||HaeII ||||MboI ||||| DpnI TaqI MnlI ||||| |BstKTI MaeIII | BccI CviJI AciI |FauI \\\\\ \\ \ \ \ \ \ \\ ATAGCGCCGATCAAAGTATTTGTTACGACAATATCGAATAACGATGGCTTCCCCGCTATA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TATCGCGGCTAGTTTCATAAACAATGCTGTTATAGCTTATTGCTACCGAAGGGGCGATAT //// // / / / / / / / |||| || MboI MaeIII | BccI CviJI | MnlI |||| |DpnI TaqI AciI |||| BstKTI |||Hin6I ||GlaI |HhaI HaeII I A P I K V F V T T I S N N D G F P A I * R R S K Y L L R Q Y R I T M A S P L Y S A D Q S I C Y D N I E * R W L P R Y T ----:----|----:----|----:----|----:----|----:----|----:----| I A G I L T N T V V I D F L S P K G A I S L A S * L I Q * S L I S Y R H S G R * Y R R D F Y K N R C Y R I V I A E G S Y MboI XhoII | DpnI | |BstKTI | || BinI* | || |Cac8I | || || CviJI | || || | MaeII | || || | |BsaAI SmlI | || || | |SnaBI MseI AflII | || || | || SetI |AhaIII* TfiI |MseI | || || | || TaiI || TspEI HinfI \\ \ \\ \\ \ \\ \ \\ \ \ CTTAAGAGGATCTCGCAGGCTTTACGTAAAAGAGAGATATACTTTAAAATTGACGATTCC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GAATTCTCCTAGAGCGTCCGAAATGCATTTTCTCTCTATATGAAATTTTAACTGCTAAGG / // // / / / / // // / / | || || | | | | |MaeII |MseI TspEI HinfI | || || | | | | SnaBI AhaIII* TfiI | || || | | | | BsaAI | || || | | | TaiI | || || | | | SetI | || || | | CviJI | || || | BinI* | || || | Cac8I | || || XhoII | || || MboI | || |DpnI | || BstKTI | |AflII | |SmlI | MseI FauI L K R I S Q A L R K R E I Y F K I D D S L R G S R R L Y V K E R Y T L K L T I P * E D L A G F T * K R D I L * N * R F Q ----:----|----:----|----:----|----:----|----:----|----:----| S L L I E C A K R L L S I Y K L I S S E V * S S R A P K V Y F L S I S * F Q R N K L P D R L S * T F S L Y V K F N V I G MfeI TspDTI TspEI MaeIII TspEI |HphI \ \ \ \\ AATACTTCAATTGGTAAAAAATACGCCCGTAACGATGAATTGGGAACACCATTTGGTATC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGAAGTTAACCATTTTTTATGCGGGCATTGCTACTTAACCCTTGTGGTAAACCATAG / / / / / TspEI MaeIII TspEI | HphI MfeI TspDTI N T S I G K K Y A R N D E L G T P F G I I L Q L V K N T P V T M N W E H H L V S Y F N W * K I R P * R * I G N T I W Y H ----:----|----:----|----:----|----:----|----:----|----:----| L V E I P L F Y A R L S S N P V G N P I W Y K L Q Y F I R G Y R H I P F V M Q Y I S * N T F F V G T V I F Q S C W K T D MaeIII Tsp45I Tsp4CI* | MaeII | | MseI ApoI TaqI | | SetI TspEI AsuII | | TaiI HphI | MnlI \ \ \ \ \ \ \ ACCATAGATTTCGAAACTATAAAAGACCAAACGGTGACGTTAAGAGAAAGAAATTCTATG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTATCTAAAGCTTTGATATTTTCTGGTTTGCCACTGCAATTCTCTTTCTTTAAGATAC / / / // / / / / AsuII | | || | HphI | TspEI TaqI | | || MseI | ApoI | | |MaeII MnlI | | Tsp45I | | MaeIII | TaiI | SetI Tsp4CI* T I D F E T I K D Q T V T L R E R N S M P * I S K L * K T K R * R * E K E I L * H R F R N Y K R P N G D V K R K K F Y E ----:----|----:----|----:----|----:----|----:----|----:----| V M S K S V I F S W V T V N L S L F E I * W L N R F * L L G F P S T L L F F N * G Y I E F S Y F V L R H R * S F S I R H MnlI TaqI \ \ AGGCAAGTAAGAGGCACTATTACTGATGTGATTTCGACCATTGACAAAATGCTTCACAAC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TCCGTTCATTCTCCGTGATAATGACTACACTAAAGCTGGTAACTGTTTTACGAAGTGTTG / / MnlI TaqI R Q V R G T I T D V I S T I D K M L H N G K * E A L L L M * F R P L T K C F T T A S K R H Y Y * C D F D H * Q N A S Q P ----:----|----:----|----:----|----:----|----:----|----:----| L