Restriction Map of HAA1/YPR008W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

HAA1/YPR008W on chromosome XVI from coordinates 573018 to 575102.


MnlI | EcoNI | | BsiYI* | | | MnlI | | | SetI | | | |CviRI* | | | || MwoI | | | || | CviJI Hpy178III* | | | || | HaeIII MaeIII \ \ \ \ \\ \ \ \ ATGGTCTTGATAAATGGCATAAAGTATGCCTGTGAGAGGTGCATAAGAGGCCATAGAGTA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAGAACTATTTACCGTATTTCATACGGACACTCTCCACGTATTCTCCGGTATCTCAT / / / / / / / / / Hpy178III* | | | | | | MwoI HaeIII | | | | | CviRI* CviJI | | | | MnlI | | | SetI | | EcoNI | BsiYI* MnlI M V L I N G I K Y A C E R C I R G H R V W S * * M A * S M P V R G A * E A I E * G L D K W H K V C L * E V H K R P * S N ----:----|----:----|----:----|----:----|----:----|----:----| X T K I F P M F Y A Q S L H M L P W L T X P R S L H C L T H R H S T C L L G Y L H D Q Y I A Y L I G T L P A Y S A M S Y FatI |CviAII MboI MboI AccI || NspI | DpnI BclI SetI || CviRI* | |BstKTI | DpnI |Hpy166II || NlaIII | || AciI | |BstKTI || SetI \\ \ \ \\ \ \ \\ \\ \ ACAACATGCAATCATACAGATCAACCGCTTATGATGATCAAACCCAAAGGTAGACCTTCC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTGTACGTTAGTATGTCTAGTTGGCGAATACTACTAGTTTGGGTTTCCATCTGGAAGG / / // // / / // / / // | | |CviRI* || MboI AciI || BclI SetI |AccI | | |FatI |DpnI || MboI |SetI | | CviAII BstKTI |DpnI Hpy166II | NlaIII BstKTI | NspI MaeIII T T C N H T D Q P L M M I K P K G R P S Q H A I I Q I N R L * * S N P K V D L P N M Q S Y R S T A Y D D Q T Q R * T F H ----:----|----:----|----:----|----:----|----:----|----:----| V V H L * V S * G S I I I L G L P L G E L L M C D Y L D V A * S S * V W L Y V K C C A I M C I L R K H H D F G F T S R G FatI CviRI* |CviAII | BsmI |Hin4II* Hpy166II | |Hin4II* || NspI | TaqI | || Hpy178III* || NlaIII | AsuII | || | SetI \\ \ \ \ \ \\ \ \ ACTACATGCGACTATTGTAAACAACTTCGAAAAAACAAGAATGCAAATCCTGAAGGTGTT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGATGTACGCTGATAACATTTGTTGAAGCTTTTTTGTTCTTACGTTTAGGACTTCCACAA / // / / / / / / | |FatI Hpy166II AsuII | | | SetI | CviAII TaqI | | Hpy178III* Hin4II* | Hin4II* NlaIII CviRI* NspI BsmI T T C D Y C K Q L R K N K N A N P E G V L H A T I V N N F E K T R M Q I L K V F Y M R L L * T T S K K Q E C K S * R C L ----:----|----:----|----:----|----:----|----:----|----:----| V V H S * Q L C S R F F L F A F G S P T W * M R S N Y V V E F F C S H L D Q L H S C A V I T F L K S F V L I C I R F T N CviRI* | MaeII | AflIII | |PmaCI | |BsaAI | || SetI | || TaiI | || |MwoI | || ||CfrI | || ||| MroNI | || ||| CviJI | || ||| Cfr10I | || ||| HaeIII | || ||| Eco57I | || ||| Eco57MI | || ||| |HpaII | || ||| ||NaeI | || ||| ||Cac8I | || ||| ||| CviJI MboII MwoI | || ||| ||| |MaeI | BsrI | CviJI \ \\ \\\ \\\ \\ \ \ \ \ TGCACGTGTGGCCGGCTAGAGAAGAAAAAACTGGCACAGAAAGCCAAAGAAGAAGCAAGA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| ACGTGCACACCGGCCGATCTCTTCTTTTTTGACCGTGTCTTTCGGTTTCTTCTTCGTTCT // // // / /// / // / / // || || || | ||| MaeI || MwoI CviJI |MboII || || || | ||Cfr10I |BsrI SetI || || || | ||MroNI MboII || || || | ||CviJI || || || | |HpaII || || || | Cac8I || || || | CfrI || || || | NaeI || || || HaeIII || || || CviJI || || |Eco57MI || || |Eco57I || || AflIII || |MaeII || BsaAI || PmaCI || MwoI |TaiI |SetI CviRI* C T C G R L E K K K L A Q K A K E E A R A R V A G * R R K N W H R K P K K K Q E H V W P A R E E K T G T E S Q R R S K S ----:----|----:----|----:----|----:----|----:----|----:----| Q V H P R S S F F F S A C F A L S S A L K C T H G A L S S F V P V