Restriction Map of ROX1/YPR065W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ROX1/YPR065W on chromosome XVI from coordinates 679693 to 680799.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.28810

DdeI |SetI |MnlI TfiI || TfiI HinfI TspDTI || HinfI \ \ \\ \ ATGAATCCTAAATCCTCTACACCTAAGATTCCAAGACCCAAGAACGCATTTATTCTGTTC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTAGGATTTAGGAGATGTGGATTCTAAGGTTCTGGGTTCTTGCGTAAATAAGACAAG / / / / / / / HinfI | | | | HinfI Hpy188I TfiI | | | | TfiI | | | DdeI | | MnlI | SetI TspDTI M N P K S S T P K I P R P K N A F I L F * I L N P L H L R F Q D P R T H L F C S E S * I L Y T * D S K T Q E R I Y S V Q ----:----|----:----|----:----|----:----|----:----|----:----| X F G L D E V G L I G L G L F A N I R N X S D * I R * V * S E L V W S R M * E T H I R F G R C R L N W S G L V C K N Q E MboI XhoII AsuI* | DpnI AvaII | |BstKTI |BmgT120I | || MseI || AciI | || | BinI* || | BsrBI Hpy188I | || | |Bce83I* || | |SmlI SetI \ \ \\ \ \\ \\ \ \\ \ AGACAGCACTACCACAGGATCTTAATAGACGAATGGACCGCTCAAGGTGTGGAAATACCC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGTCGTGATGGTGTCCTAGAATTATCTGCTTACCTGGCGAGTTCCACACCTTTATGGG // / / / // / // || | | BinI* || | |SmlI || | Bce83I* || | SetI || | MseI || BsrBI || XhoII || AciI || MboI |AvaII |DpnI |AsuI* BstKTI BmgT120I R Q H Y H R I L I D E W T A Q G V E I P D S T T T G S * * T N G P L K V W K Y P T A L P Q D L N R R M D R S R C G N T P ----:----|----:----|----:----|----:----|----:----|----:----| L C C * W L I K I S S H V A * P T S I G * V A S G C S R L L R I S R E L H P F V S L V V V P D * Y V F P G S L T H F Y G Csp6I |RsaI BetI* TspEI TspEI || Hin4II* CviJI |HpaII \ \ \\ \ \ \\ CATAATTCAAACATTTCTAAAATTATTGGTACGAAGTGGAAGGGCTTACAACCGGAAGAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTATTAAGTTTGTAAAGATTTTAATAACCATGCTTCACCTTCCCGAATGTTGGCCTTCTA / / /// / // TspEI TspEI ||Hin4II* CviJI |BetI* |Csp6I HpaII RsaI H N S N I S K I I G T K W K G L Q P E D I I Q T F L K L L V R S G R A Y N R K I * F K H F * N Y W Y E V E G L T T G R * ----:----|----:----|----:----|----:----|----:----|----:----| W L E F M E L I I P V F H F P K C G S S G Y N L C K * F * Q Y S T S P S V V P L M I * V N R F N N T R L P L A * L R F I BsrI TspRI | BfiI | |MaeI FatI | || Hin4II* |CviAII Hpy178III* MboII | || |AciI MaeI || NlaIII |TspDTI \ \ \\ \\ \ \\ \ \\ AAGGCACACTGGGAAAATCTAGCGGAGAAGGAGAAACTAGAACATGAAAGGAAGTATCCT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGTGTGACCCTTTTAGATCGCCTCTTCCTCTTTGATCTTGTACTTTCCTTCATAGGA / / / / // / / / // / / | | BsrI | || AciI | | |FatI | Hpy178III* | MboII | |MaeI | | CviAII TspDTI TspRI | Hin4II* | NlaIII BfiI MaeI K A H W E N L A E K E K L E H E R K Y P R H T G K I * R R R R N * N M K G S I L G T L G K S S G E G E T R T * K E V S * ----:----|----:----|----:----|----:----|----:----|----:----| L A C Q S F R A S F S F S S C S L F Y G Y P V S P F D L P S P S V L V H F S T D L C V P F I * R L L L F * F M F P L I R CviJI Cfr10I MboII BciVI |HpaII DdeI Hin4II* TaqI \ \\ \ \ \ GAATACAAATACAAGCCGGTAAGAAAGTCTAAGAAGAAGCAACTACTTTTGAAGGAAATC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATGTTTATGTTCGGCCATTCTTTCAGATTCTTCTTCGTTGATGAAAACTTCCTTTAG / / // / / BciVI | |Cfr10I DdeI Hin4II* | HpaII MboII CviJI E Y K Y K P V R K S K K K Q L L L K E I N T N T S R * E S L R R S N Y F * R K S I Q I Q A G K K V * E E A T T F E G N R ----:----|----:----|----:----|----:----|----:----|----:----| S Y L Y L G T L F D L F F C S S K F S I Q I C I C A P L F T * S S A V V K S P F F V F V L R Y S L R L L L L * K Q L F D TseI |BisI ||BlsI |||TseI ||||BisI ||||EcoP15I TseI |||||BlsI MwoI |||||| EcoP15I |BisI |||||| | BbvI ||BlsI |||||| | | MaeIII |||TseI |||||| | | Tsp45I ||||BisI BbvI |||||| | | Tsp4CI* AciI |||||BlsI | BbvI |||||| | | |BbvI | TspEI \\\\\\ \ \ \\\\\\ \ \ \\ \ \ GAGCAACAGCAGCAGCAACAACAGAAAGAACAGCAGCAGCAGAAACAGTCACAACCGCAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGTTGTCGTCGTCGTTGTTGTCTTTCTTGTCGTCGTCGTCTTTGTCAGTGTTGGCGTT / / ////// / / ////// / / / / / TaqI | |||||TseI | BbvI |||||| | | | | AciI | ||||BisI BbvI |||||| | | | Tsp45I | |||BlsI |||||| | | | MaeIII | ||TseI |||||| | | | BbvI | |BisI |||||| | | BbvI | BlsI |||||| | Tsp4CI* MwoI |||||| EcoP15I |||||EcoP15I |||||TseI ||||BisI |||BlsI ||TseI |BisI BlsI E Q Q Q Q Q Q Q K E Q Q Q Q K Q S Q P Q S N S S S N N R K N S S S R N S H N R N A T A A A T T E R T A A A E T V T T A I ----:----|----:----|----:----|----:----|----:----|----:----| S C C C C C C C F S C C C C F C D C G C R A V A A A V V S L V A A A S V T V V A L L L L L L L L F F L L L L F L * L R L EcoP15I SduI | EcoP15I HgiAI* | | EcoP15I | HphI | | | CviJI | | TspDTI | | | | MseI | | | MboII \ \ \ \ \ \ \ \ \ TTACAACAGCCCTTTAACAACAATATAGTTCTTATGAAAAGAGCACATTCTCTTTCACCA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTTGTCGGGAAATTGTTGTTATATCAAGAATACTTTTCTCGTGTAAGAGAAAGTGGT // / / / / // / || | | MseI | || MboII || | EcoP15I | |TspDTI || | CviJI | HphI || EcoP15I HgiAI* |EcoP15I SduI TspEI L Q Q P F N N N I V L M K R A H S L S P Y N S P L T T I * F L * K E H I L F H H T T A L * Q Q Y S S Y E K S T F S F T I ----:----|----:----|----:----|----:----|----:----|----:----| N C C G K L L L I T R I F L A C E R E G I V V A R * C C Y L E * S F L V N E K V * L L G K V V I Y N K H F S C M R K * W MnlI | AluI | CviJI MboI | | TaqI | MnlI | | SetI | DpnI | | | MwoI | |BstKTI | | | | AluI | ||SmlI SecI* | | | | CviJI MfeI | ||AflII |BccI | | | | | SetI TspEI | |||MseI \\ \ \ \ \ \ \ \ \ \\\\ TCTTCCTCGGTGTCAAGCTCGAACAGCTATCAGTTCCAATTGAACAATGATCTTAAGAGG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGGAGCCACAGTTCGAGCTTGTCGATAGTCAAGGTTAACTTGTTACTAGAATTCTCC / / // / // / / / // / /// | | || | || | CviJI TspEI || | ||SetI | | || | || | AluI MfeI || | |AflII | | || | || SetI || | |SmlI | | || | |TaqI || | MseI | | || | MwoI || MboI | | || CviJI |DpnI | | || AluI BstKTI | | |SetI MnlI | | MnlI | SecI* BccI S S S V S S S N S Y Q F Q L N N D L K R L P R C Q A R T A I S S N * T M I L R G F L G V K L E Q L S V P I E Q * S * E V ----:----|----:----|----:----|----:----|----:----|----:----| D E E T D L E F L * * N W N F L S R L L M K R P T L S S C S D T G I S C H D * S R G R H * A R V A I L E L Q V I I K L P Hpy178III* |BsmAI |Eco31I ||MboI ||BglII MseI ||XhoII | Hin4II* ||| DpnI | | GsuI ||| |BstKTI SetI | | Eco57MI ||| || MseI Hpy166II \ \ \ \ \\\ \\ \ \ TTGCCTATTCCTTCTGTTAATACTTCTAACTATATGGTCTCCAGATCTTTAAGTGGACTA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AACGGATAAGGAAGACAATTATGAAGATTGATATACCAGAGGTCTAGAAATTCACCTGAT / / ///// / / / | Eco57MI ||||| | | SetI | GsuI ||||| | Hpy166II Hin4II* ||||| MseI MseI ||||XhoII ||||BglII ||||MboI |||Eco31I |||BsmAI ||DpnI |BstKTI Hpy178III* L P I P S V N T S N Y M V S R S L S G L C L F L L L I L L T I W S P D L * V D Y A Y S F C * Y F * L Y G L Q I F K W T T ----:----|----:----|----:----|----:----|----:----|----:----| N G I G E T L V E L * I T E L D K L P S T A * E K Q * Y K * S Y P R W I K L H V Q R N R R N I S R V I H D G S R * T S * SetI | BceAI | | AluI FatI | | CviJI |CviAII | | PvuII || NlaIII BsmAI | | NspBII* ApoI SetI || | HgaI Eco31I | | | SetI TspEI \ \\ \ \ \ \ \ \ \ \ CCTTTGACGCATGATAAGACGGCAAGAGACCTACCACAGCTGTCATCTCAACTAAATTCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAACTGCGTACTATTCTGCCGTTCTCTGGATGGTGTCGACAGTAGAGTTGATTTAAGA / // / / / / / / | |FatI | | SetI | NspBII* TspEI | CviAII | Eco31I | PvuII ApoI NlaIII | BsmAI | CviJI HgaI | AluI BceAI SetI P L T H D K T A R D L P Q L S S Q L N S L * R M I R R Q E T Y H S C H L N * I L F D A * * D G K R P T T A V I S T K F Y ----:----|----:----|----:----|----:----|----:----|----:----| G K V C S L V A L S R G C S D D * S F E V K S A H Y S P L L G V V A T M E V L N R Q R M I L R C S V * W L Q * R L * I R Hin4II* | Bce83I* | | SetI | | | MaeII | | | | SetI DdeI | | | | TaiI | AluI BspCNI | | | | | MnlI | CviJI |BseMII | | | | | Hpy99I | | SetI || BsmAI | | | | | |SmlI \ \ \ \\ \ \ \ \ \ \ \\ ATTCCATATTACTCAGCTCCACACGACCCTTCAACGAGACATCATTACCTCAACGTCGCT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGGTATAATGAGTCGAGGTGTGCTGGGAAGTTGCTCTGTAGTAATGGAGTTGCAGCGA /// // / / / / // / / ||CviJI |BseMII | | | SetI || | MnlI ||AluI BspCNI | | Bce83I* || MaeII |DdeI | Hin4II* |Hpy99I SetI BsmAI TaiI SetI I P Y Y S A P H D P S T R H H Y L N V A F H I T Q L H T T L Q R D I I T S T S L