Restriction Map of YPR010C-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YPR010C-A on chromosome XVI from coordinates 582734 to 582373.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.3670

EMBOSS_001 AluI MaeIII CviJI Tsp4CI* PvuII | AlwNI NspBII* | | Tsp4CI* | SetI MseI \ \ \ \ \ \ ATGAGACCAGCACAGTTACTGTTGAATACAGCTGTATGTTAAGGGATATTTTCTTTTTAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCTGGTCGTGTCAATGACAACTTATGTCGACATACAATTCCCTATAAAAGAAAAATA / / / / / / | | Tsp4CI* | NspBII* MseI | | MaeIII | PvuII | AlwNI | CviJI Tsp4CI* | AluI SetI M R P A Q L L L N T A V C * G I F S F Y * D Q H S Y C * I Q L Y V K G Y F L F I E T S T V T V E Y S C M L R D I F F L L ----:----|----:----|----:----|----:----|----:----|----:----| X L G A C N S N F V A T H * P I N E K * X S V L V T V T S Y L Q I N L S I K K K H S W C L * Q Q I C S Y T L P Y K R K I TspDTI | FatI | |CviAII | || NlaIII | || | TspGWI MaeIII | || | | SfaNI Tsp45I | || | | | Hpy188I DdeI TspEI \ \ \\ \ \ \ \ \ \ TGTGACAAACGGATAATCATGCGTTCATTCTGACTTGATGCTTTCTAAGAAAACAATTAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ACACTGTTTGCCTATTAGTACGCAAGTAAGACTGAACTACGAAAGATTCTTTTGTTAATA / / / /// // / / | | | ||TspGWI |SfaNI DdeI TspEI | | | |FatI Hpy188I | | | CviAII | | NlaIII | TspDTI Tsp45I MaeIII C D K R I I M R S F * L D A F * E N N Y V T N G * S C V H S D L M L S K K T I M * Q T D N H A F I L T * C F L R K Q L C ----:----|----:----|----:----|----:----|----:----|----:----| Q S L R I I M R E N Q S S A K * S F L * N H C V S L * A N M R V Q H K R L F C N T V F P Y D H T * E S K I S E L F V I I BsmI TspDTI MaeI \ \ \ GTTGATTATGAATGCTAACTACAAGATTATAGAGTATTATACTAACAAAAAACTAGAAAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTAATACTTACGATTGATGTTCTAATATCTCATAATATGATTGTTTTTTGATCTTTT / / / / BsmI TspDTI | TsoI MaeI V D Y E C * L Q D Y R V L Y * Q K T R K L I M N A N Y K I I E Y Y T N K K L E K * L * M L T T R L * S I I L T K N * K K ----:----|----:----|----:----|----:----|----:----|----:----| T S * S H * S C S * L T N Y * C F V L F H Q N H I S V V L N Y L I I S V F F * F N I I F A L * L I I S Y * V L L F S S F TaqI | TspEI | Hpy99I TsoI CviJI | | MseI Tsp4CI* \ \ \ \ \ \ AAACATCTGGTGGCTACAAAATACCCGTCGAATTAACACCGTTATTTCTCGCTGTTGGTG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGTAGACCACCGATGTTTTATGGGCAGCTTAATTGTGGCAATAAAGAGCGACAACCAC / / / // / CviJI | | || Tsp4CI* | | |MseI | | TspEI | TaqI Hpy99I K H L V A T K Y P S N * H R Y F S L L V N I W W L Q N T R R I N T V I S R C W C T S G G Y K I P V E L T P L F L A V G V ----:----|----:----|----:----|----:----|----:----|----:----| F C R T A V F Y G D F * C R * K E S N T F V D P P * L I G T S N V G N N R A T P F M Q H S C F V R R I L V T I E R Q Q H AluI CviJI TspEI | SetI BslFI | MseI BsmAI \ \ \ \ \ \ TAGCTTTATGCTCTGGGACATACTTCACATATAAGAAATTAAGAACTGACGAGACTTTGA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| ATCGAAATACGAGACCCTGTATGAAGTGTATATTCTTTAATTCTTGACTGCTCTGAAACT / / / // / | CviJI BslFI |MseI BsmAI | AluI TspEI SetI * L Y A L G H T S H I R N * E L T R L * S F M L W D I L H I * E I K N * R D F E A L C S G T Y F T Y K K L R T D E T L R ----:----|----:----|----:----|----:----|----:----|----:----| Y S * A R P C V E C I L F * S S V L S Q T A K H E P V Y K V Y L F N L V S S V K L K I S Q S M S * M Y S I L F Q R S K S MaeIII BstEII | SetI TspEI MaeI TspDTI MseI \ \ \ \ \ \ GATTGACAGGTAACCCAGAATTATCTAGTTTAGATGAAGTCCTTGCCAAAGATAAGGATT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTAACTGTCCATTGGGTCTTAATAGATCAAATCTACTTCAGGAACGGTTTCTATTCCTAA / / / / / SetI BstEII | MaeI TspDTI MaeIII TspEI D * Q V T Q N Y L V * M K S L P K I R I I D R * P R I I * F R * S P C Q R * G L L T G N P E L S S L D E V L A K D K D * ----:----|----:----|----:----|----:----|----:----|----:----| S Q C T V W F * R T * I F D K G F I L I L N V P L G S N D L K S S T R A L S L S I S L Y G L I I * N L H L G Q W L Y P N AA -- TT / MseI X X -- L * # Enzymes that cut Frequency Isoschizomers AluI 2 AluBI AlwNI 1 CaiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BstEII 1 BstPI,Eco91I,EcoO65I,PspEI CviAII 1 CviJI 3 CviKI-1 DdeI 1 BstDEI,HpyF3I FatI 1 Hpy188I 1 Hpy99I 1 MaeI 2 FspBI,BfaI,XspI MaeIII 3 MseI 4 Tru1I,Tru9I NlaIII 1 Hin1II,Hsp92II,FaeI NspBII* 1 MspA1I PvuII 1 SetI 3 SfaNI 1 LweI TaqI 1 TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 4 TasI,Tsp509I,Sse9I TspGWI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AciI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI ApaI ApaLI ApoI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BisI BlsI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstF5I BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviQI CviRI* DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FauI Fnu4HI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin4II* Hin6I HindII HindIII HinfI HinP1I HpaI HpaII HphI Hpy166II Hpy178III*Hpy8I HspAI KasI KpnI Ksp632I* MaeII MauBI MboI MboII McrI* MfeI MluI MlyI MmeI MnlI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SecI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaiI TaqII TatI TauI TfiI TseI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769