S L W L L L L A R T A P * L L F F Q C L F G F F F C S Tsp4CI* | FauI | |Csp6I | |Hpy166II | ||RsaI AluI | |||TspRI CviJI | |||| SetI MboII | |||| |AciI SetI | SetI | |||| || MnlI |BslFI | | CviJI | |||| || |BspMI || CviRI* \ \ \ \ \\\\ \\ \\ \\ \ GCTAAAGCCAAAGAAAAACAAAGAAAACAGTGTACCTGCGGGACTGATGAGGTTTGCAAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTTCGGTTTCTTTTTGTTTCTTTTGTCACATGGACGCCCTGACTACTCCAAACGTTT / / / / /// // / / / / CviJI CviJI | | ||Csp6I |MnlI | SetI | BslFI AluI | | |RsaI AciI BspMI CviRI* | | |SetI | | |FauI | | Hpy166II | Tsp4CI* TspRI A K A K E K Q R K Q C T C G T D E V C K L K P K K N K E N S V P A G L M R F A N * S Q R K T K K T V Y L R D * * G L Q I ----:----|----:----|----:----|----:----|----:----|----:----| A L A L S F C L F C H V Q P V S S T Q L L * L W L F V F F V T Y R R S Q H P K C S F G F F F L S F L T G A P S I L N A F FatI BinI* |CviAII | MboI || NlaIII | XhoII || | BsmAI BslFI DdeI Hin4II* | | DpnI \\ \ \ \ \ \ \ \ \ TATCATGCTCAAAAGAGACATCTAAGAAAGTCCCCTTCAAGTTCTCAAAAGAAAGGAAGA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGTACGAGTTTTCTCTGTAGATTCTTTCAGGGGAAGTTCAAGAGTTTTCTTTCCTTCT / // / / / / / // | |FatI BsmAI BslFI DdeI Hin4II* | |DpnI | CviAII | BstKTI NlaIII BinI* Y H A Q K R H L R K S P S S S Q K K G R I M L K R D I * E S P L Q V L K R K E D S C S K E T S K K V P F K F S K E R K I ----:----|----:----|----:----|----:----|----:----|----:----| Y * A * F L C R L F D G E L E * F F P L I D H E F S V D L F T G K L N E F S L F I M S L L S M * S L G R * T R L L F S S MboII BstKTI MboII BbvII* \ \ \ TCCATTTCTCGTTCTCAACCAATGTTTGAAAGGGTATTGTCTTCTACTTCACTTGACAGC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTAAAGAGCAAGAGTTGGTTACAAACTTTCCCATAACAGAAGATGAAGTGAACTGTCG / / / / | MboII | BbvII* XhoII MboII MboI S I S R S Q P M F E R V L S S T S L D S P F L V L N Q C L K G Y C L L L H L T A H F S F S T N V * K G I V F Y F T * Q Q ----:----|----:----|----:----|----:----|----:----|----:----| D M E R E * G I N S L T N D E V E S S L I W K E N E V L T Q F P I T K * K V Q C G N R T R L W H K F P Y Q R R S * K V A HpaII SduI |CfrI HgiAI* || CviJI | Hpy188I || HaeIII | | TspGWI || |SecI* | | | SetI SduI || |DsaI* | | | |MaeI MnlI HgiAI* \\ \\ \ \ \ \\ \ \ AATATGTTATCCGGCCACGGAGCACTATCAGATACCTCTAGCATACTGACGAGCACATTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTATACAATAGGCCGGTGCCTCGTGATAGTCTATGGAGATCGTATGACTGCTCGTGTAAA // / // // / / / / || | |HgiAI* || SetI | MnlI HgiAI* || | |SduI |TspGWI MaeI SduI || | DsaI* Hpy188I || | SecI* || CfrI |HaeIII |CviJI HpaII N M L S G H G A L S D T S S I L T S T F I C Y P A T E H Y Q I P L A Y * R A H F Y V I R P R S T I R Y L * H T D E H I F ----:----|----:----|----:----|----:----|----:----|----:----| L I N D P W P A S D S V E L M S V L V N C Y T I R G R L V I L Y R * C V S S C M I H * G A V S C * * I G R A Y Q R A C K Tsp4CI* | BssKI | CviJI BsaBI | TspRI | TspDTI | |HpaII | |FatI | ||ScrFI | ||CviAII FokI | ||CauII* ApoI | ||| NlaIII BsiYI* | ||| BsiYI* TspEI BslFI | ||| |BccI | TspDTI \ \\\ \ \ \ \ \\\ \\ \ \ TTAGACAGTGAGCCGGGTGTTGGTAAAATTTCAAAAGATTACCATCATGTCCCTTCATTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTGTCACTCGGCCCACAACCATTTTAAAGTTTTCTAATGGTAGTACAGGGAAGTAAC / / / /// / / // / // / / / | | | ||BssKI TspEI | || | || | | TspDTI | | | |BsiYI* ApoI | || | || | BsiYI* | | | CauII* | || | || BccI | | | HpaII | || | |FatI | | | ScrFI | || | CviAII | | CviJI | || NlaIII | Tsp4CI* | |TspDTI TspRI | BsaBI BslFI L D S E P G V G K I S K D Y H H V P