C T L P V I V S T I E V M S L I S * L S A L L L C * * Q H S K S W Q C F A E C P L Y S A S N S I H N R G N V F H K V V TfiI HinfI | Hpy188I | | BsrI | | |TspDTI | | || BfiI Tsp4CI* MseI \ \ \\ \ \ \ CCTGATGAATCGGACTGGGATAAATCAACATTTGGACTGTCGCCTGTTAAGATATAA 1810 1820 1830 1840 1850 ----:----|----:----|----:----|----:----|----:----|----:-- GGACTACTTAGCCTGACCCTATTTAGTTGTAAACCTGACAGCGGACAATTCTATATT // // / / / || || BfiI Tsp4CI* MseI || |TspDTI || BsrI |Hpy188I HinfI TfiI P D E S D W D K S T F G L S P V K I * L M N R T G I N Q H L D C R L L R Y X * * I G L G * I N I W T V A C * D I X ----:----|----:----|----:----|----:----|----:----|----:-- G S S D S Q S L D V N P S D G T L I Y G Q H I P S P Y I L M Q V T A Q * S I R I F R V P I F * C K S Q R R N L Y L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 2 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AhaIII* 1 DraI AjuI 2 AluI 2 AluBI AlwNI 1 CaiI ApoI 11 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 2 BceAI 1 BdaI 2 BfiI 2 BmrI,BmuI BinI* 5 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 3 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BsaXI 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 2 BseRI 2 BsgI 1 BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 2 BsrI 4 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstAPI 1 BstKTI 7 BtsI 1 Cac8I 2 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI Csp6I 3 CviQI,RsaNI CviAII 5 CviJI 15 CviKI-1 CviRI* 6 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 7 MalI DraII 2 EcoO109I DrdI 1 AasI,DseDI Eco57I 2 AcuI Eco57MI 2 EcoNI 1 BstENI,XagI EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI FatI 5 FauI 1 SmuI FokI 3 GlaI 1 HaeII 1 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 2 HpyAV Hin6I 1 HinP1I,HspAI HinfI 7 HpaII 1 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 6 MaeI 2 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 6 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 8 MfeI 2 MunI MlyI 1 SchI MmeI 3 MnlI 12 MseI 13 Tru1I,Tru9I MwoI 2 HpyF10VI,BstMWI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspI 3 BstNSI,XceI PleI 1 PpsI PpiI 1 PpuMI 1 Psp5II,PspPPI RsaI 3 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 10 SfaNI 1 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI SnaBI 1 Eco105I,BstSNI SspI 2 StuI 1 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 9 TatI 3 TauI 1 TfiI 6 PfeI TsoI 1 Tsp45I 3 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 10 TspEI 26 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI TstI 2 VspI 2 PshBI,AseI XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflIII AgeI AlfI AloI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BamHI BarI BbvCI BbvI Bce83I* BcgI BciVI BclI BetI* BglI BglII BmeT110I BmtI BplI Bpu10I BsePI BseSI BseYI BsiI* BsmI Bsp120I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstEII BstXI BstZ17I BtgZI BtrI Cfr10I Cfr9I ClaI CspCI DinI DraIII DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoP15I EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FnuDII* FseI FspAI GsaI GsuI HgiCI* HindII HindIII HpaI Hpy99I KasI KpnI Ksp632I* MauBI McrI* MluI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PmaCI PmeI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TaqII TseI TspMI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769