Restriction Map of KAR9/YPL269W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

KAR9/YPL269W on chromosome XVI from coordinates 33013 to 34947.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.26679

AsuI* AvaII |BmgT120I ||NlaIV ||| MboI ||| BglII ||| XhoII ||| | DpnI BccI ||| | |BstKTI BseGI FokI \ \\\ \ \\ \ \ ATGGATAATGATGGACCCAGATCTATGACCATTGGGGATGACTTCCAAGAGAACTTTTGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTATTACTACCTGGGTCTAGATACTGGTAACCCCTACTGAAGGTTCTCTTGAAAACA / // // / / / BccI || || XhoII BseGI FokI || || BglII || || MboI || |DpnI || BstKTI |AvaII |AsuI* BmgT120I NlaIV M D N D G P R S M T I G D D F Q E N F C W I M M D P D L * P L G M T S K R T F V G * * W T Q I Y D H W G * L P R E L L * ----:----|----:----|----:----|----:----|----:----|----:----| X S L S P G L D I V M P S S K W S F K Q X P Y H H V W I * S W Q P H S G L S S K H I I I S G S R H G N P I V E L L V K T Hpy166II | AclI ApoI | MaeII XmnI | | SetI TspEI | | TaiI EcoRI Hin4I CviRI* \ \ \ \ \ \ GAACGTTTAGAAAGAATTCACAATACATTACATTCAATAAACGATTGCAACTCATTGAAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGCAAATCTTTCTTAAGTGTTATGTAATGTAAGTTATTTGCTAACGTTGAGTAACTTA // / / / / / || MaeII | EcoRI Hin4I CviRI* || AclI | TspEI |TaiI | ApoI |SetI XmnI Hpy166II E R L E R I H N T L H S I N D C N S L N N V * K E F T I H Y I Q * T I A T H * M T F R K N S Q Y I T F N K R L Q L I E * ----:----|----:----|----:----|----:----|----:----|----:----| S R K S L I * L V N C E I F S Q L E N F H V N L F F E C Y M V N L L R N C S M S F T * F S N V I C * M * Y V I A V * Q I Csp6I |RsaI BsmAI AclI |Hin4I | Hpy188I TspEI PpiI MaeII \\ \ \ \ \ \ GAGAGTACCACAAGTATATCAGAGACATTGTTAGTTCAATTTTATGATGATTTGGAGAAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTCATGGTGTTCATATAGTCTCTGTAACAATCAAGTTAAAATACTACTAAACCTCTTG / // / / / / | |Csp6I Hpy188I | PpiI TaiI | RsaI BsmAI TspEI SetI Hin4I E S T T S I S E T L L V Q F Y D D L E N R V P Q V Y Q R H C * F N F M M I W R T E Y H K Y I R D I V S S I L * * F G E R ----:----|----:----|----:----|----:----|----:----|----:----| S L V V L I D S V N N T * N * S S K S F H S Y W L Y I L S M T L E I K H H N P S L T G C T Y * L C Q * N L K I I I Q L V TspEI | MnlI | |Hpy178III* | || DdeI | || PpiI SetI | || |Tth111I TaiI | || || HindII | SecI* | || || Hpy166II BsrI BfiI \ \ \ \\ \\ \ \ \ GTTGCCTCGGTAATTCCCGACTTAGTCAACAAGAAAAGACTGGGAAAAGACGATATTTTG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGGAGCCATTAAGGGCTGAATCAGTTGTTCTTTTCTGACCCTTTTCTGCTATAAAAC / / /// / // / / / MaeII | ||| | || Hpy166II BsrI BfiI AclI | ||| | || HindII | ||| | |DdeI | ||| | Tth111I | ||| Hpy178III* | ||PpiI | |TspEI | MnlI SecI* V A S V I P D L V N K K R L G K D D I L L P R * F P T * S T R K D W E K T I F C C L G N S R L S Q Q E K T G K R R Y F V ----:----|----:----|----:----|----:----|----:----|----:----| T A E T I G S K T L L F L S P F S S I K R Q R P L E R S L * C S F V P F L R Y K N G R Y N G V * D V L F S Q S F V I N Q TspDTI | MaeIII | Tsp45I | | MaeII | | | SetI TsoI BsrI TspEI | | | TaiI \ \ \ \ \ \ \ TTGTTTATGGACTGGTTATTATTGAAAAAATATATGCTATATCAATTTATTAGTGACGTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AACAAATACCTGACCAATAATAACTTTTTTATATACGATATAGTTAAATAATCACTGCAA / / / / // TsoI BsrI TspDTI | |MaeII TspEI | Tsp45I | MaeIII TaiI SetI L F M D W L L L K K Y M L Y Q F I S D V C L W T G Y Y * K N I C Y I N L L V T F V Y G L V I I E K I Y A I S I Y * * R S ----:----|----:----|----:----|----:----|----:----|----:----| N N I S Q N N N F F Y I S Y * N I L S T T T * P S T I I S F I Y A I D I * * H R Q K H V P * * Q F F I H * I L K N T V N ApoI TspEI EcoRI | BseGI MnlI | Hin4II* | SspI MnlI | | Hpy178III* | |Hin4II* |Hin4I | | |TaqI | || MmeI SetI || MaeI | | || FokI \ \\ \ \ \\ \ \ \ \\ \ CATAATATTGAGGAAGGTTTTGCTCATTTGTTGGATTTACTAGAGGATGAATTCTCGAAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GTATTATAACTCCTTCCAAAACGAGTAAACAACCTAAATGATCTCCTACTTAAGAGCTTC / / / / / / / // / // / | | MmeI SetI | MnlI MaeI || | || TspDTI | Hin4II* Hin4I || | |TaqI | SspI || | Hpy178III* MnlI || EcoRI || TspEI || ApoI |Hin4II* BseGI H N I E E G F A H L L D L L E D E F S K I I L R K V L L I C W I Y * R M N S R R * Y * G R F C S F V G F T R G * I L E G ----:----|----:----|----:----|----:----|----:----|----:----| * L I S S P K A * K N S K S S S S N E F E Y Y Q P L N Q E N T P N V L P H I R S M I N L F T K S M Q Q I * * L I F E R L TspDTI AcyI |MboI MaeII || DpnI |ZraI || |BstKTI || SetI || ||Hpy178III* TaqI || TaiI TfiI || ||| Hin4I ClaI CviJI || AatII HinfI \\ \\\ \ \ \ \\ \ \ GACGATCAGGATAGCGACAAATACAATCGATTTAGCCCGATGTTTGACGTCATAGAAGAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTAGTCCTATCGCTGTTTATGTTAGCTAAATCGGGCTACAAACTGCAGTATCTTCTT / // / / / / / // / | || | Hpy178III* ClaI CviJI | |MaeII MmeI | || MboI TaqI | |AcyI | |DpnI | ZraI | BstKTI AatII | Hin4I TaiI FokI SetI D D Q D S D K Y N R F S P M F D V I E E T I R I A T N T I D L A R C L T S * K N R S G * R Q I Q S I * P D V * R H R R I ----:----|----:----|----:----|----:----|----:----|----:----| S S * S L S L Y L R N L G I N S T M S S P R D P Y R C I C D I * G S T Q R * L L V I L I A V F V I S K A R H K V D Y F F NlaIV |CviJI ||FatI ||NcoI ||StyI ||SecI* ||DsaI* MboII |||CviAII |TspEI ||||BspCNI ||MlyI |||||BseMII ||PleI ||||||NlaIII ||| MseI |||||||CviJI ||| | HinfI |||||||| AjuI TspEI MmeI ||| | | DdeI |||||||| | Hin4II* | BciVI \ \\\ \ \ \ \\\\\\\\ \ \ \ \ TCTACACAAATTAAGACTCAGTTGGAGCCATGGCTTACTAACTTGAAGGAATTATTGGAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGTGTTTAATTCTGAGTCAACCTCGGTACCGAATGATTGAACTTCCTTAATAACCTA / / // // / / //// /// / / / / | | || |MseI | DdeI |||| ||| Hin4II* | TspEI TaiI | | || TspEI HinfI |||| ||CviJI BciVI SetI | | |PleI |||| |DsaI* | | MlyI |||| |SecI* | MboII |||| |StyI HinfI |||| |NcoI TfiI |||| |FatI |||| |AjuI |||| CviAII |||BseMII ||BspCNI ||NlaIII |CviJI NlaIV S T Q I K T Q L E P W L T N L K E L L D L H K L R L S W S H G L L T * R N Y W I Y T N * D S V G A M A Y * L E G I I G Y ----:----|----:----|----:----|----:----|----:----|----:----| D V C I L V * N S G H S V L K F S N N S I * V F * S E T P A M A * * S S P I I P R C L N L S L Q L W P K S V Q L F * Q I MboI | DpnI AjuI | |BciVI MaeII |ApoI | |BstKTI | SetI |TspEI ApoI | || NdeI MseI | TaiI || MseI TspEI | || | BinI* VspI \ \ \\ \ \ \ \\ \ \ \ ACGTCATTGGAATTTAACGAAATTTCAAAGGATCATATGGATACATTACATAAAATCATT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TGCAGTAACCTTAAATTGCTTTAAAGTTTCCTAGTATACCTATGTAATGTATTTTAGTAA // / / / // / / / |AjuI | MseI TspEI || | | BinI* MaeII TspEI ApoI || | NdeI ApoI || MboI |BciVI |DpnI BstKTI T S L E F N E I S K D H M D T L H K I I R H W N L T K F Q R I I W I H Y I K S L V I G I * R N F K G S Y G Y I T * N H * ----:----|----:----|----:----|----:----|----:----|----:----| V D N S N L S I E F S * I S V N C L I M Y T M P I * R F K L P