Restriction Map of HRR25/YPL204W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

HRR25/YPL204W on chromosome XVI from coordinates 164276 to 165760.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.15643

SmlI AflII |MseI ApoI MboII || Hin4II* TspEI | NlaIV \\ \ \ \ \ ATGGACTTAAGAGTAGGAAGGAAATTTCGTATTGGCAGGAAGATTGGGAGTGGTTCCTTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTGAATTCTCATCCTTCCTTTAAAGCATAACCGTCCTTCTAACCCTCACCAAGGAAA // / / / |Hin4II* TspEI | NlaIV |AflII ApoI MboII |SmlI MseI M D L R V G R K F R I G R K I G S G S F W T * E * E G N F V L A G R L G V V P L G L K S R K E I S Y W Q E D W E W F L W ----:----|----:----|----:----|----:----|----:----|----:----| X S K L T P L F N R I P L F I P L P E K X P S L L L F S I E Y Q C S S Q S H N R H V * S Y S P F K T N A P L N P T T G K HphI CviJI | MboII | | AluI | | CviJI | | BstXI | | |BccI | | ||SetI SecI* MseI | | ||| TfiI MaeIII DsaI* |TspEI | | ||| HinfI Tsp45I |HphI || BceAI | | ||| | TsoI \ \\ \\ \ \ \ \\\ \ \ GGTGACATTTACCACGGCACGAACTTAATTAGTGGTGAAGAAGTAGCCATCAAGCTGGAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTGTAAATGGTGCCGTGCTTGAATTAATCACCACTTCTTCATCGGTAGTTCGACCTT / / / / / / // / / / / / / | | DsaI* | | BceAI || | | | | | TsoI | | SecI* | TspEI || | | | | BccI | HphI MseI || | | | CviJI Tsp45I || | | | AluI MaeIII || | | SetI || | BstXI || MboII |CviJI HphI G D I Y H G T N L I S G E E V A I K L E V T F T T A R T * L V V K K * P S S W N * H L P R H E L N * W * R S S H Q A G I ----:----|----:----|----:----|----:----|----:----|----:----| P S M * W P V F K I L P S S T A M L S S Q H C K G R C S S L * H H L L L W * A P T V N V V A R V * N T T F F Y G D L Q F TaqI MnlI ClaI |HgaI |FokI || Eam1105I |MboI || |HinfI || DpnI || || AciI || |BstKTI || || | FnuDII* || || AsuI* || || | |PleI || || AvaII || || | ||MlyI || || |BmgT120I || || | |||AccI || || ||SetI || || | ||||SfeI* || || |||Hpy178III* || || | ||||Hpy166II || || |||| BseGI || || | ||||| Hin4I || || |||| | Hin4I || || | ||||| Hin4I || || |||| | Hin4I || || | ||||| | SmlI || || |||| | | BslFI || || | ||||| | AflII || || |||| | | |MfeI || || | ||||| | |MseI || || |||| | | |TspEI || || | |||||FauI | || AciI \\ \\ \\\\ \ \ \\ \\ \\ \ \\\\\\ \ \\ \ TCGATCAGGTCCAGACATCCTCAATTGGACTATGAGTCCCGCGTCTACAGATACTTAAGC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTAGTCCAGGTCTGTAGGAGTTAACCTGATACTCAGGGCGCAGATGTCTATGAATTCG / // / // // // / / / / / / // // // | || | || |Hin4I || | | | | | | || |SfeI* |AflII | || | || |Hin4I || | | | | | | || FauI |SmlI | || | || Hpy178III* || | | | | | | |Hin4I MseI | || | || BseGI || | | | | | | |Hin4I | || | |AvaII || | | | | | | |AccI | || | |AsuI* || | | | | | | Hpy166II | || | BmgT120I || | | | | | PleI | || MboI || | | | | | MlyI | || SetI || | | | | FnuDII* | || FokI || | | | | AciI | |DpnI || | | | HinfI | BstKTI || | | HgaI | ClaI || | Eam1105I | TaqI || MnlI HinfI |TspEI TfiI |MfeI BslFI S I R S R H P Q L D