S L * T V S R V L V K F Q K I T I M S L H W R Q * A G C W * N F K R L P S C P F I G ----:----|----:----|----:----|----:----|----:----|----:----| K S L S G P T P L I E F S * W * T G E N K L C H A P H Q Y F K L L N G D H G K M * V T L R T N T F N * F I V M M D R * Q MnlI | MboI | | DpnI AccI CviJI | | |BstKTI BceAI HaeIII BseGI | | || ApoI |BssNAI |Hin4II* | MnlI | | || TspEI |Hpy166II \\ \ \ \ \ \\ \ \\ GCCTCCATTTCATCCTTACAATCCTCGCAATCGTTAGATCAAAATTTCAGTATACCACAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAGGTAAAGTAGGAATGTTAGGAGCGTTAGCAATCTAGTTTTAAAGTCATATGGTGTT / / / / // / / // | | MnlI MnlI || MboI TspEI |BceAI | BseGI |DpnI ApoI |AccI Hin4II* BstKTI Hpy166II HaeIII BssNAI CviJI FokI A S I S S L Q S S Q S L D Q N F S I P Q P P F H P Y N P R N R * I K I S V Y H K L H F I L T I L A I V R S K F Q Y T T K ----:----|----:----|----:----|----:----|----:----|----:----| A E M E D K C D E C D N S * F K L I G C P R W K M R V I R A I T L D F N * Y V V G G N * G * L G R L R * I L I E T Y W L CviJI | AciI | Cac8I MseI | |MboII FauI |TspEI \ \\ \ \\ AGCCCGCCGTTATCTTCAATGTCATTTAATTTTCTCACGGGAAATATCAATGAAACCAAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TCGGGCGGCAATAGAAGTTACAGTAAATTAAAAGAGTGCCCTTTATAGTTACTTTGGTTG / / / / / / | | AciI FauI | TspEI | Cac8I MseI | MboII CviJI S P P L S S M S F N F L T G N I N E T N A R R Y L Q C H L I F S R E I S M K P T P A V I F N V I * F S H G K Y Q * N Q P ----:----|----:----|----:----|----:----|----:----|----:----| L G G N D E I D N L K R V P F I L S V L F G A T I K L T M * N E * P F Y * H F W A R R * R * H * K I K E R S I D I F G V TspDTI | Tsp4CI* BsmI BsrI HindIII \ \ \ \ \ CAAAATCACAGTAATCATCAGCATTCAAAATCAGGCAATAACTGGCAAGATAGTTCGGTA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTAGTGTCATTAGTAGTCGTAAGTTTTAGTCCGTTATTGACCGTTCTATCAAGCCAT / / / / / | Tsp4CI* BsmI BsrI SetI TspDTI Q N H S N H Q H S K S G N N W Q D S S V K I T V I I S I Q N Q A I T G K I V R * K S Q * S S A F K I R Q * L A R * F G K ----:----|----:----|----:----|----:----|----:----|----:----| W F * L L * * C E F D P L L Q C S L E T G F D C Y D D A N L I L C Y S A L Y N P L I V T I M L M * F * A I V P L I T R Y AluI CviJI | SetI | |TfiI | |HinfI | || MaeII | || |BtrI | || || SetI | || || TaiI AluI | || || | MseI CviJI | || || | |BccI | SetI | || || | || FatI | Cac8I | || || | || |CviAII | | Cac8I | || || | || || NlaIII \ \ \ \ \\ \\ \ \\ \\ \ AGCTTGCCAGCGAAAGCTGATTCACGTCTTAACATGATGGATAAAAACAACTCTGTGGGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAACGGTCGCTTTCGACTAAGTGCAGAATTGTACTACCTATTTTTGTTGAGACACCCA / / / / / // // // // | | Cac8I | CviJI || || || |FatI | HindIII | AluI || || || CviAII | Cac8I SetI || || |NlaIII CviJI || || MseI AluI || || BccI || |MaeII || BtrI |TaiI |SetI HinfI TfiI S L P A K A D S R L N M M D K N N S V G A C Q R K L I H V L T * W I K T T L W V L A S E S * F T S * H D G * K Q L C G S ----:----|----:----|----:----|----:----|----:----|----:----| L K G A F A S E R R L M I S L F L E T P L S A L S L Q N V D * C S P Y F C S Q P A Q W R F S I * T K V H H I F V V R H T Hpy178III* CviJI | SetI HaeIII EcoRV BsiI* \ \ \ \ \ CTTGACCTATTAGGCCATTCAAAACGAATATCGCCGATATCAAACTCTCGTGTGGGCGAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTGGATAATCCGGTAAGTTTTGCTTATAGCGGCTATAGTTTGAGAGCACACCCGCTT // / / / / |SetI HaeIII EcoRV BsiI* MwoI Hpy178III* CviJI L D L L G H S K R I S P I S N S R V G E L T Y * A I Q N E Y R R Y Q T L V W A K * P I R P F K T N I A D I K L S C G R S ----:----|----:----|----:----|----:----|----:----|----:----| R