S I L L S S T R P F N E T S L P Q R R S ----:----|----:----|----:----|----:----|----:----|----:----| I G Y * E A G C S G E V L C * * R L T A * E M N S L E V R G K L S V D N G * R R N W I V * S W V V R * R S M M V E V D S AluI MfeI CviJI TspEI | SetI | FokI | | StyI | | TspDTI | | SecI* CviJI TaqI | | | MnlI BseGI \ \ \ \ \ \ \ \ \ \ CAAGCTCAACCAAGGGCTAACTCGACCCCTCAATTGCCCTTTATTTCATCCATTATCAAC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCGAGTTGGTTCCCGATTGAGCTGGGGAGTTAACGGGAAATAAAGTAGGTAATAGTTG /// / / / / / / / ||CviJI | CviJI TaqI | | MnlI BseGI ||AluI SecI* | | FokI |SmlI StyI | TspEI SetI | MfeI TspDTI Q A Q P R A N S T P Q L P F I S S I I N K L N Q G L T R P L N C P L F H P L S T S S T K G * L D P S I A L Y F I H Y Q Q ----:----|----:----|----:----|----:----|----:----|----:----| * A * G L A L E V G * N G K I E D M I L E L E V L P * S S G E I A R * K M W * * L S L W P S V R G R L Q G K N * G N D V AgeI BetI* Cfr10I |HpaII BsaXI || MaeIII EcoP15I Hin4I BssKI || | FokI |BseGI | MboII EcoRII \\ \ \ \\ \ \ \ AACAGCAGTCAAACACCGGTAACTACAACTACCACATCCACAACAACTGCGACATCTTCT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTCGTCAGTTTGTGGCCATTGATGTTGATGGTGTAGGTGTTGTTGACGCTGTAGAAGA // / / / / / / / || | FokI | | | BsaXI MboII || MaeIII | | Hin4I |Cfr10I | EcoP15I |BetI* BseGI |AgeI HpaII N S S Q T P V T T T T T S T T T A T S S T A V K H R * L Q L P H P Q Q L R H L L Q Q S N T G N Y N Y H I H N N C D I F S ----:----|----:----|----:----|----:----|----:----|----:----| L L L * V G T V V V V V D V V V A V D E C C C D F V P L * L * W M W L L Q S M K V A T L C R Y S C S G C G C C S R C R R SecI* |ScrFI |BseBI ||BseRI ||| ApoI ||| TspEI ||| |MboII ||| || BsaXI ||| || | Hin4I TatI ||| || | | BseRI |Csp6I ||| || | | | Ksp632I* ||RsaI GsuI ||| || | | | | Hpy188I ||| MnlI Tsp4CI* ||| || | | | | |MnlI ||| | BsrI MseI Eco57MI \\\ \\ \ \ \ \ \\ \\\ \ \ \ \ CCTGGGAAATTCTCCTCTTCTCCGAACTCCTCTGTACTGGAGAACAACAGATTAAACAGT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GGACCCTTTAAGAGGAGAAGAGGCTTGAGGAGACATGACCTCTTGTTGTCTAATTTGTCA / / / / / / / /// ///// / // | | | | | | BseRI ||Ksp632I* ||||BsrI | |Tsp4CI* | | | | | TspEI |MnlI |||MnlI | Eco57MI | | | | | ApoI Hpy188I ||TatI | GsuI | | | | Hin4I |Csp6I MseI | | | | BsaXI RsaI | | | MboII | | EcoRII | | BssKI | | SecI* | BseBI | ScrFI BseRI P G K F S S S P N S S V L E N N R L N S L G N S P L L R T P L Y W R T T D * T V W E I L L F S E L L C T G E Q Q I K Q Y ----:----|----:----|----:----|----:----|----:----|----:----| G P F N E E E G F E E T S S F L L N F L E Q S I R R K E S S R Q V P S C C I L C R P F E G R R R V G R Y Q L V V S * V T MnlI CviRI* TspEI SspI SetI MnlI |SetI | Hin4II* \ \ \ \ \\ \ \ ATCAACAATTCAAATCAATATTTACCTCCCCCTCTATTACCTTCTCTGCAAGATTTTCAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTGTTAAGTTTAGTTATAAATGGAGGGGGAGATAATGGAAGAGACGTTCTAAAAGTT / / / / / / // TspEI | SetI | | MnlI |Hin4II* SspI | SetI CviRI* MnlI I N N S N Q Y L P P P L L P S L Q D F Q S T I Q I N I Y L P L Y Y L L C K I F N Q Q F K S I F T S P S I T F S A R F S T ----:----|----:----|----:----|----:----|----:----|----:----| I L L E F * Y K G G G R N G E R C S K * Y * C N L D I N V E G E I V K E A L N E D V I * I L I * R G R * * R R Q L I K L MboI | DpnI | BsrI | |BstKTI | || Csp6I | || |RsaI | || ||BinI* | || ||| TseI | || ||| |BisI | || ||| ||BlsI | || ||| |||AluI BbvI | || ||| |||CviJI | AsuI* | || ||| |||| SetI | AvaII | || ||| |||| |BccI | |NlaIV EcoP15I Tsp4CI* | || ||| |||| |MwoI | |BmgT120I |BslFI | TspRI \ \\ \\\ \\\\ \\ \ \\ \\ \ \ CTGGATCAGTACCAGCAGCTAAAGCAGATGGGACCAACTTATATTGTCAAACCACTGTCT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GACCTAGTCATGGTCGTCGATTTCGTCTACCCTGGTTGAATATAACAGTTTGGTGACAGA /// / /// /// / //// / / / / ||| | ||| ||| BccI |||AvaII | | | Tsp4CI* ||| | ||| ||CviJI |||AsuI* | | TspRI ||| | ||| ||MwoI ||BmgT120I | BslFI ||| | ||| ||TseI |NlaIV EcoP15I ||| | ||| ||AluI BbvI ||| | ||| |BisI ||| | ||| BlsI ||| | ||| SetI ||| | ||BinI* ||| | |Csp6I ||| | RsaI ||| MboI ||DpnI |BstKTI BsrI L D Q Y Q Q L K Q M G P T Y I V K P L S W I S T S S * S R W D Q L I L S N H C L G S V P A A K A D G T N L Y C Q T T V S ----:----|----:----|----:----|----:----|----:----|----:----| S S * Y W C S F C I P G V * I T L G S D V P D T G A A L A S P V L K Y Q * V V T Q I L V L L * L L H S W S I N D F W Q R BsmAI | BssKI | EcoRII | | ScrFI | | BseBI Hpy166II SfaNI \ \ \ \ \ CACACCAGGAACAATCTATTGTCCACAACTACCCCTACGCATCATCACATTCCTCATATA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTGGTCCTTGTTAGATAACAGGTGTTGATGGGGATGCGTAGTAGTGTAAGGAGTATAT // / / / || EcoRII Hpy166II SfaNI || BssKI |BseBI |ScrFI BsmAI H T R N N L L S T T T P T H H H I P H I T P G T I Y C P Q L P L R I I T F L I Y H Q E Q S I V H N Y P Y A S S H S S Y T ----:----|----:----|----:----|----:----|----:----|----:----| * V L F L R N D V V V G V C * * M G * I E C W S C D I T W L * G * A D D C E E Y V G P V I * Q G C S G R R M M V N R M Y SmlI | BseMII | |BspCNI | || MnlI | || | HphI | || | | DdeI | || | | | TspRI | || | | | MaeIII Bce83I* | || | | | Tsp45I | MnlI | || | | | BstEII | TspEI | || | | | | SetI MnlI | | PsiI | || | | | | | AciI \ \ \ \ \ \\ \ \ \ \ \ \ CCAAACCAAAACATTCCTCTACATCAAATTATAAACTCAAGCAACACTGAGGTCACCGCT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTGGTTTTGTAAGGAGATGTAGTTTAATATTTGAGTTCGTTGTGACTCCAGTGGCGA / / / // // /// / // / / MnlI | MnlI |PsiI || ||| HphI |DdeI | AciI Bce83I* TspEI || ||TspRI SetI BstEII || |MnlI Tsp45I || SmlI MaeIII |BspCNI BseMII P N Q N I P L H Q I I N S S N T E V T A Q T K T F L Y I K L * T Q A T