Y E S R V Y R Y L S R S G P D I L N W T M S P A S T D T * A D Q V Q T S S I G L * V P R L Q I L K R ----:----|----:----|----:----|----:----|----:----|----:----| D I L D L C G * N S * S D R T * L Y K L I S * T W V D E I P S H T G R R C I S L R D P G S M R L Q V I L G A D V S V * A TspDTI | TfiI | HinfI BccI Hpy188I MnlI HphI \ \ \ \ \ \ GGTGGTGTGGGAATCCCGTTCATCAGATGGTTTGGCAGAGAGGGTGAATATAATGCTATG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCACACCCTTAGGGCAAGTAGTCTACCAAACCGTCTCTCCCACTTATATTACGATAC / / / / / / / / AciI TspDTI HinfI | Hpy188I MnlI HphI MboII TfiI BccI G G V G I P F I R W F G R E G E Y N A M V V W E S R S S D G L A E R V N I M L W W C G N P V H Q M V W Q R G * I * C Y G ----:----|----:----|----:----|----:----|----:----|----:----| P P T P I G N M L H N P L S P S Y L A I R H H P F G T * * I T Q C L P H I Y H * T T H S D R E D S P K A S L T F I I S H MboII | TaqI | ClaI | |MboI | || DpnI | || |BstKTI | || || MaeI | || || | AsuI* | || || | |CviJI | || || | |HaeIII MaeIII | || || | |BmgT120I Tsp45I | || || | || BsiYI* Tsp4CI* | || || | || | BccI MboII |Hin4II* SetI \ \\ \\ \ \\ \ \ \ \\ \ GTCATCGATCTTCTAGGCCCATCTTTGGAAGATTTATTCAACTACTGTCACAGAAGGTTC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTAGCTAGAAGATCCGGGTAGAAACCTTCTAAATAAGTTGATGACAGTGTCTTCCAAG // / / /// / / / // / / || MboI | ||| BsiYI* BccI MboII || | SetI |DpnI | ||AsuI* || Tsp45I BstKTI | |BmgT120I || MaeIII ClaI | HaeIII |Hin4II* TaqI | CviJI Tsp4CI* MaeI V I D L L G P S L E D L F N Y C H R R F S S I F * A H L W K I Y S T T V T E G S H R S S R P I F G R F I Q L L S Q K V L ----:----|----:----|----:----|----:----|----:----|----:----| T M S R R P G D K S S K N L * Q * L L N P * R D E L G M K P L N I * S S D C F T D D I K * A W R Q F I * E V V T V S P E Tsp4CI* | FatI | |CviAII | || NlaIII | || | Cac8I | || | | CviJI Hin4II* | || | | |BceAI |FatI | || | | ||MwoI ||CviAII MseI | || | | ||| CviRI* ||| TspDTI \ \ \\ \ \ \\\ \ \\\ \ TCCTTTAAGACGGTTATCATGCTGGCTTTGCAAATGTTTTGCCGTATTCAGTATATACAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAAATTCTGCCAATAGTACGACCGAAACGTTTACAAAACGGCATAAGTCATATATGTA / / / // /// / / / // / | | | || ||| | CviRI* | || CviAII | | | || ||| BceAI | |TspDTI | | | || ||CviJI | NlaIII | | | || |MwoI Hin4II* | | | || Cac8I | | | |FatI | | | CviAII | | NlaIII | Tsp4CI* MseI S F K T V I M L A L Q M F C R I Q Y I H P L R R L S C W L C K C F A V F S I Y M L * D G Y H A G F A N V L P Y S V Y T W ----:----|----:----|----:----|----:----|----:----|----:----| E K L V T I M S A K C I N Q R I * Y I C R R * S P * * A P K A F T K G Y E T Y V G K L R N D H Q S Q L H K A T N L I Y M NlaIII AcyI | TspDTI MseI | SecI* | | SetI EcoRV |BceAI | DsaI* \ \ \ \ \\ \ \ GGAAGGTCGTTCATTCATAGAGATATCAAACCAGACAACTTTTTAATGGGGGTAGGACGC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTCCAGCAAGTAAGTATCTCTATAGTTTGGTCTGTTGAAAAATTACCCCCATCCTGCG /// / // / ||SetI EcoRV |BceAI AcyI |TspDTI MseI FatI G R S