Restriction Map of BMS1/YPL217C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

BMS1/YPL217C on chromosome XVI from coordinates 143171 to 139620.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.24272

EMBOSS_001 Tsp4CI* AluI | Hin4II* MboII CviJI \ \ \ \ ATGGAGCAGTCTAATAAACAGCACCGTAAGGCGAAGGAGAAGAATACAGCAAAAAAGAAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTCGTCAGATTATTTGTCGTGGCATTCCGCTTCCTCTTCTTATGTCGTTTTTTCTTC / / / / / | Hin4II* MboII | CviJI Tsp4CI* | AluI SetI M E Q S N K Q H R K A K E K N T A K K K W S S L I N S T V R R R R R I Q Q K R S G A V * * T A P * G E G E E Y S K K E A ----:----|----:----|----:----|----:----|----:----|----:----| X S C D L L C C R L A F S F F V A F F F X P A T * Y V A G Y P S P S S Y L L F S H L L R I F L V T L R L L L I C C F L L SecI* DsaI* | TseI | MwoI | |BisI | ||BlsI | |||CviJI | |||| BssKI | |||| SecI* | |||| EcoRII | |||| | ScrFI BceAI | |||| | BseBI | CviRI* | |||| | |BcgI SetI | | StuI | |||| | |BccI | MwoI | | CviJI | |||| | || SetI | | BsiYI* | | HaeIII | |||| | || |BbvI \ \ \ \ \ \ \ \\\\ \ \\ \\ CTCCATACGCAGGGTCATAATGCAAAGGCCTTTGCCGTGGCAGCCCCAGGTAAGATGGCG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GAGGTATGCGTCCCAGTATTACGTTTCCGGAAACGGCACCGTCGGGGTCCATTCTACCGC / / // / / / /// ///// / | BsiYI* || HaeIII | | ||| ||||| BbvI MwoI || CviJI | | ||| ||||EcoRII || StuI | | ||| ||||BssKI |CviRI* | | ||| |||SecI* BceAI | | ||| |||BccI | | ||| ||BseBI | | ||| ||ScrFI | | ||| |SetI | | ||| BcgI | | ||CviJI | | ||TseI | | |BisI | | BlsI | DsaI* | SecI* MwoI L H T Q G H N A K A F A V A A P G K M A S I R R V I M Q R P L P W Q P Q V R W R P Y A G S * C K G L C R G S P R * D G E ----:----|----:----|----:----|----:----|----:----|----:----| S W V C P * L A F A K A T A A G P L I A A G Y A P D Y H L P R Q R P L G L Y S P E M R L T M I C L G K G H C G W T L H R FatI CviRI* |CviAII MboI || NspI | DpnI CviRI* SetI BcgI Hpy166II || NlaIII | |BstKTI \ \ \ \ \\ \ \ \\ AGAACTATGCAAAGGTCAAGTGATGTGAACGAAAGAAAACTGCATGTTCCTATGGTTGAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTGATACGTTTCCAGTTCACTACACTTGCTTTCTTTTGACGTACAAGGATACCAACTA / / / / / // // | SetI BcgI Hpy166II | |FatI |DpnI CviRI* | CviAII BstKTI CviRI* NlaIII NspI R T M Q R S S D V N E R K L H V P M V D E L C K G Q V M * T K E N C M F L W L I N Y A K V K * C E R K K T A C S Y G * S ----:----|----:----|----:----|----:----|----:----|----:----| L V I C L D L S T F S L F S C T G I T S S F * A F T L H H S R F F V A H E * P Q S S H L P * T I H V F S F Q M N R H N I AsuI* AvaII |NlaIV |BmgT120I || Hpy166II EciI || | BssKI | BinI* || | EcoRII | | MboI || | | ScrFI | | | DpnI || | | BseBI | | | |BstKTI Eco57I || | | |SetI Csp6I | | | ||AciI Eco57MI || | | || EcoNI |RsaI | | | ||| MboII | MnlI Hpy99I || | | || | BsiYI* \\ \ \ \ \\\ \ \ \ \ \\ \ \ \\ \ \ CGTACCCCTGAAGATGATCCGCCTCCATTTATCGTCGCTGTCGTGGGTCCACCTGGAACA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GCATGGGGACTTCTACTAGGCGGAGGTAAATAGCAGCGACAGCACCCAGGTGGACCTTGT / // / / // / / / // //// //// | || EciI | || | MboII | |Hpy99I |||| |||EcoNI | |Csp6I | || | AciI | MnlI |||| ||EcoRII | RsaI | || MboI Eco57MI |||| ||BssKI MboI | |DpnI Eco57I |||| |BsiYI* | BstKTI |||| BseBI BinI* |||| ScrFI |||SetI ||Hpy166II ||AvaII ||AsuI* |BmgT120I NlaIV R T P E D D P P P F I V A V V G P P G T V P L K M I R L H L S S L S W V H L E Q Y P * R * S A S I Y R R C R G S T W N R ----:----|----:----|----:----|----:----|----:----|----:----| R V G S S S G G G N I T A T T P G G P V D Y G Q L H D A E M * R R Q R P D V Q F T G R F I I R R W K D D S D H T W R S C TfiI HinfI | AsuI* | AvaII | |BmgT120I | || BsiYI* BslFI | || |Hpy178III* | TaqII | ||NlaIV || MnlI \ \ \ \\\ \\ \ GGAAAGACTACTTTGATTCGGTCCCTCGTCAGGAGAATGACAAAAAGCACTTTGAATGAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTTCTGATGAAACTAAGCCAGGGAGCAGTCCTCTTACTGTTTTTCGTGAAACTTACTA / / / // / // | BslFI | || | |MnlI TaqII | || | Hpy178III* | || BsiYI* | |AvaII | |AsuI* | BmgT120I | NlaIV HinfI TfiI G K T T L I R S L V R R M T K S T L N D E R L L * F G P S S G E * Q K A L * M I K D Y F D S V P R Q E N D K K H F E * Y ----:----|----:----|----:----|----:----|----:----|----:----| P F V V K I R D R T L L I V F L V K F S L F S * K S E T G R * S F S L F C K S H S L S S Q N P G E D P S H C F A S Q I I AsuI* AvaII DraII BsmAI PpuMI | FalI |BmgT120I | FalI BbvII* ||SetI Tsp4CI* | |Hpy166II | MboII BcgI \\\ \ \ \\ \ \ \ ATTCAAGGTCCTATTACTGTTGTCTCTGGTAAACATAGAAGACTAACTTTTTTGGAGTGC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTTCCAGGATAATGACAACAGAGACCATTTGTATCTTCTGATTGAAAAAACCTCACG / // / / / / // | |PpuMI Tsp4CI* FalI Hpy166II BbvII* |BseSI | |DraII FalI BsmAI MboII |FalI | |AvaII |FalI | |AsuI* |SduI | BmgT120I BcgI SetI I Q G P I T V V S G K H R R L T F L E C F K V L L L L S L V N I E D * L F W S A S R S Y Y C C L W * T * K T N F F G V P ----:----|----:----|----:----|----:----|----:----|----:----| I * P G I V T T E P L C L L S V K K S H Y E L D * * Q Q R Q Y V Y F V L K K P T N L T R N S N D R T F M S S * S K Q L A SduI MboI BseSI | DpnI |FalI | |BstKTI BcgI |FalI | || Hpy188I | BtgZI || AciI | || | BsmI | |DdeI MwoI \\ \ \ \\ \ \ \ \\ \ CCTGCGGACGATCTGAATGCGATGATTGATATTGCTAAGATTGCCGACTTGGTTCTTTTA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GGACGCCTGCTAGACTTACGCTACTAACTATAACGATTCTAACGGCTGAACCAAGAAAAT / // / / / // | || | BsmI BcgI |BtgZI | || Hpy188I |DdeI | || MboI MwoI | |DpnI | BstKTI AciI P A D D L N A M I D I A K I A D L V L L L R T I * M R * L I L L R L P T W F F Y C G R S E C D D * Y C * D C R L G S F T ----:----|----:----|----:----|----:----|----:----|----:----| G A S S R F A I I S I A L I A S K T R K G Q P R D S H S S Q Y Q * S Q R S P E K R R V I Q I R H N I N S L N G V Q N K * ApoI Tsp4CI* TspEI TspEI | TspEI EcoRI MseI SspI \ \ \ \ \ \ CTAATTGACGGTAATTTCGGTTTTGAAATGGAAACAATGGAATTCTTAAATATTGCTCAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GATTAACTGCCATTAAAGCCAAAACTTTACCTTTGTTACCTTAAGAATTTATAACGAGTT / / / / / / | | TspEI | | SspI | Tsp4CI* | MseI TspEI EcoRI TspEI ApoI L I D G N F G F E M E T M E F L N I A Q * L T V I S V L K W K Q W N S * I L L N N * R * F R F * N G