D Y P Y M V Y F * R * Q F K V F N * L I M H I C * M F D N Hpy178III* | AloI | |ApoI | |TspEI | || Hpy178III* SetI | || | BslFI | MboII BsiYI* | || | | HgaI | FnuDII* |AloI \ \\ \ \ \ \ \ \\ AATAGCAATATATCGTATTGTCTGGAAATTCAGGAAGAAAGGTTCGCGTCCCCGATACGG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCGTTATATAGCATAACAGACCTTTAAGTCCTTCTTTCCAAGCGCAGGGGCTATGCC / / / / / / // // // VspI | | | | | |HgaI || |BsiYI* MseI | | | | | SetI || AloI | | | | BslFI |FnuDII* | | | Hpy178III* MboII | | TspEI | | ApoI | Hpy178III* AloI N S N I S Y C L E I Q E E R F A S P I R I A I Y R I V W K F R K K G S R P R Y G * Q Y I V L S G N S G R K V R V P D T A ----:----|----:----|----:----|----:----|----:----|----:----| L L L I D Y Q R S I * S S L N A D G I R * Y C Y I T N D P F E P L F T R T G S V I A I Y R I T Q F N L F F P E R G R Y P BceAI BsmAI | BccI SpeI | BseMII | | MaeI |MaeI | |BspCNI \ \ \ \\ \ \\ CATACTCCATCATTTACCCTAGAACAACTAGTCAAGTTATTAGGAACGCATACGGAGACA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GTATGAGGTAGTAAATGGGATCTTGTTGATCAGTTCAATAATCCTTGCGTATGCCTCTGT // / // /// |BccI MaeI |SpeI ||BsmAI BceAI MaeI |BspCNI BseMII H T P S F T L E Q L V K L L G T H T E T I L H H L P * N N * S S Y * E R I R R Q Y S I I Y P R T T S Q V I R N A Y G D N ----:----|----:----|----:----|----:----|----:----|----:----| C V G D N V R S C S T L N N P V C V S V A Y E M M * G L V V L * T I L F A Y P S M S W * K G * F L * D L * * S R M R L C DdeI | CviJI | |TspGWI | || Acc65I | || HgiCI* | || |Csp6I | || ||RsaI | || ||SetI MboII | || ||NlaIV |Hpy178III* | || ||| KpnI Hin4I || Hpy178III* | || ||| | ApoI Hin4I || | Hin4I | || ||| | TspEI HpaII || | Hin4I \ \\ \\\ \ \ \ \\ \ \ ACTGAGCCAAAGGTACCAAAATTTTCTCCGGCAGAAGATATTTTATCAAGAAAGTTCTTG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTCGGTTTCCATGGTTTTAAAAGAGGCCGTCTTCTATAAAATAGTTCTTTCAAGAAC // / / /// / / / / / / || | | ||HgiCI* TspEI HpaII | | | Hpy178III* || | | ||Acc65I Hin4I | | Hin4I || | | |Csp6I Hin4I | | Hin4I || | | NlaIV ApoI | Hpy178III* || | | RsaI MboII || | KpnI || SetI |CviJI TspGWI DdeI T E P K V P K F S P A E D I L S R K F L L S Q R Y Q N F L R Q K I F Y Q E S S * * A K G T K I F S G R R Y F I K K V L E ----:----|----:----|----:----|----:----|----:----|----:----| V S G F T G F N E G A S S I K D L F N K L Q A L P V L I K E P L L Y K I L F T R S L W L Y W F K R R C F I N * * S L E Q MfeI SetI TspEI MnlI EcoRV SetI TspEI \ \ \ \ \ \ AACCTAAAAAAAAATATCCCTCCAATTGAAAAAAGTTTGACTGATATCCTACCTCAAAGA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGATTTTTTTTTATAGGGAGGTTAACTTTTTTCAAACTGACTATAGGATGGAGTTTCT / // / / SetI |MnlI | SetI TspEI EcoRV MfeI N L K K N I P P I E K S L T D I L P Q R T * K K I S L Q L K K V * L I S Y L K E P K K K Y P S N * K K F D * Y P T S K N ----:----|----:----|----:----|----:----|----:----|----:----| F R F F F I G G I S F L K V S I R G * L S G L F F Y G E L Q F F N S Q Y G V E F V * F F I D R W N F F T Q S I D * R L S MnlI | CviRI* | |TspEI | || MwoI | || | HgiCI* | || | | NlaIV | || | | |SduI | || | | |BetI* | || | | |BseSI | || | | ||HpaII CviRI* CviRI* \ \\ \ \ \\\ \ \ ATTGTGCAATTTGGGCACCGGAATATAACAAACATAACTACTTTGCAAACAATCTTGCAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TAACACGTTAAACCCGTGGCCTTATATTGTTTGTATTGATGAAACGTTTGTTAGAACGTT / / / / / / / / // / / | | | | | | | | |BetI* CviRI* CviRI* | | | | | | | | HpaII | | | | | | | HgiCI* | | | | | | NlaIV | | | | | BseSI | | | | | SduI | | | | TspEI | | | MwoI | | CviRI* | TspEI MnlI I V Q F G H R N I T N I T T L Q T I L Q L C N L G T G I * Q T * L L C K Q S C K C A I W A P E Y N K H N Y F A N N L A K ----:----|----:----|----:----|----:----|----:----|----:----| I T C N P C R F I V F M V V K C V I K C F Q A I Q A G S Y L L C L * K A F L R A N H L K P V P I Y C V Y S S Q L C D Q L TspDTI AluI | ApoI Hpy188I CviJI | TspEI | TspDTI | SetI | EcoRI | | TspEI \ \ \ \ \ \ \ AAAAAATACGAGCTGATAATGAAAGATTATAGATTTATGAATTCAGAGTTTAGGGAATTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTATGCTCGACTATTACTTTCTAATATCTAAATACTTAAGTCTCAAATCCCTTAAC / / / // / / | CviJI TspDTI || TspDTI TspEI | AluI |Hpy188I SetI EcoRI TspEI ApoI K K Y E L I M K D Y R F M N S E F R E L K N T S * * * K I I D L * I Q S L G N * K I R A D N E R L * I Y E F R V * G I E ----:----|----:----|----:----|----:----|----:----|----:----| F F Y S S I I F S * L N I F E S N L S N F F I R A S L S L N Y I * S N L T * P I F F V L Q Y H F I I S K H I * L K P F Q MseI VspI |TspEI || MseI || |SwaI || |AhaIII* || || FatI AclI || || BspHI MaeII || || |CviAII MmeI | SetI || || |Hpy178III* |TaqI TaqI | TaiI || || || NlaIII \\ \ \ \ \\ \\ \\ \ AAAGTCGAACTAATCGACAAACGTTGGAATATACTCTTTATTAATTTAAATCATGAACTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCAGCTTGATTAGCTGTTTGCAACCTTATATGAGAAATAATTAAATTTAGTACTTGAT / / / / / / /// / // MmeI TaqI | | MaeII | ||| | |BspHI | | AclI | ||| | |FatI | TaiI | ||| | Hpy178III* | SetI | ||| | CviAII TaqI | ||| NlaIII | ||MseI | |AhaIII* | |SwaI | TspEI VspI MseI K V E L I D K R W N I L F I N L N H E L K S N * S T N V G I Y S L L I * I M N Y S R T N R Q T L E Y T L Y * F K S * T I ----:----|----:----|----:----|----:----|----:----|----:----| F T S S I S L R Q F I S K I L K F * S S S L R V L R C V N S Y V R * * N L D H V F D F * D V F T P I Y E K N I * I M F * SetI | CviRI* AccI TspDTI | | TaqI |BssNAI | Hpy178III* | | | TspEI |Hpy166II \ \ \ \ \ \ \\ TTATACATTCTTGATGAGATAGAAAGGTTGCAGTCGAAATTACTGACAACAAAGTATACC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AATATGTAAGAACTACTCTATCTTTCCAACGTCAGCTTTAATGACTGTTGTTTCATATGG / / / / / / // | Hpy178III* SetI | TaqI TspEI |AccI TspDTI CviRI* Hpy166II BssNAI L Y I L D E I E R L Q S K L L T T K Y T Y T F L M R * K G C S R N Y * Q Q S I P I H S * * D R K V A V E I T D N K V Y Q ----:----|----:----|----:----|----:----|----:----|----:----| N Y M R S S I S L N C D F N S V V F Y V I I C E Q H S L F T A T S I V S L L T Y * V N K I L Y F P Q L R F * Q C C L I G MnlI |CviJI ||AvaI ||XhoI ||SmlI |||TaqI |||BmeT110I ||||Hpy178III* ||||| MwoI ||||| |Hin4I Tsp4CI* ||||| || MfeI | DdeI EcoRV ||||| || TspEI | |Hin4I \ \\\\\ \\ \ \ \\ AAAGATATCACTATAAGGCTCGAGAGGCAATTGGAGAGAAAATCAAAAACTGTTTCTAAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTATAGTGATATTCCGAGCTCTCCGTTAACCTCTCTTTTAGTTTTTGACAAAGATTC / / / //// / / / / EcoRV | | |||| TspEI | Hin4I DdeI | | |||| MfeI Tsp4CI* | | |||Hpy178III* | | |||SmlI | | |||XhoI | | |||AvaI | | ||BmeT110I | | ||TaqI | | |MwoI | | Hin4I | CviJI MnlI K D I T I R L E R Q L E R K S K T V S K K I S L * G S R G N W R E N Q K L F L R R Y H Y K A R E A I G E K I K N C F * D ----:----|----:----|----:----|----:----|----:----|----:----| L S I V I L S S L C N S L F D F V T E L W L Y * * L A R S A I P S F I L F Q K * F I D S Y P E L P L Q L S F * F S N R L Cac8I |DrdI ||AcyI ||| MwoI ||| HgaI ||| | Hpy99I ApoI ||| | | BdaI TspEI ||| | | BdaI SspI EcoRI HgaI ||| | | TaqI \ \ \ \\\ \ \ \ ACATTCAATATTATTTACAGAGCATTGGAATTCTCACTTTTGGACGCTGGCGTCGCATCG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAAGTTATAATAAATGTCTCGTAACCTTAAGAGTGAAAACCTGCGACCGCAGCGTAGC / / / //// / // / SspI EcoRI | |||| | || TaqI TspEI | |||| | |HgaI ApoI | |||| | BdaI | |||| | BdaI | |||| AcyI | |||Hpy99I | ||MwoI | |Cac8I | DrdI HgaI T F N I I Y R A L E F S L L D A G V A S H S I L F T E H W N S H F W T L A S H R I Q Y Y L Q S I G I L T F G R W R R I E ----:----|----:----|----:----|----:----|----:----|----:----| V N L I I * L A N S N E S K S A P T A D S M * Y * K C L M P I R V K P R Q R R M C E I N N V S C Q F E * K Q V S A D C R SfaNI | BbvII* | | TspEI CviJI | | | MboII | SfeI* | | | | AluI TspDTI | | AciI | | | | CviJI | CviJI | | NspBII* | | | | |BccI | | BdaI | | | ApoI | | | | ||SetI | | BdaI | | | TspEI \ \ \ \ \\\ \ \ \ \ \ \ \ AAGACAAATGAATTAGCTCAAAGATGGCTGAATATCAAGCCTACAGCGGATAAAATTCTA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTGTTTACTTAATCGAGTTTCTACCGACTTATAGTTCGGATGTCGCCTATTTTAAGAT / / / / / / / / / // / / | | | | | | | BdaI CviJI || AciI TspEI | | | | | | | BdaI |NspBII* ApoI | | | | | | CviJI SfeI* | | | | | TspDTI | | | | BccI | | | CviJI | | | AluI | | TspEI | | SetI | BbvII* | MboII SfaNI K T N E L A Q R W L N I K P T A D K I L R Q M N * L K D G * I S S L Q R I K F * D K * I S S K M A E Y Q A Y S G * N S N ----:----|----:----|----:----|----:----|----:----|----:----| F V F S N A * L H S F I L G V A S L I R S S L H I L E F I A S Y * A * L P Y F E L C I F * S L S P Q I D L R C R I F N * AluI CviJI | SetI TfiI MboII AciI MnlI | | MaeI HinfI | MboII \ \ \ \ \ \ \ \ ATCAAATCCTCCGCTTCAAACAAAATAGCTACTAGCAAGAAGAAGATTCCAAAACCGAAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTTAGGAGGCGAAGTTTGTTTTATCGATGATCGTTCTTCTTCTAAGGTTTTGGCTTT / / / / / / / / | MnlI | CviJI MaeI | | MboII AciI | AluI | MboII SetI HinfI TfiI I K S S A S N K I A T S K K K I P K P K S N P P L Q T K * L L A R R R F Q N R N Q I L R F K Q N S Y * Q E E D S K T E I ----:----|----:----|----:----|----:----|----:----|----:----| I L D E A E F L I A V L L F F I G F G F L * I R R K L C F L * * C S S S E L V S D F G G S * V F Y S S A L L L N W F R F BssKI PfoI SecI* BssKI EcoRII EcoRII | ScrFI | ScrFI CviJI McrI* TaqII | BseBI | BseBI \ \ \ \ \ \ \ TCATTAGGCTTTGGGCGACCGAATAGTGTTATTGGAACTATAACCCAGGATTTCCAGGAG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAATCCGAAACCCGCTGGCTTATCACAATAACCTTGATATTGGGTCCTAAAGGTCCTC / / / /// / / CviJI McrI* TaqII ||EcoRII | EcoRII ||BssKI | BssKI |SecI* | PfoI BseBI BseBI ScrFI ScrFI S L G F G R P N S V I G T I T Q D F Q E H * A L G D R I V L L E L * P R I S R R I R L W A T E * C Y W N Y N P G F P G E ----:----|----:----|----:----|----:----|----:----|----:----| D N P K P R G F L T I P V I V W S K W S I M L S Q A V S Y H * Q F * L G P N G P * * A K P S R I T N N S S Y G L I E L L MaeIII Tsp45I | SetI | | Tsp4CI* | | | TspDTI | | | | HphI PleI | | | | | CspCI Hin4II* | | | | | |BetI* SfeI* |MseI | | | | | ||HpaII | Tsp4CI* |VspI | | | | | ||| ApoI | | CviJI HinfI |MlyI | | | | | ||| TspEI | | |TspRI \ \\ \ \ \ \ \ \\\ \ \ \ \\ AGAGTCGCCATTAATGAAGGTGACAGTAATAAAACACCGGAAAATTCAACTACAGTGGCT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCAGCGGTAATTACTTCCACTGTCATTATTTTGTGGCCTTTTAAGTTGATGTCACCGA / / / / / / / / / // / / // / | | | | SetI | | | CspCI |BetI* | | || CviJI | | | VspI | | HphI HpaII | | |SfeI* | | | MseI | TspDTI | | Tsp4CI* | | PleI Tsp4CI* | TspRI | | MlyI Tsp45I TspEI | Hin4II* MaeIII ApoI HinfI R V A I N E G D S N K T P E N S T T V A E S P L M K V T V I K H R K I Q L Q W L S R H * * R * Q * * N T G K F N Y S G F ----:----|----:----|----:----|----:----|----:----|----:----| L T A M L S P S L L L V G S F E V V T A S L R W * H L H C Y Y F V P F N L * L P S D G N I F T V T I F C R F I * S C H S SetI |CspCI SetI || HindIII MaeIII |CviRI* || | AluI | SfeI* SspI |TspDTI || | CviJI | | CviRI* | MseI || TspDTI || | | SetI | | | PstI | |MboII || |BspMI \\ \ \ \ \ \ \ \ \ \\ \\ \\ TTGAAAGGTAAAAAGCTTGGTAAAGCGTTACTGCAGAAGATGAATATTAAACCTGCAACA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTTCCATTTTTCGAACCATTTCGCAATGACGTCTTCTACTTATAATTTGGACGTTGT / / / / / / / / / / // / / / | | | | HindIII | | SfeI* | | || | | TspDTI | | | CviJI | CviRI* | | || | CviRI* | | | AluI MaeIII | | || TspDTI | | SetI PstI | | |SetI | CspCI | | MseI SetI | MboII SspI L K G K K L G K A L L Q K M N I K P A T * K V K S L V K R Y C R R * I L N L Q Q E R * K A W * S V T A E D E Y * T C N K ----:----|----:----|----:----|----:----|----:----|----:----| K F P L F S P L A N S C F I F I L G A V K S L Y F A Q Y L T V A S S S Y * V Q L Q F T F L K T F R * Q L L H I N F R C C Hin4I Hin4I | BinI* | | MboI | | | DpnI | | | |BetI* | | | |BstKTI PleI | | | |BspMII* |MlyI CviJI | | | ||HpaII || BsiYI* | ApoI MseI | | | ||Hpy178III* || | Hin4I | TspEI VspI | | | ||| HinfI || | Hin4I \ \ \ \ \ \ \\\ \ \\ \ \ AGCCCAAATTCATCAAATGCGATTAATCCATTTTTTGATCCGGAGTCGCCAAACAAAGGA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TCGGGTTTAAGTAGTTTACGCTAATTAGGTAAAAAACTAGGCCTCAGCGGTTTGTTTCCT / / / / / / // / // / / / | BspMI TspEI | VspI | || | || HinfI | Hin4I CviJI ApoI | MseI | || | |BspMII* | Hin4I Hin4I | || | |BetI* BsiYI* Hin4I | || | | PleI | || | | MlyI | || | Hpy178III* | || | HpaII | || MboI | |DpnI | BstKTI BinI* S P N S S N A I N P F F D P E S P N K G A Q I H Q M R L I H F L I R S R Q T K E P K F I K C D * S I F * S G V A K Q R K ----:----|----:----|----:----|----:----|----:----|----:----| L G F E D F A I L G N K S G S D G F L P L G L N M L H S * D M K Q D P T A L C L A W I * * I R N I W K K I R L R W V F S MnlI DdeI |SetI TspGWI \ \\ \ AAACTGATACTAAGTAGTGTTCCTCCCTTACCTTATGACGAAACCGATGAAACCACCCTC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGACTATGATTCATCACAAGGAGGGAATGGAATACTGCTTTGGCTACTTTGGTGGGAG / / / / / DdeI | MnlI TspGWI TspDTI SetI K L I L S S V P P L P Y D E T D E T T L N * Y * V V F L P Y L M T K P M K P P S T D T K * C S S L T L * R N R * N H P P ----:----|----:----|----:----|----:----|----:----|----:----| F S I S L L T G G K G * S S V S S V V R F V S V L Y H E E R V K H R F R H F W G F Q Y * T T N R G * R I V F G I F G G E MaeIII Tsp45I | MlyI | PleI | | TspDTI Hin4II* TspDTI | | NmeAIII | FatI | MnlI | | | HinfI | |CviAII | |BsiI* HphI | | | |TspDTI | || NlaIII \ \\ \ \ \ \ \\ \ \\ \ CGTGTTTCTCGTGGGGAAAATGAAAAGTCACCAGACTCCTTCATTACATCTCGGCATGAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GCACAAAGAGCACCCCTTTTACTTTTCAGTGGTCTGAGGAAGTAATGTAGAGCCGTACTT / / / // / / / / / // MnlI BsiI* HphI || | | HinfI | | |FatI || | TspDTI | | CviAII || Tsp45I | NlaIII || MaeIII Hin4II* |PleI NmeAIII TspDTI MlyI R V S R G E N E K S P D S F I T S R H E V F L V G K M K S H Q T P S L H L G M K C F S W G K * K V T R L L H Y I S A * K ----:----|----:----|----:----|----:----|----:----|----:----| R T E R P S F S F D G S E K M V D R C S G H K E H P F H F T V L S R * * M E A H T N R T P F I F L * W V G E N C R P M F TatI BsaXI |Csp6I ||RsaI ||| TspDTI BccI BsaXI TaqI \\\ \ \ \ \ AATAAAGTACAGATTACAGAAACTCCTTTGATGGCAAAGAATAAGTCTGTGCTTGACATC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTCATGTCTAATGTCTTTGAGGAAACTACCGTTTCTTATTCAGACACGAACTGTAG / /// / / | ||TatI BccI BsaXI | |TspDTI | |Csp6I | RsaI BsaXI N K V Q I T E T P L M A K N K S V L D I I K Y R L Q K L L * W Q R I S L C L T S * S T D Y R N S F D G K E * V C A * H R ----:----|----:----|----:----|----:----|----:----|----:----| F L T C I V S V G K I A F F L D T S S M F Y L V S * L F E K S P L S Y T Q A Q C I F Y L N C F S R Q H C L I L R H K V D BinI* | MaeI | | MboI AgeI | | BamHI BetI* | | XhoII Cfr10I | | | DpnI |HpaII | | | NlaIV || AsuI* | | | |BstKTI TfiI || AvaII | | | ||MnlI HinfI || |BmgT120I | | | ||| BinI* \ \\ \\ \ \ \ \\\ \ GAAAAAGATAAATGGAATCATTACCGGTCCTTGCCCTCTAGGATCCCTATATACAAGGAT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTTCTATTTACCTTAGTAATGGCCAGGAACGGGAGATCCTAGGGATATATGTTCCTA / / //// / / //// / TaqI HinfI |||AvaII | | |||| BinI* TfiI |||AsuI* | | |||XhoII ||BmgT120I | | |||BamHI |Cfr10I | | |||MboI |BetI* | | ||MnlI |AgeI | | |NlaIV HpaII | | |DpnI | | BstKTI | MaeI BinI* E K D K W N H Y R S L P S R I P I Y K D K K I N G I I T G P C P L G S L Y T R I K R * M E S L P V L A L * D P Y I Q G * ----:----|----:----|----:----|----:----|----:----|----:----| S F S L H F * * R D K G E L I G I Y L S R F L Y I S D N G T R A R * S G * I C P F F I F P I M V P G Q G R P D R Y V L I EciI SetI |MlyI MaeIII |PleI Tsp45I || Hpy178III* | HphI || | HinfI HphI | Tsp4CI* || | | AciI \ \ \ \\ \ \ \ AAAGTGGTGAAAGTCACCGTAGAAAACACACCGATAGCAAAGGTTTTCCAGACTCCGCCA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCACCACTTTCAGTGGCATCTTTTGTGTGGCTATCGTTTCCAAAAGGTCTGAGGCGGT / / / / // / / / HphI Tsp4CI* | | || | | AciI Tsp45I | | || | HinfI MaeIII | | || Hpy178III* HphI | | |PleI | | MlyI | EciI SetI K V V K V T V E N T P I A K V F Q T P P K W * K S P * K T H R * Q R F S R L R Q S G E S H R R K H T D S K G F P D S A N ----:----|----:----|----:----|----:----|----:----|----:----| L T T F T V T S F V G I A F T K W V G G Y L P S L * R L F C V S L L P K G S E A F H H F D G Y F V C R Y C L N E L S R W AsuI* AvaII DraII PpuMI SanDI |NlaIV Hpy178III* |BmgT120I | SetI ||NlaIV MnlI | |BslFI ||| TaqI Hin4II* | MboII \ \\ \\\ \ \ \ \ ACAAAAATCACGACACCTAATAGTCAAGTTTGGGTCCCTTCGACAAGAAGAAGAACCCGA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTTTAGTGCTGTGGATTATCAGTTCAAACCCAGGGAAGCTGTTCTTCTTCTTGGGCT / / / /// / / / // | SetI BslFI ||SanDI | Hin4II* | |BsiYI* Hpy178III* ||PpuMI TaqI | MboII ||DraII MnlI ||AvaII ||AsuI* |BmgT120I |NlaIV NlaIV T K I T T P N S Q V W V P S T R R R T R Q K S R H L I V K F G S L R Q E E E P D K N H D T * * S S L G P F D K K K N P I ----:----|----:----|----:----|----:----|----:----|----:----| V F I V V G L L * T Q T G E V L L L V R L L F * S V * Y D L K P G K S L F F F G C F D R C R I T L N P D R R C S S S G S MboII BsiYI* | StuI HphI | CviJI MaeIII Hin4II* | HaeIII MnlI Tsp4CI* | BsiYI* \ \ \ \ \ \ TTGAGGCCTCCCACCCCCTTATCACAGTTACTTTCACCAAGAGAAGGGCGTTTAGATAAA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AACTCCGGAGGGTGGGGGAATAGTGTCAATGAAAGTGGTTCTCTTCCCGCAAATCTATTT / / / / / / / | HaeIII MnlI | | | BsiYI* | CviJI | | Hin4II* | StuI | MaeIII MboII Tsp4CI* HphI L R P P T P L S Q L L S P R E G R L D K * G L P P P Y H S Y F H Q E K G V * I K E A S H P L I T V T F T K R R A F R * N ----:----|----:----|----:----|----:----|----:----|----:----| N L G G V G K D C N S E G L S P R K S L I S A E W G R I V T V K V L L L A N L Y Q P R G G G * * L * K * W S F P T * I F ACCCCAACTTATTGA 1930 ----:----|----: TGGGGTTGAATAACT T P T Y * P Q L I X P N L L X ----:----|----: V G V * Q F G L K N G W S I S # Enzymes that cut Frequency Isoschizomers AatII 1 Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 3 BspACI,SsiI AclI 3 Psp1406I AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AjuI 1 AloI 1 AluI 4 AluBI ApoI 11 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BamHI 1 BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 4 BceAI 1 BciVI 2 BfuI BdaI 2 BetI* 4 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 4 AlwI,BspPI,AclWI BmeT110I 1 BmgT120I 3 BsaXI 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 2 BseSI 1 BaeGI,BstSLI BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BspCNI 2 BspHI 1 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 2 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 5 Cac8I 1 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 3 CviQI,RsaNI CspCI 1 CviAII 3 CviJI 15 CviKI-1 CviRI* 7 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 5 MalI DraII 1 EcoO109I DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI EciI 1 EcoRI 4 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 2 Eco32I FatI 3 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I Hin4I 7 Hin4II* 7 HpyAV HindII 1 HincII HindIII 1 HinfI 8 HpaII 5 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 13 Hpy188III Hpy188I 2 Hpy99I 1 KpnI 1 MaeI 5 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 6 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 9 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 2 MunI MlyI 5 SchI MmeI 3 MnlI 12 MseI 8 Tru1I,Tru9I MwoI 3 HpyF10VI,BstMWI NcoI 1 Bsp19I NdeI 1 FauNDI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 7 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 1 MspA1I PfoI 1 PleI 5 PpsI PpiI 1 PpuMI 1 Psp5II,PspPPI PstI 1 RsaI 3 AfaI SanDI 1 ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 22 SfaNI 1 LweI SfeI* 3 BstSFI,SfcI,BfmI SmlI 1 SmoI SpeI 1 BcuI,AhlI SspI 3 StuI 1 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 6 TaqI 9 TaqII 1 TatI 1 TfiI 3 PfeI TsoI 1 Tsp45I 4 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 13 TspEI 24 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 4 PshBI,AseI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI AflII AflIII AlfI AlwNI ApaI ApaLI AscI AsuII AvrII BaeI BalI BarI BbvCI BbvI Bce83I* BcgI BclI BglI BisI BlsI BmtI BplI Bpu10I BsaAI BsaBI BsePI BseRI BseYI BsgI BsmI Bsp120I Bsp1407I BspLU11I* BspOI BsrBI BsrDI BstAPI BstEII BstXI BtgZI BtrI BtsI CauII* Cfr9I CfrI DinI DraIII Eam1105I Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoT22I EgeI EheI Esp3I EspI* FalI FauI Fnu4HI FseI FspAI GlaI GsaI GsuI HaeII HgiAI* HgiJII* HhaI Hin6I HinP1I HpaI HspAI KasI Ksp632I* MauBI MluI Mph1103I MroNI MslI MstI* NaeI NarI NgoMIV NheI NotI NruI NsiI NspI OliI PacI PasI PflMI PmaCI PmeI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I TauI TseI TspMI TstI XbaI XcmI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769