F I H R D I K P D N F L M G V G R E G R S F I E I S N Q T T F * W G * D A K V V H S * R Y Q T R Q L F N G G R T P ----:----|----:----|----:----|----:----|----:----|----:----| P L D N M * L S I L G S L K K I P T P R H F T T * E Y L Y * V L C S K L P P L V S P R E N M S I D F W V V K * H P Y S A Tsp4CI* | FatI TspDTI | |CviAII |MwoI | || TaqII |HgaI | || NlaIII \\ \ \\ \ CGTGGTAGCACCGTTCATGTTATTGATTTCGGTCTATCAAAGAAATACCGAGATTTCAAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GCACCATCGTGGCAAGTACAATAACTAAAGCCAGATAGTTTCTTTATGGCTCTAAAGTTG / / // / /// | DsaI* || | ||FatI | SecI* || | |CviAII TspDTI || | TaqII MwoI || NlaIII |Tsp4CI* HgaI R G S T V H V I D F G L S K K Y R D F N V V A P F M L L I S V Y Q R N T E I S T W * H R S C Y * F R S I K E I P R F Q H ----:----|----:----|----:----|----:----|----:----|----:----| R P L V T * T I S K P R D F F Y R S K L G H Y C R E H * Q N R D I L S I G L N * T T A G N M N N I E T * * L F V S I E V Csp6I |RsaI |SetI ||BsaXI ||| Hin4I ||| |AluI ||| |CviJI ||| || SetI Hin4I ||| || | MwoI BsaXI ||| || | | CviRI* \ \\\ \\ \ \ \ ACACATCGTCATATTCCTTACAGGGAGAACAAGTCCTTGACAGGTACAGCTCGTTATGCA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGTAGCAGTATAAGGAATGTCCCTCTTGTTCAGGAACTGTCCATGTCGAGCAATACGT / / / / /// / / / | BsaXI | | ||| | MwoI CviRI* Hin4I | | ||| CviJI | | ||| AluI | | ||SetI | | |Csp6I | | RsaI | BsaXI | Hin4I SetI T H R H I P Y R E N K S L T G T A R Y A H I V I F L T G R T S P * Q V Q L V M Q T S S Y S L Q G E Q V L D R Y S S L C K ----:----|----:----|----:----|----:----|----:----|----:----| V C R * I G * L S F L D K V P V A R * A C V D D Y E K C P S C T R S L Y L E N H C M T M N R V P L V L G Q C T C S T I C DdeI Ksp632I* | MboII | Hin4I | | TfiI SfaNI | Hin4I | | HinfI MaeI SetI \ \ \ \ \ \ \ \ AGTGTCAATACGCATCTTGGAATAGAGCAAAGTAGAAGAGATGACTTAGAATCACTAGGT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TCACAGTTATGCGTAGAACCTTATCTCGTTTCATCTTCTCTACTGAATCTTAGTGATCCA / / / / / / // | | Ksp632I* | | | |MaeI | Hin4I | | | SetI | Hin4I | | HinfI SfaNI | | TfiI | DdeI MboII S V N T H L G I E Q S R R D D L E S L G V S I R I L E * S K V E E M T * N H * V C Q Y A S W N R A K * K R * L R I T R L ----:----|----:----|----:----|----:----|----:----|----:----| L T L V C R P I S C L L L S S K S D S P L H * Y A D Q F L A F Y F L H S L I V L T D I R M K S Y L L T S S I V * F * * T FatI NcoI Hin4I StyI Hin4I SecI* Hpy178III* DsaI* | MboI |CviAII | | DpnI || NlaIII | | |BstKTI || | BsiYI* \ \ \\ \\ \ \ TATGTCTTGATCTATTTTTGTAAGGGTTCTTTGCCATGGCAGGGTTTGAAAGCAACCACC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| ATACAGAACTAGATAAAAACATTCCCAAGAAACGGTACCGTCCCAAACTTTCGTTGGTGG / /// / / // Hin4I ||| MboI | |DsaI* Hin4I ||DpnI | |SecI* |BstKTI | |StyI Hpy178III* | |NcoI | |FatI | BsiYI* | CviAII NlaIII Y V L I Y F C K G S L P W Q G L K A T T M S * S I F V R V L C H G R V * K Q P P C L D L F L * G F F A M A G F E S N H Q ----:----|----:----|----:----|----:----|----:----|----:----| * T K I * K Q L P E K G H C P K F A V V N H R S R N K Y P N K A M A P N S L L W I D Q D I K T L T R Q W P L T Q F C G G MboI TspEI | DpnI | MseI | |BstKTI | | AclI | || FatI | | MaeII | || |CviAII | | | SetI | || || NlaIII | | | TaiI \ \\ \\ \ \ \ \ \ AAGAAACAAAAGTATGATCGTATCATGGAAAAGAAATTAAACGTTAGCGTGGAAACTCTA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTGTTTTCATACTAGCATAGTACCTTTTCTTTAATTTGCAATCGCACCTTTGAGAT // / / // /// / || | | |FatI ||| MaeII || | | CviAII ||| AclI || | NlaIII ||TaiI || MboI ||SetI |DpnI |MseI BstKTI TspEI K K Q K Y D R I M E K K L N V S V E T L R N K S M I V S W K R N * T L A W K L Y E T K V * S Y H G K E I K R * R G N S M ----:----|----:----|----:----|----:----|----:----|----:----| L F C F Y S R I M S F F N F T L T S V R W S V F T H D Y * P F S I L R * R P F E L F L L I I T D H F L F * V N A H F S * Tsp4CI* ApoI SetI | ApoI TspEI |Hpy166II Hpy178III* CviJI | TspEI | TaqI \\ \ \ \ \ \ \ TGTTCAGGTTTACCATTAGAGTTTCAAGAATATATGGCTTACTGTAAGAATTTGAAATTC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| ACAAGTCCAAATGGTAATCTCAAAGTTCTTATATACCGAATGACATTCTTAAACTTTAAG / / / / / / / SetI Hpy166II | | Tsp4CI* TspEI TspEI | CviJI ApoI ApoI Hpy178III* C S G L P L E F Q E Y M A Y C K N L K F V Q V Y H * S F K N I W L T V R I * N S F R F T I R V S R I Y G L L * E F E I R ----:----|----:----|----:----|----:----|----:----|----:----| H E P K G N S N * S Y I A * Q L F K F N I N L N V M L T E L I Y P K S Y S N S I T * T * W * L K L F I H S V T L I Q F E CviJI | BseMII | |MseI | |BspCNI | ||AhaIII* | ||| MboI | ||| BglII | ||| XhoII | ||| | DpnI | ||| | |BstKTI | ||| | ||BaeI | ||| | ||DdeI | ||| | |||Hpy188I CviJI | ||| | |||| MseI MaeI \ \ \\\ \ \\\\ \ \ GATGAGAAGCCAGATTATTTGTTCTTGGCAAGGCTGTTTAAAGATCTGAGTATTAAACTA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTCTTCGGTCTAATAAACAAGAACCGTTCCGACAAATTTCTAGACTCATAATTTGAT / / / // /// // / / / / TaqI CviJI | || ||| || | DdeI MseI MaeI | || ||| || Hpy188I | || ||| || XhoII | || ||| || BglII | || ||| || MboI | || ||| |DpnI | || ||| BstKTI | || ||BaeI | || |MseI | || AhaIII* | |BspCNI | BseMII CviJI D E K P D Y L F L A R L F K D L S I K L M R S Q I I C S W Q G C L K I * V L N * * E A R L F V L G K A V * R S E Y * T R ----:----|----:----|----:----|----:----|----:----|----:----| S S F G S * K N K A L S N L S R L I L S R H S A L N N T R P L A T * L D S Y * V I L L W I I Q E Q C P Q K F I Q T N F * BaeI | TaqI MaeIII BccI \ \ \ \ GAGTATCACAACGACCACTTGTTCGATTGGACAATGTTGCGTTACACAAAGGCGATGGTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTCATAGTGTTGCTGGTGAACAAGCTAACCTGTTACAACGCAATGTGTTTCCGCTACCAC / / / / BaeI TaqI | BccI MaeIII E Y H N D H L F D W T M L R Y T K A M V S I T T T T C S I G Q C C V T Q R R W W V S Q R P L V R L D N V A L H K G D G G ----:----|----:----|----:----|----:----|----:----|----:----| S Y * L S W K N S Q V I N R * V F A I T L T D C R G S T R N S L T A N C L P S