S R N P W E F R I D G I D F E R T P S D Q G I L G N L V F I A S I L S E H P R K V * * A M * F S Y R R Y * V R T H A F XmnI | MmeI | |MboII | || Hpy188I | || |BccI | || || Hin4II* | || || | Ksp632I* AciI | || || | | Hin4I MwoI | MaeI | || || | | | MaeIII \ \ \ \ \\ \\ \ \ \ \ GTTAGCGTTCCGCTAGAAGAATATATTCCTTCTGACATTGATGGGGTTGGAAGAGTTACT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CAATCGCAAGGCGATCTTCTTATATAAGGAAGACTGTAACTACCCCAACCTTCTCAATGA / / / / / / / / // / | MaeI | | | | | Hin4II* |Ksp632I* MaeIII AciI | | | | BccI Hin4I | | | Hpy188I | | MboII | MmeI XmnI V S V P L E E Y I P S D I D G V G R V T L A F R * K N I F L L T L M G L E E L L * R S A R R I Y S F * H * W G W K S Y * ----:----|----:----|----:----|----:----|----:----|----:----| T L T G S S S Y I G E S M S P T P L T V L * R E A L L I Y E K Q C Q H P Q F L * N A N R * F F I N R R V N I P N S S N S AccI |Hpy166II || Hin4I || |CfrI TatI AluI || || BalI TspDTI |Csp6I CviJI || || CviJI |ApoI ||BbvI MboII | SetI || || HaeIII |TspEI ||RsaI \ \ \ \\ \\ \ \\ \\\ GATAAAAGCTCTTTGGTCTACGATTGGCCATTTGATGAAAGTATTGAGAGAAATTTCAGT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTTTCGAGAAACCAGATGCTAACCGGTAAACTACTTTCATAACTCTCTTTAAAGTCA / / / // / / / / / | | CviJI |Hin4I | CfrI TspDTI | RsaI | | AluI |AccI HaeIII TspEI | SetI Hpy166II CviJI ApoI MboII BalI D K S S L V Y D W P F D E S I E R N F S I K A L W S T I G H L M K V L R E I S V * K L F G L R L A I * * K Y * E K F Q Y ----:----|----:----|----:----|----:----|----:----|----:----| S L L E K T * S Q G N S S L I S L F K L Q Y F S K P R R N A M Q H F Y Q S F N * I F A R Q D V I P W K I F T N L S I E T AciI | TseI | MwoI | BstAPI | NspBII* | |BisI | ||BlsI HphI Tsp4CI* AciI | |||CviRI* BsrI |TaqI MseI | TspEI \ \ \\\\ \ \\ \ \ \ ACAACCGCAACCGCTGCAACTGGTGAAAGTAAGTTCGACATTAACGACAACTGTAATAGA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTGGCGTTGGCGACGTTGACCACTTTCATTCAAGCTGTAATTGCTGTTGACATTATCT // / / / //// / / / / / || | | | |||| BsrI | TaqI MseI Tsp4CI* || | | | |||CviRI* HphI || | | | |||TseI || | | | ||BisI || | | | |BlsI || | | | NspBII* || | | | AciI || | | BstAPI || | | MwoI || | AciI || BbvI |TatI Csp6I T T A T A A T G E S K F D I N D N C N R Q P Q P L Q L V K V S S T L T T T V I E N R N R C N W * K * V R H * R Q L * * N ----:----|----:----|----:----|----:----|----:----|----:----| V V A V A A V P S L L N S M L S L Q L L Y L R L R Q L Q H F Y T R C * R C S Y Y C G C G S C S T F T L E V N V V V T I S MseI Tsp4CI* VspI | TspDTI \ \ \ ATTAATAGCAAAAGTTATAGTAAGACTAATAGTATGAATGGAAACGGTATGAACAATAGC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTATCGTTTTCAATATCATTCTGATTATCATACTTACCTTTGCCATACTTGTTATCG // / / |VspI | TspDTI |MseI Tsp4CI* TspEI I N S K S Y S K T N S M N G N G M N N S L I A K V I V R L I V * M E T V * T I A * * Q K L * * D * * Y E W K R Y E Q * Q ----:----|----:----|----:----|----:----|----:----|----:----| I L L L L * L L V L L I F P F P I F L L F * Y C F N Y Y S * Y Y S H F R Y S C Y N I A F T I T L S I T H I S V T H V I A XbaI |MaeI |Hpy178III* TspDTI Tsp4CI* MboII ||Ksp632I* \ \ \ \\\ AATAATAATAATATCAACAGTAATGGCAACGACAAGAACAATAACAACTCTTCTAGACAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTATTATTATAGTTGTCATTACCGTTGCTGTTCTTGTTATTGTTGAGAAGATCTGTT / / / /// TspDTI Tsp4CI* MboII ||Ksp632I* |XbaI Hpy178III* MaeI N N N N I N S N G N D K N N N N S S R Q I I I I S T V M A T T R T I T T L L D K * * * Y Q Q * W Q R Q E Q * Q L F * T R ----:----|----:----|----:----|----:----|----:----|----:----| L