N N G I L K Y C S T ----:----|----:----|----:----|----:----|----:----|----:----| S I S P L K P K S I S V I S N K F I A * V L Q R Y N R N Q F P F L P I R L Y Q E * N V T I E T K F H F C H F E * I N S L Hpy178III* | MboI | | DpnI TatI | | |BstKTI |Csp6I AluI | | || MseI ||RsaI CviJI | | || |AhaIII* Tsp4CI* ||ScaI | SetI | | || || DdeI \ \\\ \ \ \ \ \\ \\ \ CATCACGGTATGCCAAGAGTACTTGGTGTAGCTACACATCTTGATCTGTTTAAATCTCAG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GTAGTGCCATACGGTTCTCATGAACCACATCGATGTGTAGAACTAGACAAATTTAGAGTC / /// / / /// / // / Tsp4CI* ||TatI | CviJI ||| MboI |MseI DdeI |Csp6I | AluI ||DpnI AhaIII* ScaI SetI |BstKTI RsaI Hpy178III* H H G M P R V L G V A T H L D L F K S Q I T V C Q E Y L V * L H I L I C L N L S S R Y A K S T W C S Y T S * S V * I S V ----:----|----:----|----:----|----:----|----:----|----:----| C * P I G L T S P T A V C R S R N L D * V D R Y A L L V Q H L * V D Q D T * I E M V T H W S Y K T Y S C M K I Q K F R L HindII Hpy166II | BspCNI | |BseMII | || AluI TfiI | || CviJI HinfI | || | SetI | AlwNI | || | | DdeI MseI | |Hpy178III* \ \\ \ \ \ \ \ \\ TCAACTTTGAGAGCTTCTAAGAAAAGATTAAAGCACAGATTCTGGACGGAAGTTTATCAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTGAAACTCTCGAAGATTCTTTTCTAATTTCGTGTCTAAGACCTGCCTTCAAATAGTT / // / / / / / / / / | || | CviJI DdeI MseI | | Hpy178III* TspGWI | || | AluI | HinfI SetI | || SetI | TfiI | |BseMII AlwNI | BspCNI Hpy166II HindII S T L R A S K K R L K H R F W T E V Y Q Q L * E L L R K D * S T D S G R K F I K N F E S F * E K I K A Q I L D G S L S R ----:----|----:----|----:----|----:----|----:----|----:----| D V K L A E L F L N F C L N Q V S T * * T L K S L K * S F I L A C I R S P L K D * S Q S S R L F S * L V S E P R F N I L TspGWI | SetI MseI SetI | |CviRI* VspI | Hpy178III* | || TspEI SetI Hin4II* | | BciVI \ \\ \ \ \ \ \ \ GGTGCAAAATTATTTTACCTATCTGGTGTGATTAATGGAAGGTATCCTGATAGAGAGATT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CCACGTTTTAATAAAATGGATAGACCACACTAATTACCTTCCATAGGACTATCTCTCTAA / / / / / / / / CviRI* | SetI | VspI SetI | BciVI TspEI | MseI Hpy178III* Hin4II* G A K L F Y L S G V I N G R Y P D R E I V Q N Y F T Y L V * L M E G I L I E R F C K I I L P I W C D * W K V S * * R D F ----:----|----:----|----:----|----:----|----:----|----:----| P A F N N * R D P T I L P L Y G S L S I L H L I I K G I Q H S * H F T D Q Y L S T C F * K V * R T H N I S P I R I S L N Hpy188I | MseI MseI | TspDTI |AhaIII* | |MnlI || SetI | ||MslI || | Hpy178III* ApoI | ||| FokI || | | BsaBI TspEI | ||| BstXI BseGI \\ \ \ \ \ \ \\\ \ \ TTAAACCTTTCACGATTTATATCTGTTATGAAATTCAGACCATTAAAATGGAGGAACGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTGGAAAGTGCTAAATATAGACAATACTTTAAGTCTGGTAATTTTACCTCCTTGCTT /// / / // / / / / / ||SetI | BsaBI || | | MslI FokI BseGI |MseI Hpy178III* || | | MseI AhaIII* || | BstXI || | MnlI || TspDTI |Hpy188I TspEI ApoI L N L S R F I S V M K F R P L K W R N E * T F H D L Y L L * N S D H * N G G T N K P F T I Y I C Y E I Q T I K M E E R T ----:----|----:----|----:----|----:----|----:----|----:----| K F R E R N I D T I F N L G N F H L F S K L G K V I * I Q * S I * V M L I S S R * V K * S K Y R N H F E S W * F P P V F BseGI | BetI* | BspMII* | |HpaII | |Hpy178III* | ||Bce83I* | ||| TspEI | ||| | MseI | ||| | VspI Hin4I TfiI | ||| | BsmAI Hin4I HinfI | ||| | | MlyI |HinfI CviJI | FokI MseI | ||| | | PleI || SmlI \ \ \ \ \ \\\ \ \ \ \\ \ CATCCCTATATGTTGGCTGACAGATTCACAGATTTAACTCATCCGGAATTAATAGAGACT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GTAGGGATATACAACCGACTGTCTAAGTGTCTAAATTGAGTAGGCCTTAATTATCTCTGA / / / // / // //// / CviJI | FokI || | || |||BsmAI HinfI HinfI || | || ||PleI TfiI || | || |Hin4I || | || |Hin4I || | || |VspI || | || |MseI || | || |MlyI || | || TspEI || | |BspMII* || | |BetI* || | Hpy178III* || | HpaII || Bce83I* |BseGI MseI H P Y M L A D R F T D L T H P E L I E T I P I C W L T D S Q I * L I R N * * R L S L Y V G * Q I H R F N S S G I N R D S ----:----|----:----|----:----|----:----|----:----|----:----| C G * I N A S L N V S K V * G S N I S V V D R Y T P Q C I * L N L E D P I L L S M G I H Q S V S E C I * S M R F * Y L S CviRI* | TaqI | | AciI | | McrI* | | | DrdI CviRI* | | | | TsoI | Tsp4CI* | | | | | Hin4I | |Csp6I | | | | | Hin4I | ||RsaI \ \ \ \ \ \ \ \\\ CAAGGACTGCAAATCGACCGCAAAGTCGCTATCTATGGTTATTTGCACGGTACTCCTTTG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCCTGACGTTTAGCTGGCGTTTCAGCGATAGATACCAATAAACGTGCCATGAGGAAAC / / / / // / / // SmlI CviRI* | | |TsoI | | |Csp6I | | Hin4I | | RsaI | | Hin4I | Tsp4CI* | DrdI CviRI* | AciI McrI* TaqI Q G L Q I D R K V A I Y G Y L H G T P L K D C K S T A K S L S M V I C T V L L C R T A N R P Q S R Y L W L F A R Y S F A ----:----|----:----|----:----|----:----|----:----|----:----| * P S C I S R L T A I * P * K C P V G K E L V A F R G C L R * R H N N A R Y E K L S Q L D V A F D S D I T I Q V T S R Q BssKI |HpaII ||ScrFI ||CauII* ||Hin4II* ||| SduI ||| BseSI ||| |MaeI AlfI ||| || OliI AlfI DdeI AlfI ||| || MslI CviRI* AlfI | HphI TspEI \ \\\ \\ \ \ \ \ \ \ CCTTCTGCTCCGGGCACTAGGGTGCATATTGCTGGTGTTGGTGATTTCTCAGTAGCACAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAGACGAGGCCCGTGATCCCACGTATAACGACCACAACCACTAAAGAGTCATCGTGTT / / / / / / / / // AlfI | | | MslI CviRI* AlfI HphI |BseMII AlfI | | | OliI AlfI DdeI BspCNI | | | MaeI | | BssKI | CauII* | HpaII | ScrFI | BseSI | SduI Hin4II* P S A P G T R V H I A G V G D F S V A Q L L L R A L G C I L L V L V I S Q * H K F C S G H * G A Y C W C W * F L S S T N ----:----|----:----|----:----|----:----|----:----|----:----| G E A G P V L T C I A P T P S K E T A C A K Q E P C * P A Y Q Q H Q H N R L L V R R S R A S P H M N S T N T I E * Y C L BspCNI |BseMII || TspEI || |BslFI || || BinI* || || | MboI || || | XhoII || || | | DpnI || || | | |BstKTI || || | | ||FatI AlwNI || || | | |||CviAII | BsrI || || | | |||| NlaIII SetI | | BseGI \\ \\ \ \ \\\\ \ \ \ \ \ ATTGAAAAATTACCAGATCCATGTCCCACACCTTTTTACCAACAGAAACTGGATGATTTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTTTTTAATGGTCTAGGTACAGGGTGTGGAAAAATGGTTGTCTTTGACCTACTAAAA / // // / // / / / / TspEI || || | |FatI SetI AlwNI | BseGI || || | CviAII BsrI || || NlaIII || || XhoII || || MboI || |DpnI || BstKTI |BslFI TspEI BinI* I E K L P D P C P T P F Y Q Q K L D D F L K N Y Q I H V P H L F T N R N W M I L * K I T R S M S H T F L P T E T G * F * ----:----|----:----|----:----|----:----|----:----|----:----| I S F N G S G H G V G K * W C F S S S K F Q F I V L D M D W V K K G V S V P H N N F F * W I W T G C R K V L L F Q I I K MaeII |FokI TspDTI || SetI Ksp632I* | CviJI || TaiI |MnlI | MboII TspEI TspGWI \\ \ \\ \ \ \ \ GAACGTGAAAAAATGAAAGAAGAGGCAAAGGCTAACGGAGAAATTACAACTGCCTCTACG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGCACTTTTTTACTTTCTTCTCCGTTTCCGATTGCCTCTTTAATGTTGACGGAGATGC / / / / / / // / / | | FokI | Ksp632I* | |CviJI | TspGWI | MaeII MnlI | MboII TspEI TaiI TspDTI SetI E R E K M K E E A K A N G E I T T A S T N V K K * K K R Q R L T E K L Q L P L R T * K N E R R G K G * R R N Y N C L Y D ----:----|----:----|----:----|----:----|----:----|----:----| S R S F I F S S A F A L P S I V V A E V Q V H F F S L L P L P * R L F * L Q R * F T F F H F F L C L S V S F N C S G R R MaeII | SetI | TaiI | BbvII* | | MboII Hin4I Hpy188I MnlI | | | SetI | TspEI MmeI |MnlI \ \ \ \ \ \ \ \ \\ ACAAGAAGACGTAAAAGGTTAGATGATAAAGATAAATTGATATATGCTCCAATGTCCGAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTCTTCTGCATTTTCCAATCTACTATTTCTATTTAACTATATACGAGGTTACAGGCTA / / / // / / / // MnlI | | |BbvII* Hin4I | MmeI |Hin4I | | |MboII TspEI |MnlI | | SetI Hpy188I | MaeII TaiI SetI T R R R K R L D D K D K L I Y A P M S D Q E D V K G * M I K I N * Y M L Q C P M K K T * K V R * * R * I D I C S N V R C ----:----|----:----|----:----|----:----|----:----|----:----| V L L R L L N S S L S L N I Y A G I D S S L F V Y F T L H Y L Y I S I H E L T R C S S T F P * I I F I F Q Y I S W H G I Hin4I | Hpy188I | | BccI SapI | | SetI SfaNI BseGI FokI Ksp632I* \ \ \ \ \ \ \ GTCGGAGGTGTGTTGATGGATAAGGATGCTGTTTATATTGATATTGGAAAGAAAAATGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCCTCCACACAACTACCTATTCCTACGACAAATATAACTATAACCTTTCTTTTTACTT / / / / / / / | SetI BccI SfaNI BseGI FokI Ksp632I* Hpy188I SapI V G G V L M D K D A V Y I D I G K K N E S E V C * W I R M L F I L I L E R K M K R R C V D G * G C C L Y * Y W K E K * R ----:----|----:----|----:----|----:----|----:----|----:----| T P P T N I S L S A T * I S I P F F F S H R L H T S P Y P H Q K Y Q Y Q F S F H D S T H Q H I L I S N I N I N S L F I F MboII |TspDTI || BssKI || | HpaII || | ScrFI HphI || | CauII* | FatI || | |CfrI Hin4II* | BspHI || | || CviJI |BplI | |CviAII || | || HaeIII |BplI | |Hpy178III* CviJI || | || | MnlI || SetI | || NlaIII Hpy166II \ \\ \ \\ \ \ \\ \ \ \\ \ \ GAGCCAAGTTTTGTTCCCGGCCAAGAAAGAGGTGAAGGAGAAAAACTCATGACGGGTTTA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGGTTCAAAACAAGGGCCGGTTCTTTCTCCACTTCCTCTTTTTGAGTACTGCCCAAAT / / ///// / / / / / // / / CviJI TspDTI ||||| | | SetI HphI | || | Hpy166II MboII ||||| | Hin4II* | || BplI ||||| BplI | || BplI ||||| BplI | |BspHI ||||CfrI | |FatI |||MnlI | Hpy178III* ||HaeIII | CviAII ||BssKI NlaIII ||CviJI |HpaII CauII* ScrFI E P S F V P G Q E R G E G E K L M T G L S Q V L F P A K K E V K E K N S * R V Y A K F C S R P R K R * R R K T H D G F T ----:----|----:----|----:----|----:----|----:----|----:----| S G L K T G P W S L P S P S F S M V P K L A L N Q E R G L F L H L L F V * S P N L W T K N G A L F S T F S F F E H R T * CviRI* | BccI CviRI* BplI | ApoI |MfeI BseMII BplI | TspEI |TspEI |BspCNI \ \ \ \\ \\ CAAAGTGTTGAACAAAGTATTGCAGAGAAATTTGATGGTGTGGGTTTGCAATTGTTTAGC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCACAACTTGTTTCATAACGTCTCTTTAAACTACCACACCCAAACGTTAACAAATCG / / / / / // CviRI* | TspEI | | |BspCNI | ApoI | | BseMII BccI | TspEI | MfeI CviRI* Q S V E Q S I A E K F D G V G L Q L F S K V L N K V L Q R N L M V W V C N C L A K C * T K Y C R E I * W C G F A I V * Q ----:----|----:----|----:----|----:----|----:----|----:----| C L T S C L I A S F N S P T P K C N N L V F H Q V F Y Q L S I Q H H P N A I T * L T N F L T N C L F K I T H T Q L Q K A MboI |Hin4II* ||DpnI TspDTI |||FatI | DdeI |||BspHI | | AluI |||BstKTI | | CviJI ||||CviAII | | TspRI ||||Hpy178III* | | | SetI |||||TspDTI | | | |FatI |||||| NlaIII | | | |BspHI |||||| | FatI | | | ||CviAII |||||| | |CviAII | | | ||Hpy178III* |||||| | || NlaIII | | | ||| BceAI |||||| | || | TspDTI | | | ||| |NlaIII |||||| | || | |BseGI FokI \ \ \ \\\ \\ \\\\\\ \ \\ \ \\ \ AACGGCACTGAGCTTCATGAAGTTGCCGATCATGAAGGCATGGATGTTGAAAGTGGAGAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCCGTGACTCGAAGTACTTCAACGGCTAGTACTTCCGTACCTACAACTTTCACCTCTT // /// / /// ///// // / // // / |TspRI ||| | ||BceAI ||||| || | || |BseGI FokI TspDTI ||| | |BspHI ||||| || | || TspDTI ||| | |FatI ||||| || | |FatI ||| | | ||||| || | CviAII ||| | | ||||| || NlaIII ||| | | ||||| |BspHI ||| | | ||||| |FatI ||| | | ||||| Hpy178III* ||| | | ||||| CviAII ||| | | ||||MboI ||| | | |||TspDTI ||| | | |||NlaIII ||| | | ||DpnI ||| | | |BstKTI ||| | | Hin4II* ||| | Hpy178III* ||| | CviAII ||| NlaIII ||CviJI ||AluI |DdeI SetI N G T E L H E V A D H E G M D V E S G E T A L S F M K L P I M K A W M L K V E K R H * A S * S C R S * R H G C * K W R R ----:----|----:----|----:----|----:----|----:----|----:----| L P V S S * S T A S * S P M S T S L P S C R C Q A E H L Q R D H L C P H Q F H L V A S L K M F N G I M F A H I N F T S F MboII MseI ApoI MnlI | Hin4II* TspDTI BsrI |MboII TspEI \ \ \ \ \ \\ \ GAAAGTATTGAGGACGATGAAGGAAAGAGCAAGGGAAGAACCAGTTTAAGAAAACCAAGA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCATAACTCCTGCTACTTCCTTTCTCGTTCCCTTCTTGGTCAAATTCTTTTGGTTCT / / / / / / / MnlI | Hin4II* TspDTI BsrI | MseI MboII MboII E S I E D D E G K S K G R T S L R K P R K V L R T M K E R A R E E P V * E N Q E K Y * G R * R K E Q G K N Q F K K T K N ----:----|----:----|----:----|----:----|----:----|----:----| S L I S S S S P F L L P L V L K L F G L L F Y Q P R H L F S C P F F W N L F V L F T N L V I F S L A L S S G T * S F W S BbvII* | MboII | | HgaI CviJI | | MboII |BsrI Hpy178III* | | | TspEI \\ \ \ \ \ \ ATTTATGGTAAGCCAGTTCAAGAAGAAGACGCAGATATTGATAATTTACCGAGTGATGAA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TAAATACCATTCGGTCAAGTTCTTCTTCTGCGTCTATAACTATTAAATGGCTCACTACTT / // / / / / / TspEI |CviJI Hpy178III* | | | TspEI ApoI BsrI | | HgaI | BbvII* | MboII MboII I Y G K P V Q E E D A D I D N L P S D E F M V S Q F K K K T Q I L I I Y R V M K L W * A S S R R R R R Y * * F T E * * R ----:----|----:----|----:----|----:----|----:----|----:----| I * P L G T * S S S A S I S L K G L S S F K H Y A L E L L L R L Y Q Y N V S H H N I T L W N L F F V C I N I I * R T I F MaeII |BtrI ||MlyI ||PleI ||Hpy99I |||SetI |||TaiI ||||CviRI* ||||| HinfI ||||| | Hpy188I ||||| | | BccI ||||| | | |StyI ||||| | | |SecI* SetI ||||| | | ||BsiYI* TaqI | MboII ||||| | | ||| BsgI ClaI | |TspDTI ||||| | | ||| | BseGI |FokI \ \\ \\\\\ \ \ \\\ \ \ \\ GAACCTTATACAAATGATGACGACGTGCAGGACTCCGAACCAAGGATGGTTGAAATCGAT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGGAATATGTTTACTACTGCTGCACGTCCTGAGGCTTGGTTCCTACCAACTTTAGCTA / / / / //// // / / / / / SetI TspDTI | | |||CviRI* || | | | BseGI ClaI MboII | | ||PleI || | | SecI* TaqI | | |MaeII || | | BsgI | | |MlyI || | | StyI | | BtrI || | BccI | TaiI || BsiYI* | SetI |Hpy188I Hpy99I HinfI E P Y T N D D D V Q D S E P R M V E I D N L I Q M M T T C R T P N Q G W L K S I T L Y K * * R R A G L R T K D G * N R F ----:----|----:----|----:----|----:----|----:----|----:----| S G * V F S S S T C S E S G L I T S I S L V K Y L H H R R A P S R V L S P Q F R F R I C I I V V H L V G F W P H N F D I TfiI HinfI | AlwNI AgeI | | Hpy188I BetI* HgiCI* AluI | | |ApoI Cfr10I | NlaIV CviJI | | |TspEI |HpaII | |HphI TspEI | SetI | | ||Ksp632I* \\ \ \\ \ \ \ \ \ \\\ TTCAATAATACCGGTGAGCAGGGTGCCGAAAAATTAGCTTTGGAAACAGATTCTGAATTT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTATTATGGCCACTCGTCCCACGGCTTTTTAATCGAAACCTTTGTCTAAGACTTAAA / // / / / / / // / FokI |Cfr10I | HgiCI* | CviJI | || Ksp632I* |BetI* NlaIV | AluI | || TspEI |AgeI HphI TspEI | || ApoI HpaII SetI | |Hpy188I | HinfI | TfiI AlwNI F N N T G E Q G A E K L A L E T D S E F S I I P V S R V P K N * L W K Q I L N L Q * Y R * A G C R K I S F G N R F * I * ----:----|----:----|----:----|----:----|----:----|----:----| K L L V P S C P A S F N A K S V S E S N N * Y Y R H A P H R F I L K P F L N Q I E I I G T L L T G F F * S Q F C I R F K BssKI MboII AciI EcoRII NspBII* |SecI* |BisI AluI ||ScrFI ||BlsI CviJI MboII ||BseBI |||TauI | SetI \ \\\ \\\\ \ \ GAAGAGAGTGAAGATGAGTTTTCCTGGGAAAGAACAGCGGCAAACAAGCTGAAGAAAACT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTCTCACTTCTACTCAAAAGGACCCTTTCTTGTCGCCGTTTGTTCGACTTCTTTTGA / / / / /// / / MboII | | EcoRII ||BisI | CviJI | | BssKI ||AciI | AluI | | SecI* |BlsI SetI | BseBI NspBII* | ScrFI TauI MboII E E S E D E F S W E R T A A N K L K K T K R V K M S F P G K E Q R Q T S * R K L R E * R * V F L G K N S G K Q A E E N * ----:----|----:----|----:----|----:----|----:----|----:----| S S L S S S N E Q S L V A A F L S F F V Q L S H L H T K R P F F L P L C A S S F F L T F I L K G P F S C R C V L Q L F S Eco57I Eco57MI | AsuI* | AvaII | DraII | PpuMI | |BmgT120I | ||BssKI | ||EcoRII FatI | ||| ScrFI AluI |CviAII | ||| BseBI CviJI || NlaIII MboII | ||| |SetI | SetI || | HphI SetI \ \ \\\ \\ \ \ \\ \ \ \ GAAAGTAAGAAAAGGACCTGGAATATCGGTAAGCTGATATACATGGACAACATTTCACCT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCATTCTTTTCCTGGACCTTATAGCCATTCGACTATATGTACCTGTTGTAAAGTGGA / / /// / / / / / /// / MboII | ||| | EcoRII | CviJI | ||HphI SetI | ||| | BssKI | AluI | |FatI | ||| BseBI SetI | CviAII | ||| ScrFI NlaIII | ||PpuMI | ||DraII | ||AvaII | ||AsuI* | |BmgT120I | SetI Eco57MI Eco57I E S K K R T W N I G K L I Y M D N I S P K V R K G P G I S V S * Y T W T T F H L K * E K D L E Y R * A D I H G Q H F T * ----:----|----:----|----:----|----:----|----:----|----:----| S L L F L V Q F I P L S I Y M S L M E G Q F Y S F S R S Y R Y A S I C P C C K V F T L F P G P I D T L Q Y V H V V N * R SetI Hin4II* |Eco57I | MboII |Eco57MI MaeIII | |MnlI ||MnlI Hpy99I Tsp45I \ \\ \\\ \ \ GAAGAATGTATAAGAAGGTGGAGGGGCGAGGACGACGATAGTAAAGACGAAAGTGACATT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTACATATTCTTCCACCTCCCCGCTCCTGCTGCTATCATTTCTGCTTTCACTGTAA / // / / / / / | || | | MnlI Hpy99I Tsp45I | || | Eco57MI MaeIII | || | Eco57I | || SetI | |MnlI | MboII Hin4II* E E C I R R W R G E D D D S K D E S D I K N V * E G G G A R T T I V K T K V T L R M Y K K V E G R G R R * * R R K * H * ----:----|----:----|----:----|----:----|----:----|----:----| S S H I L L H L P S S S S L L S S L S M Q L I Y L F T S P R P R R Y Y L R F H C F F T Y S P P P A L V V I T F V F T V N Eco57I Csp6I Eco57MI |RsaI | MboII || MaeIII | | MboII Hpy178III* || Tsp4CI* | | |MboII | BccI || | MnlI \ \ \\ \ \ \\ \ \ GAAGAAGATGTTGATGATGACTTCTTCAGGAAAAAAGATGGTACTGTTACAAAAGAGGGC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTCTACAACTACTACTGAAGAAGTCCTTTTTTCTACCATGACAATGTTTTCTCCCG / / // / / /// / / | | |MboII | BccI ||| | MaeIII | | MboII Hpy178III* ||| MnlI | MboII ||Tsp4CI* Eco57MI |Csp6I Eco57I RsaI E E D V D D D F F R K K D G T V T K E G K K M L M M T S S G K K M V L L Q K R A R R C * * * L L Q E K R W Y C Y K R G Q ----:----|----:----|----:----|----:----|----:----|----:----| S S S T S S S K K L F F S P V T V F S P Q L L H Q H H S R * S F L H Y Q * L L P F F I N I I V E E P F F I T S N C F L A FatI TsoI |CviAII |TaqI || CviRI* |AsuII || NlaIII TaqI || TspEI \\ \ \ \\ \ AATAAAGACCATGCAGTTGATTTGGAAAAGTTTGTTCCATATTTCGACACTTTCGAAAAA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTCTGGTACGTCAACTAAACCTTTTCAAACAAGGTATAAAGCTGTGAAAGCTTTTT / // / / / | |CviRI* | TsoI AsuII | |FatI TaqI TaqI | CviAII NlaIII N K D H A V D L E K F V P Y F D T F E K I K T M Q L I W K S L F H I S T L S K N * R P C S * F G K V C S I F R H F R K I ----:----|----:----|----:----|----:----|----:----|----:----| L L S W A T S K S F N T G Y K S V K S F C Y L G H L Q N P F T Q E M N R C K R F I F V M C N I Q F L K N W I E V S E F F TfiI HinfI | SecI* | | Hin6I | | |GlaI | | ||HhaI NmeAIII | | ||| Cac8I CviJI SfaNI | CviRI* | | ||| |MnlI \ \ \ \ \ \ \\\ \\ TTGGCTAAAAAATGGAAAAGCGTTGATGCAATCAAAGAGCGATTCCTCGGCGCAGGCATT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AACCGATTTTTTACCTTTTCGCAACTACGTTAGTTTCTCGCTAAGGAGCCGCGTCCGTAA / / / / / / //// / | CviJI | | CviRI* | |||| Cac8I TspEI | NmeAIII | |||| MnlI SfaNI | |||Hin6I | ||GlaI | |HhaI | SecI* HinfI TfiI L A K K W K S V D A I K E R F L G A G I W L K N G K A L M Q S K S D S S A Q A F G * K M E K R * C N Q R A I P R R R H F ----:----|----:----|----:----|----:----|----:----|----:----| N A L F H F L T S A I L S R N R P A P M I P * F I S F R Q H L * L A I G R R L C Q S F F P F A N I C D F L S E E A C A N MlyI PleI | MaeIII | Tsp45I | | HinfI SetI | | | Hin4II* SetI TspDTI MboII \ \ \ \ \ \ \ \ TTAGGTAATGATAATAAAACGAAAAGTGACTCTAATGAAGGTGGGGAAGAACTATACGGC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| AATCCATTACTATTATTTTGCTTTTCACTGAGATTACTTCCACCCCTTCTTGATATGCCG / // // / / / SetI |PleI |HinfI SetI TspDTI MboII MlyI Hin4II* Tsp45I MaeIII L G N D N K T K S D S N E G G E E L Y G * V M I I K R K V T L M K V G K N Y T A R * * * * N E K * L * * R W G R T I R R ----:----|----:----|----:----|----:----|----:----|----:----| K P L S L L V F L S E L S P P S S S Y P K L Y H Y Y F S F H S * H L H P L V I R * T I I I F R F T V R I F T P F F * V A MboI BglII XhoII | DpnI | |XbaI | |BceAI | |BstKTI BbvII* | ||BccI XmnI | MaeIII | ||MaeI |MboII | Tsp45I | ||Hpy178III* || Hpy188I | | MboII | ||| MboII || | Hin4II* | | | MnlI \ \\\ \ \\ \ \ \ \ \ \ GATTTTGAAGATCTAGAAGATGGAAACCCTTCTGAACAAGCAGAAGACAATAGTGACAAA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAAACTTCTAGATCTTCTACCTTTGGGAAGACTTGTTCGTCTTCTGTTATCACTGTTT // //// / / / / / / / || |||| MboII | | Hin4II* | | MnlI || |||XbaI | Hpy188I | Tsp45I || ||Hpy178III* MboII | MaeIII || ||MaeI XmnI BbvII* || |BceAI MboII || |BccI || XhoII || BglII || MboI |DpnI BstKTI D F E D L E D G N P S E Q A E D N S D K I L K I * K M E T L L N K Q K T I V T K F * R S R R W K P F * T S R R Q * * Q R ----:----|----:----|----:----|----:----|----:----|----:----| S K S S R S S P F G E S C A S S L L S L R N Q L D L L H F G K Q V L L L C Y H C I K F I * F I S V R R F L C F V I T V F FokI | BbvII* | TspDTI BseGI | | MboII SfaNI MnlI BseGI |FokI | | | TspDTI TspEI | TspEI \ \ \\ \ \ \ \ \ \ \ GAAAGTGAGGATGAGGATGAAAACGAAGACACTAATGGAGATGATGATAATTCATTCACT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCACTCCTACTCCTACTTTTGCTTCTGTGATTACCTCTACTACTATTAAGTAAGTGA / / / / / / / / / MnlI BseGI BseGI | | | | TspDTI TspEI | | | BbvII* | | | MboII | | FokI | TspDTI FokI E S E D E D E N E D T N G D D D N S F T K V R M R M K T K T L M E M M I I H S L K * G * G * K R R H * W R * * * F I H * ----:----|----:----|----:----|----:----|----:----|----:----| S L S S S S S F S S V L P S S S L E N V L F H P H P H F R L C * H L H H Y N M * F T L I L I F V F V S I S I I I I * E S MseI | FatI | NcoI | StyI TseI | SecI* |BisI | DsaI* ||BlsI MnlI | |CviAII BbvI ||BsmI | AciI | || NlaIII TsoI ||Hin4II* \ \ \ \\ \ \ \\\ AATTTTGATGCGGAGGAAAAAAAGGACTTAACCATGGAGCAAGAAAGAGAAATGAATGCT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAAACTACGCCTCCTTTTTTTCCTGAATTGGTACCTCGTTCTTTCTCTTTACTTACGA / // / / / // / / /// | |MnlI AciI | | |DsaI* TsoI BbvI ||BisI | TspEI | | |SecI* |Hin4II* SfaNI | | |StyI |BlsI | | |NcoI BsmI | | |FatI | | CviAII | NlaIII MseI N F D A E E K K D L T M E Q E R E M N A I L M R R K K R T * P W S K K E K * M L F * C G G K K G L N H G A R K R N E C C ----:----|----:----|----:----|----:----|----:----|----:----| L K S A S S F F S K V M S C S L S I F A * N Q H P P F F P S L W P A L F L F S H I K I R L F F L V * G H L L F S F H I S MaeII |BsaAI ||ApaLI |||SetI |||TaiI ||||CviRI* ||||Hpy166II ||||| SduI ||||| BseSI ||||| HgiAI* SetI ||||| |TspEI | MboII ||||| || TaqI | | MseI CviRI* ||||| || |Hpy178III* | | |AhaIII* | TspDTI ||||| || || Hin4II* | | ||HphI \ \ \\\\\ \\ \\ \ \ \ \\\ GCAAAGAAGGAAAAACTACGTGCACAATTCGAGATAGAAGAAGGTGAAAACTTTAAAGAA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTCTTCCTTTTTGATGCACGTGTTAAGCTCTATCTTCTTCCACTTTTGAAATTTCTT / / / // / / / /// / / // | TspDTI | || | | | ||Hin4II* SetI MboII |MseI CviRI* | || | | | |Hpy178III* AhaIII* TseI | || | | | TaqI HphI | || | | TspEI | || | ApaLI | || Hpy166II | || CviRI* | |HgiAI* | |MaeII | |BseSI | |SduI | BsaAI TaiI SetI A K K E K L R A Q F E I E E G E N F K E Q R R K N Y V H N S R * K K V K T L K K K E G K T T C T I R D R R R * K L * R R ----:----|----:----|----:----|----:----|----:----|----:----| A F F S F S R A C N S I S S P S F K L S Q L S P F V V H V I R S L L L H F S * L C L L F F * T C L E L Y F F T F V K F F TspDTI | FatI CviJI | |CviAII HaeIII | || NlaIII Hin4II* |TspDTI MboII | || TspDTI |SfeI* || EcoRV \ \ \\ \ \\ \\ \ GATGATGAAAACAATGAATATGATACATGGTATGAACTACAGAAGGCCAAGATATCTAAA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTACTTTTGTTACTTATACTATGTACCATACTTGATGTCTTCCGGTTCTATAGATTT / / / /// / / // / MboII TspDTI | ||FatI | | |HaeIII EcoRV | |CviAII | | |CviJI | TspDTI | | TspDTI NlaIII | SfeI* Hin4II* D D E N N E Y D T W Y E L Q K A K I S K M M K T M N M I H G M N Y R R P R Y L N * * K Q * I * Y M V * T T E G Q D I * T ----:----|----:----|----:----|----:----|----:----|----:----| S S S F L S Y S V H Y S S C F A L I D L L H H F C H I H Y M T H V V S P W S I * I I F V I F I I C P I F * L L G L Y R F GsuI Eco57MI | Hpy178III* | | HinfI | | | Hpy178III* | | | | MaeII | | | | | SetI | | | | | TaiI | | | | | | Hin4II* Tsp4CI* | | | | | | |TfiI | TspEI | | MlyI | | | | |HinfI | | MseI | | PleI | | | | || TaqI \ \ \ \ \ \ \ \ \ \ \\ \ CAGTTAGAAATTAACAATATAGAATATCAAGAAATGACTCCAGAACAACGTCAAAGAATC 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| GTCAATCTTTAATTGTTATATCTTATAGTTCTTTACTGAGGTCTTGTTGCAGTTTCTTAG / // / // / / / / / / Tsp4CI* |MseI Eco57MI |PleI | | | | | HinfI TspEI GsuI | | | | | | TfiI | | | | | Hin4II* | | | | MaeII | | | TaiI | | | SetI | | Hpy178III* | HinfI Hpy178III* MlyI Q L E I N N I E Y Q E M T P E Q R Q R I S * K L T I * N I K K * L Q N N V K E S V R N * Q Y R I S R N D S R T T S K N R ----:----|----:----|----:----|----:----|----:----|----:----| C N S I L L I S Y * S I V G S C R * L I V T L F * C Y L I D L F S E L V V D F F L * F N V I Y F I L F H S W F L T L S D Csp6I |RsaI ||MaeII |||BsaAI |||SnaBI AluI |||| SetI CviJI |||| TaiI TaqI ApoI SetI | SetI |||| |BslFI AsuII TspEI \ \ \ \\\\ \\ \ \ GAAGGTTTCAAAGCTGGTTCTTATGTACGTATCGTTTTCGAAAAAGTCCCAATGGAATTT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCCAAAGTTTCGACCAAGAATACATGCATAGCAAAAGCTTTTTCAGGGTTACCTTAAA // / / //// / / / |SetI | CviJI |||MaeII | AsuII TspEI TaqI | AluI ||SnaBI | TaqI ApoI SetI ||BsaAI BslFI |Csp6I RsaI TaiI SetI E G F K A G S Y V R I V F E K V P M E F K V S K L V L M Y V S F S K K S Q W N L R F Q S W F L C T Y R F R K S P N G I C ----:----|----:----|----:----|----:----|----:----|----:----| S P K L A P E * T R I T K S F T G I S N R L N * L Q N K H V Y R K R F L G L P I F T E F S T R I Y T D N E F F D W H F K Hpy178III* TaqII | ApoI ApoI |MfeI | TspEI TspEI |TspEI McrI* \ \ \ \\ \ GTCAAGAATTTCAATCCAAAATTTCCAATTGTTATGGGTGGTTTATTGCCGACCGAAATA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTCTTAAAGTTAGGTTTTAAAGGTTAACAATACCCACCAAATAACGGCTGGCTTTAT / / / / / | TspEI TspEI TspEI McrI* | ApoI TaqII MfeI Hpy178III* ApoI V K N F N P K F P I V M G G L L P T E I S R I S I Q N F Q L L W V V Y C R P K * Q E F Q S K I S N C Y G W F I A D R N K ----:----|----:----|----:----|----:----|----:----|----:----| T L F K L G F N G I T I P P K N G V S I Q * S N * D L I E L Q * P H N I A S R F D L I E I W F K W N N H T T * Q R G F Y Hin4I |BssKI |CviJI |EcoRII || AjuI || ScrFI || BseBI BbvII* Hin4I CspCI TaqII || | SetI | MboII | AjuI |MboII \ \\ \ \ \ \ \ \ \\ AAGTTCGGTATTGTCAAAGCCAGGTTGAGAAGACATCGTTGGCATAAGAAGATTTTGAAG 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAAGCCATAACAGTTTCGGTCCAACTCTTCTGTAGCAACCGTATTCTTCTAAAACTTC / / / / // / / / / / / TaqII | | | || EcoRII | | AjuI | MboII | | | || BssKI | Hin4I CspCI | | | |BseBI BbvII* | | | |ScrFI MboII | | | SetI | | CviJI | AjuI Hin4I K F G I V K A R L R R H R W H K K I L K S S V L S K P G * E D I V G I R R F * R V R Y C Q S Q V E K T S L A * E D F E D ----:----|----:----|----:----|----:----|----:----|----:----| F N P I T L A L N L L C R Q C L F I K F L T R Y Q * L W T S F V D N A Y S S K S L E T N D F G P Q S S M T P M L L N Q L BbvII* | MboII | |MmeI | || DrdI | || | BsrI Hin4II* SetI | || | TspRI | CspCI NlaIV TspEI \ \\ \ \ \ \ \ \ ACAAATGACCCACTGGTCTTGTCTTTGGGTTGGAGAAGGTTCCAAACTTTACCAATTTAT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTACTGGGTGACCAGAACAGAAACCCAACCTCTTCCAAGGTTTGAAATGGTTAAATA / / / / / / / / | | BsrI | | | NlaIV TspEI | DrdI | | SetI BbvII* | CspCI MboII Hin4II* TspRI MmeI T N D P L V L S L G W R R F Q T L P I Y Q M T H W S C L W V G E G S K L Y Q F I K * P T G L V F G L E K V P N F T N L Y ----:----|----:----|----:----|----:----|----:----|----:----| V F S G S T K D K P Q L L N W V K G I * S L H G V P R T K P N S F T G F K V L K C I V W Q D Q R Q T P S P E L S * W N I HinfI | XbaI AccI MlyI | |MaeI |BssNAI PleI | |Hpy178III* BsmI |Hpy166II \ \ \\ \ \\ ACAACAACTGACTCTAGAACAAGAACCAGAATGCTAAAGTATACACCAGAACACACATAT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTGTTGACTGAGATCTTGTTCTTGGTCTTACGATTTCATATGTGGTCTTGTGTGTATA // / // / // |PleI | |XbaI BsmI |AccI MlyI | Hpy178III* Hpy166II | MaeI BssNAI HinfI T T T D S R T R T R M L K Y T P E H T Y Q Q L T L E Q E P E C * S I H Q N T H I N N * L * N K N Q N A K V Y T R T H I L ----:----|----:----|----:----|----:----|----:----|----:----| V V V S E L V L V L I S F Y V G S C V Y Y L L Q S * F L F W F A L T Y V L V C M C C S V R S C S G S H * L I C W F V C I BslFI | AciI AsuI* | |BisI AvaII | ||BlsI Tsp4CI* | |||TauI |BmgT120I SetI | |||CviJI ||NlaIV | BsiYI* TspEI \ \\\\ \\\ \ \ \ TGTAATGCGGCTTTCTACGGTCCCTTATGTTCTCCAAACACACCTTTTTGTGGTGTTCAA 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| ACATTACGCCGAAAGATGCCAGGGAATACAAGAGGTTTGTGTGGAAAAACACCACAAGTT //// / // / / |||CviJI | |AvaII SetI BsiYI* ||BslFI | |AsuI* ||BisI | BmgT120I ||AciI | NlaIV |BlsI Tsp4CI* TauI C N A A F Y G P L C S P N T P F C G V Q V M R L S T V P Y V L Q T H L F V V F K * C G F L R S L M F S K H T F L W C S N ----:----|----:----|----:----|----:----|----:----|----:----| Q L A A K * P G K H E G F V G K Q P T * N Y H P K R R D R I N E L C V K K H H E T I R S E V T G * T R W V C R K T T N L Tsp4CI* | TspEI BssKI | | TseI |HpaII | | CviRI* SetI ||ScrFI | | |BisI |BbvI ||CauII* | | ||BlsI ||Ksp632I* \\\ \ \ \\\ \\\ ATTGTTGCTAATAGTGATACCGGGAACGGTTTTAGAATTGCAGCAACAGGTATCGTTGAA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TAACAACGATTATCACTATGGCCCTTGCCAAAATCTTAACGTCGTTGTCCATAGCAACTT / / / / ///// / / TspEI | | Tsp4CI* ||||| SetI Ksp632I* | BssKI ||||TseI BbvI CauII* |||BisI HpaII ||BlsI ScrFI |CviRI* TspEI I V A N S D T G N G F R I A A T G I V E L L L I V I P G T V L E L Q Q Q V S L K C C * * * Y R E R F * N C S N R Y R * R ----:----|----:----|----:----|----:----|----:----|----:----| I T A L L S V P F P K L I A A V P I T S F Q Q * Y H Y R S R N * F Q L L L Y R Q N N S I T I G P V T K S N C C C T D N F MaeII | MboII | |MseI | |SetI | |TaiI MseI ApoI | || SspI TspEI MseI | TspEI TspEI \ \\ \ \ \ \ \ \ GAGATAGACGTTAATATTGAAATTGTTAAAAAGTTAAAATTAGTTGGGTTTCCATATAAA 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTATCTGCAATTATAACTTTAACAATTTTTCAATTTTAATCAACCCAAAGGTATATTT / // / / / / / / | || | SspI | MseI MseI TspEI | || MseI TspEI | |MaeII | MboII TaiI SetI E I D V N I E I V K K L K L V G F P Y K R * T L I L K L L K S * N * L G F H I K D R R * Y * N C * K V K I S W V S I * N ----:----|----:----|----:----|----:----|----:----|----:----| S I S T L I S I T L F N F N T P N G Y L L S L R * Y Q F Q * F T L I L Q T E M Y L Y V N I N F N N F L * F * N P K W I F FatI AflIII BspLU11I* |CviAII || NspI CviRI* PsiI || NlaIII | MnlI \ \\ \ \ \ ATTTTCAAAAATACTGCCTTTATAAAGGACATGTTTTCAAGTGCTATGGAAGTTGCAAGG 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAGTTTTTATGACGGAAATATTTCCTGTACAAAAGTTCACGATACCTTCAACGTTCC / / / // /// TspEI PsiI | |BspLU11I* ||SetI ApoI | |AflIII |MnlI | |FatI CviRI* | CviAII NlaIII NspI I F K N T A F I K D M F S S A M E V A R F S K I L P L * R T C F Q V L W K L Q G F Q K Y C L Y K G H V F K C Y G S C K V ----:----|----:----|----:----|----:----|----:----|----:----| I K L F V A K I F S M N E L A I S T A L F K * F Y Q R * L P C T K L H * P L Q L N E F I S G K Y L V H K * T S H F N C P Hin6I |GlaI Tsp4CI* |MstI* |TspGWI ||HhaI || AvaI SduI ||| MboI || |BmeT110I BseSI ||| | DpnI || || SecI* | BseMII SetI ||| | |BstKTI || || BsmAI DsaI* BciVI HphI | |BspCNI \ \\\ \ \\ \\ \\ \ \ \ \ \ \\ TTTGAGGGTGCGCAGATCAAAACTGTCTCGGGTATCCGTGGTGAAATCAAAAGGGCACTT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTCCCACGCGTCTAGTTTTGACAGAGCCCATAGGCACCACTTTAGTTTTCCCGTGAA /// // / / // / / / / / // ||| || MboI | || BsmAI | BciVI | | |BspCNI ||| |DpnI | |AvaI DsaI* | | BseMII ||| BstKTI | BmeT110I SecI* | BseSI ||Hin6I Tsp4CI* | SduI |MstI* TspGWI HphI |GlaI HhaI F E G A Q I K T V S G I R G E I K R A L L R V R R S K L S R V S V V K S K G H F * G C A D Q N C L G Y P W * N Q K G T F ----:----|----:----|----:----|----:----|----:----|----:----| N S P A C I L V T E P I R P S I L L A S T Q P H A S * F Q R P Y G H H F * F P V K L T R L D F S D R T D T T F D F P C K MnlI | CviJI | | DdeI TseI | | SauI* |BisI | | | MaeIII ||MnlI | | | Tsp45I ||BlsI | | | | SfeI* |||CviJI BbvI \ \ \ \ \ \\\\ \ TCAAAGCCTGAGGGTCACTATAGGGCAGCCTTTGAGGATAAAATCCTAATGAGTGATATT 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTTCGGACTCCCAGTGATATCCCGTCGGAAACTCCTATTTTAGGATTACTCACTATAA / / / / / /// / | | SauI* | | ||CviJI BbvI | | DdeI | | ||TseI | CviJI | | |BisI MnlI | | BlsI | | MnlI | SfeI* Tsp45I MaeIII S K P E G H Y R A A F E D K I L M S D I Q S L R V T I G Q P L R I K S * * V I L K A * G S L * G S L * G * N P N E * Y C ----:----|----:----|----:----|----:----|----:----|----:----| E F G S P * * L A A K S S L I R I L S I K L A Q P D S Y P L R Q P Y F G L S H Y * L R L T V I P C G K L I F D * H T I N TspEI | DdeI | | MboI | | | DpnI AciI | | | |FatI | BciVI | | | |BstKTI | FnuDII* | | | ||CviAII | | Hpy178III* | | | ||| NlaIII | | | ApoI | | | ||| |HgaI | | | TspEI MaeIII SetI \ \ \ \\\ \\ \ \ \ \ \ \ GTAATTCTAAGATCATGGTATCCTGTCCGCGTCAAGAAATTCTATAATCCTGTTACCTCA 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| CATTAAGATTCTAGTACCATAGGACAGGCGCAGTTCTTTAAGATATTAGGACAATGGAGT / ///// // / // / / / / | ||||| |FatI HgaI || | TspEI | MaeIII | ||||| CviAII || | ApoI SetI | ||||MboI || Hpy178III* | |||NlaIII |FnuDII* | ||DpnI |AciI | |BstKTI BciVI | DdeI TspEI V I L R S W Y P V R V K K F Y N P V T S * F * D H G I L S A S R N S I I L L P H N S K I M V S C P R Q E I L * S C Y L T ----:----|----:----|----:----|----:----|----:----|----:----| T I R L D H Y G T R T L F N * L G T V E Q L E L I M T D Q G R * S I R Y D Q * R Y N * S * P I R D A D L F E I I R N G * AciI BsrBI Hin4II* SetI CviJI |BisI | MnlI |MseI HaeIII ||BlsI \ \ \\ \ \\\ CTATTGTTGAAGGAAAAAACCGAGTGGAAAGGTTTAAGATTGACAGGCCAAATAAGAGCG 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| GATAACAACTTCCTTTTTTGGCTCACCTTTCCAAATTCTAACTGTCCGGTTTATTCTCGC / / / / / /// | MnlI SetI MseI HaeIII ||BisI Hin4II* CviJI ||AciI |BlsI BsrBI TauI L L L K E K T E W K G L R L T G Q I R A Y C * R K K P S G K V * D * Q A K * E R I V E G K N R V E R F K I D R P N K S G ----:----|----:----|----:----|----:----|----:----|----:----| S N N F S F V S H F P K L N V P W I L A V I T S P F F R T S L N L I S L G F L L * Q Q L F F G L P F T * S Q C A L Y S R TspDTI |Tsp4CI* || TaqI || | TfiI || | HinfI || | Hpy99I || | | BetI* || | | BspMII* BssKI || | | |HpaII EcoRII || | | |Hpy178III* MaeII | ScrFI || | | || Tsp4CI* AflIII TauI | BseBI || | | || | CviRI* | SetI CviJI | |SetI || | | || | | TspRI | TaiI \ \ \\ \\ \ \ \\ \ \ \ \ \ GCTATGAACCTGGAAACACCGTCGAATCCGGACAGTGCATATCATAAAATAGAACGTGTA 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CGATACTTGGACCTTTGTGGCAGCTTAGGCCTGTCACGTATAGTATTTTATCTTGCACAT / / / / / / / / // / / / / / CviJI | | | | | | | || | CviRI* | | AflIII | | | | | | | || Tsp4CI* | MaeII | | | | | | | |BspMII* TaiI | | | | | | | |BetI* SetI | | | | | | | Hpy178III* | | | | | | | HpaII | | | | | | | TspRI | | | | | | HinfI | | | | | | TfiI | | | | | TaqI | | | | Tsp4CI* | | | | Hpy99I | | | TspDTI | | EcoRII | | BssKI | BseBI | ScrFI SetI A M N L E T P S N P D S A Y H K I E R V L * T W K H R R I R T V H I I K * N V * Y E P G N T V E S G Q C I S * N R T C R ----:----|----:----|----:----|----:----|----:----|----:----| A I F R S V G D F G S L A Y * L I S R T P * S G P F V T S D P C H M D Y F L V H S H V Q F C R R I R V T C I M F Y F T Y AsuI* AvaII DraII PpuMI |BmgT120I AluI BslFI ||SetI CviJI |MslI ||NlaIV | SetI TspEI BinI* \\ \\\ \ \ \ \ GAAAGACACTTCAATGGTCTAAAGGTCCCAAAAGCTGTTCAAAAGGAATTGCCATTCAAA 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCTGTGAAGTTACCAGATTTCCAGGGTTTTCGACAAGTTTTCCTTAACGGTAAGTTT / / / // / / / | BslFI | || | CviJI TspEI MslI | || | AluI | || SetI | |PpuMI | |DraII | |AvaII | |AsuI* | BmgT120I | NlaIV SetI E R H F N G L K V P K A V Q K E L P F K K D T S M V * R S Q K L F K R N C H S N K T L Q W S K G P K S C S K G I A I Q I ----:----|----:----|----:----|----:----|----:----|----:----| S L C K L P R F T G F A T * F S N G N L L F V S * H D L P G L L Q E F P I A M * F S V E I T * L D W F S N L L F Q W E F DdeI | MboI | XhoII MwoI | Hpy188I BspCNI BceAI | CviJI | | DpnI |BseMII TspDTI | MboII | |SecI* | | |BstKTI ||BccI | TsoI | | CviJI | |DsaI* \ \ \\ \\\ \ \ \ \ \ \ \\ TCTCAGATCCATCAAATGAAACCACAAAAGAAGAAAACATATATGGCTAAAAGAGCCGTG 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGTCTAGGTAGTTTACTTTGGTGTTTTCTTCTTTTGTATATACCGATTTTCTCGGCAC / //// / // / / / // / / / / | |||| | || BccI | TsoI || | MwoI | DsaI* | |||| | |BseMII TspDTI || CviJI | SecI* | |||| | BspCNI |BceAI CviJI | |||| XhoII MboII | |||| MboI | |||DpnI | ||BstKTI | |DdeI | Hpy188I BinI* S Q I H Q M K P Q K K K T Y M A K R A V L R S I K * N H K R R K H I W L K E P W S D P S N E T T K E E N I Y G * K S R G ----:----|----:----|----:----|----:----|----:----|----:----| D * I W * I F G C F F F V Y I A L L A T I E S G D F S V V F S S F M Y P * F L R R L D M L H F W L L L F C I H S F S G H Hin4II* | HphI | | TspDTI | | | MboI | | | |TspDTI | | | ||DpnI TaqI MaeI SetI | | | |||BstKTI AsuII \ \ \ \ \ \\\\ \ GTGCTAGGTGGTGATGAAAAGAAGGCAAGATCATTCATTCAAAAAGTATTGACGATTTCG 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| CACGATCCACCACTACTTTTCTTCCGTTCTAGTAAGTAAGTTTTTCATAACTGCTAAAGC // / // / // / / |MaeI | || | || MboI AsuII