L R S P L K P K H S S T S N Y K L K Q H * G H R * ----:----|----:----|----:----|----:----|----:----|----:----| G F W F M G R C * I I F E L L V S T V A V L G F C E E V D F * L S L C C Q P * R W V L V N R * M L N Y V * A V S L D G S MaeI | CviJI | | MaeI Hpy188I \ \ \ \ AAAACTAGCCTAGTTTCTCCGAAATGA 1090 1100 ----:----|----:----|----:-- TTTTGATCGGATCAAAGAGGCTTTACT // / / || MaeI Hpy188I |CviJI MaeI K T S L V S P K * K L A * F L R N X N * P S F S E M X ----:----|----:----|----:-- L V L R T E G F H * F * G L K E S I F S A * N R R F S # Enzymes that cut Frequency Isoschizomers AciI 4 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AgeI 1 AsiGI,BshTI,CspAI,PinAI AluI 6 AluBI ApoI 2 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BbvI 5 BseXI,BstV1I,Lsp1109I BccI 2 Bce83I* 3 BpuEI BceAI 1 BciVI 1 BfuI BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 2 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmgT120I 2 BsaXI 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 2 BseRI 2 BslFI 1 BsmFI,FaqI BsmAI 4 Alw26I,BstMAI BspCNI 2 BsrBI 1 AccBSI,MbiI BsrI 3 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 4 Cfr10I 2 BsrFI,BssAI,Bse118I Csp6I 3 CviQI,RsaNI CviAII 2 CviJI 11 CviKI-1 CviRI* 1 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 4 MalI Eco31I 2 Bso31I,BspTNI,BsaI Eco57MI 2 EcoP15I 7 EcoRII 2 AjnI,Psp6I,PspGI FatI 2 FokI 2 GsuI 2 BpmI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I Hin4I 1 Hin4II* 6 HpyAV HinfI 2 HpaII 3 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 3 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 3 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MfeI 2 MunI MnlI 12 MseI 6 Tru1I,Tru9I MwoI 3 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PsiI 1 AanI PvuII 1 RsaI 3 AfaI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 16 SfaNI 1 LweI SmlI 4 SmoI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 3 TatI 1 TfiI 2 PfeI TseI 5 ApeKI Tsp45I 2 NmuCI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 9 TasI,Tsp509I,Sse9I TspRI 3 TscAI XhoII 2 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflIII AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvII* BcgI BclI BdaI BglI BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsePI BseSI BseYI BsgI BsiI* BsiYI* BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrDI BssNAI Bst1107I BstAPI BstXI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco47III Eco57I EcoICRI EcoNI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FauI FnuDII* FseI FspAI GlaI GsaI HaeII HaeIII HgiCI* HgiJII* HhaI Hin6I HindII HindIII HinP1I HpaI HspAI KasI KpnI MauBI McrI* MluI MlyI MmeI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TauI TsoI TspGWI TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769