L L L I L L L P L S L F L L L E E L C C Y Y Y Y * C Y H C R C S C Y C S K * V I I I I D V T I A V V L V I V V R R S L FatI AflIII BspLU11I* |CviAII ||Hin4I ||Hin4I |||TspDTI ||||NspI ||||NlaIII ||||| Hpy166II ||||| | TfiI TaqI Hin4I ||||| | HinfI | Hpy99I Hin4I \\\\\ \ \ \ \ \ GAACATCAAGGAAATGGACTATTTGACATGTTTACAGATTCATCGTCGATTTCAACGCTT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTAGTTCCTTTACCTGATAAACTGTACAAATGTCTAAGTAGCAGCTAAAGTTGCGAA / // // / / / / / | || || | | | TaqI Hin4I | || || | | Hpy99I Hin4I | || || | HinfI | || || | TfiI | || || Hpy166II | || |BspLU11I* | || |AflIII | || |FatI | || CviAII | |TspDTI | NlaIII | NspI Hin4I Hin4I E H Q G N G L F D M F T D S S S I S T L N I K E M D Y L T C L Q I H R R F Q R F T S R K W T I * H V Y R F I V D F N A F ----:----|----:----|----:----|----:----|----:----|----:----| S C * P F P S N S M N V S E D D I E V S L V D L F H V I Q C T * L N M T S K L A F M L S I S * K V H K C I * R R N * R K CviRI* CviRI* TspEI \ \ \ TCCCGTGCAAACTTATTATTGCAAGAAAAAATTGGTTCGCAAGAAAACTCTGTCAAACAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AGGGCACGTTTGAATAATAACGTTCTTTTTTAACCAAGCGTTCTTTTGAGACAGTTTGTT / / / CviRI* CviRI* TspEI S R A N L L L Q E K I G S Q E N S V K Q P V Q T Y Y C K K K L V R K K T L S N K P C K L I I A R K N W F A R K L C Q T R ----:----|----:----|----:----|----:----|----:----|----:----| E R A F K N N C S F I P E C S F E T L C K G H L S I I A L F F Q N A L F S Q * V G T C V * * Q L F F N T R L F V R D F L Hpy178III* | MboI | TspDTI | |FokI TaqI TspEI | ||DpnI AsuII MnlI | MseI | |||BstKTI \ \ \ \ \ \\\\ GAAAACTATTCGAAAAATCCTCAACTTCGTCATCAATTAACTTCCAGAAGTAGATCATTT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTGATAAGCTTTTTAGGAGTTGAAGCAGTAGTTAATTGAAGGTCTTCATCTAGTAAA / / // / / // // AsuII MnlI |MseI | | || |FokI TaqI TspEI | | || MboI | | |DpnI | | BstKTI | TspDTI Hpy178III* E N Y S K N P Q L R H Q L T S R S R S F K T I R K I L N F V I N * L P E V D H L K L F E K S S T S S S I N F Q K * I I Y ----:----|----:----|----:----|----:----|----:----|----:----| S F * E F F G * S R * * N V E L L L D N L F S N S F D E V E D D I L K W F Y I M F V I R F I R L K T M L * S G S T S * K MboII BseGI | ApoI | HpaII | TspEI MslI \ \ \ \ \ ATTCATCATCCGGCAAACGAGTATTTGAAGAATACTTTTGGAAATTCACATAGTAATGAC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTAGTAGGCCGTTTGCTCATAAACTTCTTATGAAAACCTTTAAGTGTATCATTACTG / / / / / / / BseGI HpaII MboII TspEI | | BsaXI ApoI | TstI MslI I H H P A N E Y L K N T F G N S H S N D F I I R Q T S I * R I L L E I H I V M T S S S G K R V F E E Y F W K F T * * * H ----:----|----:----|----:----|----:----|----:----|----:----| I * * G A F S Y K F F V K P F E C L L S * E D D P L R T N S S Y K Q F N V Y Y H N M M R C V L I Q L I S K S I * M T I V TstI BsaXI BsaXI | Hpy188I | TstI Hpy178III* \ \ \ \ \ ATCGGAAAGGGAGTTGAAGTGCTATCTTTGACACCGAGTTTTATGGATATTCCCGAAAAA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCCTTTCCCTCAACTTCACGATAGAAACTGTGGCTCAAAATACCTATAAGGGCTTTTT / / / Hpy188I BsaXI Hpy178III* TstI I G K G V E V L S L T P S F M D I P E K S E R E L K C Y L * H R V L W I F P K K R K G S * S A I F D T E F Y G Y S R K R ----:----|----:----|----:----|----:----|----:----|----:----| M P F P T S T S D K V G L K I S I G S F C R F P L Q L A I K S V S N * P Y E R F D S L S N F H * R Q C R T K H I N G F F FokI | MboI | | DpnI | | |BstKTI | | || BsaBI | | || | BseGI | | || | TspGWI | | || | | BccI | | || | | TspEI SetI TaqI \ \ \\ \ \ \ \ \ GAAAGAGAAACGGAAAGATCGCCATCATCCAATTACATTACTGACAGACCTTTCACTCGA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCTCTTTGCCTTTCTAGCGGTAGTAGGTTAATGTAATGACTGTCTGGAAAGTGAGCT /// // / / / / / ||| || TspGWI | TspEI SetI TaqI ||| || BseGI BccI ||| |BsaBI ||| MboI ||DpnI |BstKTI FokI E R E T E R S P S S N Y I T D R P F T R K E K R K D R H H P I T L L T D L S L E K R N G K I A I I Q L H Y * Q T F H S K ----:----|----:----|----:----|----:----|----:----|----:----| S L S V S L D G D D L * M V S L G K V R L F L F P F I A M M W N C * Q C V K * E F S F R F S R W * G I V N S V S R E S S MboII | MaeI | |SetI | ||MboI | ||BglII | ||XhoII MaeII SetI | ||| DpnI | SetI | BciVI | ||| |BstKTI | TaiI | |HgiCI* | ||| || MaeI | |Hpy166II SetI | || NlaIV Tsp4CI* \ \\\ \\ \ \ \\ \ \ \\ \ \ AAACCTAGATCTTCTAGCATTGACGTAAACCATAGGTATCCACCTATGGCACCAACAACC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGATCTAGAAGATCGTAACTGCATTTGGTATCCATAGGTGGATACCGTGGTTGTTGG // /// / / / / / / / / / / / |SetI ||| | MaeI | | | SetI SetI | | HgiCI* Tsp4CI* MboII ||| XhoII | | Hpy166II | NlaIV ||| BglII | MaeII BciVI ||| MboI TaiI ||DpnI SetI |BstKTI MaeI K P R S S S I D V N H R Y P P M A P T T N L D L L A L T * T I G I H L W H Q Q P T * I F * H * R K P * V S T Y G T N N R ----:----|----:----|----:----|----:----|----:----|----:----| F G L D E L M S T F W L Y G G I A G V V F V * I K * C Q R L G Y T D V * P V L L F R S R R A N V Y V M P I W R H C W C G Hpy178III* |TaqI || BseMII BssKI || |BspCNI | HpaII || ||MboI | ScrFI || |||Hpy99I | CauII* || ||||DpnI | | BceAI || |||||BstKTI | | | CviRI* Cac8I || |||||| DdeI \ \ \ \ \ \\ \\\\\\ \ GTAGCGACATCTCCCGGTGCATTGAACAATGCCGTAGCAAGCAATCTCGACGATCAACTG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CATCGCTGTAGAGGGCCACGTAACTTGTTACGGCATCGTTCGTTAGAGCTGCTAGTTGAC ///// / /// // / ||||CviRI* Cac8I ||| || MboI |||BceAI ||| |DpnI ||BssKI ||| BstKTI |HpaII ||TaqI CauII* |Hpy178III* ScrFI |BspCNI Hpy99I BseMII V A T S P G A L N N A V A S N L D D Q L * R H L P V H * T M P * Q A I S T I N * S D I S R C I E Q C R S K Q S R R S T E ----:----|----:----|----:----|----:----|----:----|----:----| T A V D G P A N F L A T A L L R S S * S R L S M E R H M S C H R L L C D R R D V Y R C R G T C Q V I G Y C A I E V I L Q TaqI AsuI* ClaI AvaII | BccI |BmgT120I DdeI | BspCNI || BseMII MseI | CviJI | |BseMII BccI ||NlaIV |BspCNI \ \ \ \ \\ \ \\\ \\ AGTTTAACATCACTAAACTCTCAGCCATCATCGATAGCAAATATGATGATGGACCCTTCA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAATTGTAGTGATTTGAGAGTCGGTAGTAGCTATCGTTTATACTACTACCTGGGAAGT / / // //// / // // DdeI MseI |CviJI |||BccI BccI || |BspCNI DdeI ||ClaI || BseMII ||TaqI |AvaII |BseMII |AsuI* BspCNI BmgT120I NlaIV S L T S L N S Q P S S I A N M M M D P S V * H H * T L S H H R * Q I * * W T L Q F N I T K L S A I I D S K Y D D G P F K ----:----|----:----|----:----|----:----|----:----|----:----| L K V D S F E * G D D I A F I I I S G E S N L M V L S E A M M S L L Y S S P G K T * C * * V R L W * R Y C I H H H V R * MaeI |SetI |Hin4II* || AluI || CviJI || |DdeI MnlI || |EspI* | BspCNI || ||SetI | |BseMII || ||| TspDTI DdeI | || Hpy188I \\ \\\ \ \ \ \\ \ AACCTAGCTGAGCAAAGTTCTATTCATTCAGTTCCTCAGTCAATAAACTCTCCGAGAATG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGATCGACTCGTTTCAAGATAAGTAAGTCAAGGAGTCAGTTATTTGAGAGGCTCTTAC / //// / / / // / / | |||| TspDTI DdeI | || Hpy188I BsmI | |||| EspI* | |BseMII | |||| DdeI | BspCNI | |||CviJI MnlI | |||AluI | ||MaeI | |SetI | Hin4II* SetI N L A E Q S S I H S V P Q S I N S P R M T * L S K V L F I Q F L S Q * T L R E C P S * A K F Y S F S S S V N K L S E N A ----:----|----:----|----:----|----:----|----:----|----:----| F R A S C L E I * E T G * D I F E G L I L G L Q A F N * E N L E E T L L S E S F V * S L L T R N M * N R L * Y V R R S H BsiYI* Hin4II* AciI BsmI | BsrI | DdeI MboII \ \ \ \ \ \ CCTAAAACTGGAAGTCGCCAAGACAAGAACATTCACACTAAGAAGGAAGAAAGAAATCCG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GGATTTTGACCTTCAGCGGTTCTGTTCTTGTAAGTGTGATTCTTCCTTCTTTCTTTAGGC / / / / / / | BsrI | DdeI | AciI BsiYI* Hin4II* MboII P K T G S R Q D K N I H T K K E E R N P L K L E V A K T R T F T L R R K K E I R * N W K S P R Q E H S H * E G R K K S A ----:----|----:----|----:----|----:----|----:----|----:----| G L V P L R W S L F M * V L F S S L F G A * F Q F D G L C S C E C * S P L F F D R F S S T A L V L V N V S L L F F S I R MboI | DpnI | |BstKTI | || MaeIII | || Tsp45I | || | MfeI Csp6I | || | TspEI |RsaI \ \\ \ \ \\ CTAAATAACATACACGATCTGTCACAATTGGAAAATGTACCAGACGAGATGAACCAAATG 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GATTTATTGTATGTGCTAGACAGTGTTAACCTTTTACATGGTCTGCTCTACTTGGTTTAC // / / / // || MboI | TspEI |Csp6I |DpnI | MfeI RsaI BstKTI Tsp45I MaeIII L N N I H D L S Q L E N V P D E M N Q M * I T Y T I C H N W K M Y Q T R * T K C K * H T R S V T I G K C T R R D E P N V ----:----|----:----|----:----|----:----|----:----|----:----| S F L M C S R D C N S F T G S S I F W I A L Y C V R D T V I P F H V L R S S G F * I V Y V I Q * L Q F I Y W V L H V L H TspDTI | BseGI | | TspDTI | | | FokI BetI* | | | | ApoI MaeI TspDTI MseI SfaNI |HpaII | | | | TspEI |TspDTI \ \ \ \\ \ \ \ \ \ \\ TTCTCCCCACCATTAAAAAGTATGAATAGACCGGATGCCATAAGGGAAAATTCATCTAGT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AAGAGGGGTGGTAATTTTTCATACTTATCTGGCCTACGGTATTCCCTTTTAAGTAGATCA / / / /// / / / / / / TspDTI MseI | ||| | TspDTI | | | MaeI | ||| BseGI | | TspDTI | ||TspDTI | TspEI | |BetI* | ApoI | HpaII FokI SfaNI F S P P L K S M N R P D A I R E N S S S S P H H * K V * I D R M P * G K I H L V L P T I K K Y E * T G C H K G K F I * * ----:----|----:----|----:----|----:----|----:----|----:----| N E G G N F L I F L G S A M L S F E D L T R G V M L F Y S Y V P H W L P F N M * E G W W * F T H I S R I G Y P F I * R T FatI Hin4II* |CviAII | BetI* || MboI | BspMII* || |NlaIII | |HpaII StyI || ||DpnI | |Hpy178III* TspEI SecI* || |||BstKTI | || Hin4II* SetI \ \ \\ \\\\ \ \\ \ \ AGTAATTTCATAATCCAAGGAAATAGCATGATCTCTACGCCTTCCGGAAGGAATGACCTT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTAAAGTATTAGGTTCCTTTATCGTACTAGAGATGCGGAAGGCCTTCCTTACTGGAA / / / /// / / // / / TspEI SecI* | ||| MboI | || | SetI StyI | ||DpnI | || Hin4II* | |BstKTI | |BspMII* | |FatI | |BetI* | CviAII | Hpy178III* NlaIII | HpaII Hin4II* S N F I I Q G N S M I S T P S G R N D L V I S * S K E I A * S L R L P E G M T F * F H N P R K * H D L Y A F R K E * P S ----:----|----:----|----:----|----:----|----:----|----:----| L L K M I W P F L M I E V G E P L F S R Y Y N * L G L F Y C S R * A K R F S H G T I E Y D L S I A H D R R R G S P I V K Hpy178III* | Hin4II* MaeIII | | SetI MnlI HgaI HphI Tsp45I TspEI MboI \ \ \ \ \ \ \ \ \ CCAGATACCTCTCCAATGAGTAGTATTCAAACAGCGTCACCACCAAGTCAATTACTGACC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTATGGAGAGGTTACTCATCATAAGTTTGTCGCAGTGGTGGTTCAGTTAATGACTGG / / / / / / | Hin4II* MnlI HgaI Tsp45I TspEI | SetI HphI MaeIII Hpy178III* P D T S P M S S I Q T A S P P S Q L L T Q I P L Q * V V F K Q R H H Q V N Y * P R Y L S N E * Y S N S V T T K S I T D R ----:----|----:----|----:----|----:----|----:----|----:----| G S V E G I L L I * V A D G G L * N S V E L Y R E L S Y Y E F L T V V L D I V S W I G R W H T T N L C R * W W T L * Q G AciI TaqII | TspDTI | | TspEI | | | MboII | | | BbvII* | | | | FatI DpnI | | | | |CviAII |BstKTI | | | | || NlaIII \\ \ \ \ \ \\ \ GATCAAGGATTTGCGGATTTGGATAATTTCATGTCTTCGTTATGA 2050 2060 2070 2080 ----:----|----:----|----:----|----:----|----: CTAGTTCCTAAACGCCTAAACCTATTAAAGTACAGAAGCAATACT // / / // / /// // || MboI | |TspDTI | ||| |FatI |DpnI | AciI | ||| CviAII BstKTI TaqII | ||BbvII* | |NlaIII | TspEI MboII D Q G F A D L D N F M S S L * I K D L R I W I I S C L R Y X S R I C G F G * F H V F V M X ----:----|----:----|----:----|----:----|----: S * P N A S K S L K M D E N H R D L I Q P N P Y N * T K T I I L S K R I Q I I E H R R * S # Enzymes that cut Frequency Isoschizomers AccI 3 FblI,XmiI AciI 8 BspACI,SsiI AflIII 2 AluI 5 AluBI ApoI 5 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 6 BceAI 2 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BetI* 2 BsaWI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 1 BsaAI 1 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BsaXI 1 BseGI 4 BstF5I,BtsCI BseMII 4 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 3 BsaMI,Mva1269I,PctI BspCNI 4 BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 4 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 1 BstKTI 11 BtrI 1 BmgBI,AjiI Cac8I 5 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 3 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 3 CviQI,RsaNI CviAII 8 CviJI 17 CviKI-1 CviRI* 9 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 11 MalI DsaI* 1 BtgI,BstDSI Eco57I 1 AcuI Eco57MI 1 EcoNI 1 BstENI,XagI EcoRV 1 Eco32I EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FatI 8 FauI 2 SmuI FokI 4 HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4I 3 Hin4II* 10 HpyAV HindIII 1 HinfI 2 HpaII 7 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 7 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 4 Hpy99I 2 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 8 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 4 MboI 11 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 12 MfeI 1 MunI MmeI 1 MnlI 9 MroNI 1 NgoMIV MseI 7 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NaeI 1 PdiI NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 3 BstNSI,XceI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI RsaI 3 AfaI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 23 SfaNI 1 LweI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 7 TaqII 1 TatI 1 TfiI 2 PfeI TseI 1 ApeKI Tsp45I 2 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 14 TspEI 14 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 2 TscAI TstI 1 VspI 1 PshBI,AseI XbaI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BamHI BarI BbvCI Bce83I* BcgI BdaI BfiI BglI BmeT110I BmtI BplI Bpu10I BseBI BsePI BseRI BseSI BseYI BsgI Bsp120I Bsp1407I BspHI BspOI BsrBI BsrDI Bst2UI BstEII BstNI BstOI BstXI BtgZI BtsI Cfr9I CspCI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoP15I EcoRI EcoRII EcoT22I EgeI EheI Esp3I FalI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HgiJII* HhaI Hin6I HindII HinP1I HpaI HspAI KasI KpnI MauBI McrI* MluI MlyI Mph1103I MstI* MvaI NarI NcoI NdeI NheI NmeAIII NotI NruI NsiI OliI PacI PasI PflMI PfoI PleI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TauI TsoI TspMI Tth111I XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769