SetI | || | |DpnI TaqI | || | BstKTI | || TspDTI | |TspDTI | HphI Hin4II* V L G G D E K K A R S F I Q K V L T I S C * V V M K R R Q D H S F K K Y * R F R A R W * * K E G K I I H S K S I D D F E ----:----|----:----|----:----|----:----|----:----|----:----| T S P P S S F F A L D N M * F T N V I E P A L H H H F S P L I M * E F L I S S K H * T T I F L L C S * E N L F Y Q R N R HindII Hpy166II | MaeII MnlI CviJI | | SetI CviJI | Hin4II* Hin4II* |MaeI | | TaiI \ \ \ \ \\ \ \ \ AAAGCCAAAGACAGCAAGAGGAAGGAACAGAAGGCTAGTCAACGTAAGGAAAGATTGAAA 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCGGTTTCTGTCGTTCTCCTTCCTTGTCTTCCGATCAGTTGCATTCCTTTCTAACTTT / / / / / / // / CviJI | Hin4II* Hin4II* | | || MaeII MnlI | | |TaiI | | |SetI | | Hpy166II | | HindII | MaeI CviJI K A K D S K R K E Q K A S Q R K E R L K K P K T A R G R N R R L V N V R K D * K S Q R Q Q E E G T E G * S T * G K I E K ----:----|----:----|----:----|----:----|----:----|----:----| F A L S L L L F S C F A L * R L S L N F S L W L C C S S P V S P * D V Y P F I S F G F V A L P L F L L S T L T L F S Q F TspEI | BccI | |AluI | |CviJI | ||DdeI | |||MnlI | |||SetI MboII \ \\\\ \ AAATTAGCTAAGATGGAGGAAGAAAAATCACAAAGGGATAAGGAGAAAAAGAAAGAATAC 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAATCGATTCTACCTCCTTCTTTTTAGTGTTTCCCTATTCCTCTTTTTCTTTCTTATG / // / / | || DdeI MboII | |MnlI | CviJI | AluI | BccI TspEI SetI K L A K M E E E K S Q R D K E K K K E Y N * L R W R K K N H K G I R R K R K N T I S * D G G R K I T K G * G E K E R I L ----:----|----:----|----:----|----:----|----:----|----:----| F N A L I S S S F D C L S L S F F F S Y F I L * S P P L F I V F P Y P S F S L I F * S L H L F F F * L P I L L F L F F V Hpy166II | MaeII | |BsaAI | ||MnlI | ||TspDTI Hin4I | |||SetI Hin4I | |||TaiI | AciI TfiI | |||| MnlI | | MaeIII HinfI | |||| |Hin4I | | Tsp45I | HphI | |||| |Hin4I \ \ \ \ \ \ \\\\ \\ TTCGCCCAGAATGGTAAAAGAACAACTATGGGCGGTGACGATGAATCTCGTCCACGTAAG 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCGGGTCTTACCATTTTCTTGTTGATACCCGCCACTGCTACTTAGAGCAGGTGCATTC / / / // ///// / Hin4I AciI | |HinfI ||||| MnlI Hin4I | |TfiI ||||MaeII | HphI |||Hin4I Tsp45I |||Hin4I MaeIII |||BsaAI |||MnlI ||TspDTI |TaiI |SetI Hpy166II F A Q N G K R T T M G G D D E S R P R K S P R M V K E Q L W A V T M N L V H V R R P E W * K N N Y G R * R * I S S T * D ----:----|----:----|----:----|----:----|----:----|----:----| K A W F P L L V V I P P S S S D R G R L S R G S H Y F F L * P R H R H I E D V Y E G L I T F S C S H A T V I F R T W T L SetI \ ATGAGGAGGTAA 3550 ----:----|-- TACTCCTCCATT / SetI M R R * * G G X E E V X ----:----|-- I L L Y S S S T H P P L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 9 BspACI,SsiI AflIII 2 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 3 DraI AjuI 1 AlfI 2 AluI 10 AluBI AlwNI 3 CaiI ApaLI 1 Alw44I,VneI ApoI 10 AcsI,XapI AsuI* 6 Cfr13I,PspPI,Sau96I,AspS9I AsuII 3 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 6 Bme18I,Eco47I,SinI,VpaK11BI BbvI 4 BseXI,BstV1I,Lsp1109I BbvII* 7 BpiI,BpuAI,BstV2I,BbsI BccI 8 Bce83I* 1 BpuEI BceAI 4 BcgI 2 BciVI 3 BfuI BetI* 3 BsaWI BglII 1 BinI* 3 AlwI,BspPI,AclWI BisI 7 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 7 BmeT110I 1 BmgT120I 6 BplI 2 BsaAI 3 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 6 Bst2UI,BstNI,BstOI,MvaI BseGI 8 BstF5I,BtsCI BseMII 5 BseSI 4 BaeGI,BstSLI BsgI 1 BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 5 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BsmI 3 BsaMI,Mva1269I,PctI BspCNI 5 BspHI 3 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMII* 2 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 1 AccBSI,MbiI BsrI 4 BseNI,Bse1I,BsrSI BssKI 9 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 11 BstXI 1 BtgZI 1 BtrI 1 BmgBI,AjiI Cac8I 1 BstC8I CauII* 3 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 5 CviQI,RsaNI CspCI 1 CviAII 12 CviJI 29 CviKI-1 CviRI* 17 HpyCH4V DdeI 9 BstDEI,HpyF3I DpnI 11 MalI DraII 3 EcoO109I DrdI 2 AasI,DseDI DsaI* 4 BtgI,BstDSI EciI 1 Eco57I 4 AcuI Eco57MI 5 EcoNI 1 BstENI,XagI EcoRI 1 EcoRII 6 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FalI 2 FatI 12 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 8 GlaI 2 GsuI 1 BpmI HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 6 Hin4II* 18 HpyAV Hin6I 2 HinP1I,HspAI HindII 2 HincII HinfI 13 HpaII 6 HapII,BsiSI,MspI HphI 8 AsuHPI Hpy166II 9 Hpy8I Hpy178III* 19 Hpy188III Hpy188I 8 Hpy99I 4 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 10 HpyCH4IV MaeIII 7 MboI 11 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 31 McrI* 2 BsiEI,BstMCI,Bsh1285I MfeI 2 MunI MlyI 5 SchI MmeI 2 MnlI 23 MseI 16 Tru1I,Tru9I MslI 3 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 4 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 12 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 1 MspA1I NspI 2 BstNSI,XceI OliI 1 AleI PleI 5 PpsI PpuMI 3 Psp5II,PspPPI PsiI 1 AanI RsaI 5 AfaI SapI 1 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 1 BmcAI,AssI,ZrmI ScrFI 9 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 8 BseDI,BssECI,BsaJI SetI 51 SfaNI 3 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI SnaBI 1 Eco105I,BstSNI SspI 2 StuI 1 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 10 TaqI 9 TaqII 3 TatI 1 TauI 3 TfiI 8 PfeI TseI 4 ApeKI TsoI 4 Tsp45I 5 NmuCI Tsp4CI* 12 HpyCH4III,TaaI,Bst4CI TspDTI 20 TspEI 35 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 3 TscAI VspI 2 PshBI,AseI XbaI 2 XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AloI ApaI AscI Asp718I AvrII BaeI BalI BamHI BarI BbvCI BclI BdaI BfiI BglI BmtI Bpu10I BsaXI BsePI BseRI BseYI BsiI* Bsp120I Bsp1407I BspMI BspOI BsrDI BstAPI BstEII BtsI Cfr9I DinI DraIII Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoP15I EcoT22I EgeI EheI Esp3I EspI* FauI FseI FspAI GsaI HaeII HgiJII* HindIII HpaI KasI KpnI MauBI MluI Mph1103I MroNI NaeI NarI NdeI NgoMIV NheI NotI NruI NsiI PacI PasI PflMI PfoI PmaCI PmeI PpiI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TspMI TstI Tth111I XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769