P L I V V V V Q E I P C H Q T V C L R H H BseRI BtgZI | AsuI* | AvaII | DraII TseI | PpuMI TaqI CviRI* | |NlaIV | MnlI |BisI | |BmgT120I | BslFI ||BlsI | || SetI | | MnlI SetI HphI ||BsrDI \ \\ \ \ \ \ \ \ \\\ GAGAAGCAAAGGGACCTCCTCATCGAAAAAGGTGATTTGAACGCAAATAGCAATGCAGCA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTCGTTTCCCTGGAGGAGTAGCTTTTTCCACTAAACTTGCGTTTATCGTTACGTCGT / / /// // / / / //// BseRI | ||PpuMI || | BslFI HphI |||BstAPI | ||DraII || | SetI |||MwoI | ||AvaII || MnlI |||TseI | ||AsuI* |TaqI ||BisI | |BmgT120I MnlI |BlsI | NlaIV CviRI* | SetI BsrDI BtgZI E K Q R D L L I E K G D L N A N S N A A R S K G T S S S K K V I * T Q I A M Q Q E A K G P P H R K R * F E R K * Q C S K ----:----|----:----|----:----|----:----|----:----|----:----| S F C L S R R M S F P S K F A F L L A A P S A F P G G * R F L H N S R L Y C H L L L L P V E E D F F T I Q V C I A I C C MwoI BstAPI | CviRI* | | BbvI Tsp4CI* | | MaeIII Hin4I | CviJI | | | Hin4I Eam1105I Hin4I | |FatI | | | Hin4I | Hpy188I | MseI | ||CviAII \ \ \ \ \ \ \ \ \ \\\ AGTGCAAGTAACAGCACAGACAACAAGTCTGAAACTTTCAACAAGATTAAACTGTTAGCC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TCACGTTCATTGTCGTGTCTGTTGTTCAGACTTTGAAAGTTGTTCTAATTTGACAATCGG // // / / / / / // |Hin4I |MaeIII | Hpy188I Hin4I | | |NlaIII |Hin4I BbvI Eam1105I Hin4I | | CviJI CviRI* | Tsp4CI* MseI S A S N S T D N K S E T F N K I K L L A V Q V T A Q T T S L K L S T R L N C * P C K * Q H R Q Q V * N F Q Q D * T V S H ----:----|----:----|----:----|----:----|----:----|----:----| L A L L L V S L L D S V K L L I L S N A L H L Y C C L C C T Q F K * C S * V T L T C T V A C V V L R F S E V L N F Q * G NlaIII | ApoI | XmnI BbvII* | TspEI | HphI | | TsoI | | MboII | | | MboII | | |TspDTI | | | |TspDTI TaqII | | || Ksp632I* \ \ \ \\ \ \ \ \\ \ ATGAAGAAATTCCCCACCCATTTCCACTATTACAAGAATGAAGACAAACATAATCCTTCA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTCTTTAAGGGGTGGGTAAAGGTGATAATGTTCTTACTTCTGTTTGTATTAGGAAGT // / // / / / / || | || TspDTI TaqII | TspDTI || | || MboII | BbvII* || | |TspEI | MboII || | |ApoI HphI || | TsoI || XmnI |FatI CviAII M K K F P T H F H Y Y K N E D K H N P S * R N S P P I S T I T R M K T N I I L H E E I P H P F P L L Q E * R Q T * S F T ----:----|----:----|----:----|----:----|----:----|----:----| M F F N G V W K W * * L F S S L C L G E W S S I G W G N G S N C S H L C V Y D K H L F E G G M E V I V L I F V F M I R * MboII Hin4II* | TseI | MboI | CviRI* MnlI | | DpnI | |BisI Ksp632I* | | |BstKTI | ||BlsI |BbvI | | || MboII Hpy178III* | |||CviJI || MnlI \ \ \\ \ \ \ \\\\ \\ \ CCAGAAGAGATCAAACAACAAACTATCTTGAATAATAATGCAGCCTCTTCTTTACCAGAG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTTCTCTAGTTTGTTGTTTGATAGAACTTATTATTACGTCGGAGAAGAAATGGTCTC / / // / / / / //// / // / | | || | MboII | | |||CviJI | || BbvI | | || MboI | | |||TseI | |Ksp632I* | | |DpnI | | ||BisI | MnlI | | BstKTI | | |BlsI MnlI | Hin4II* | | CviRI* Ksp632I* | MboII Hpy178III* P E E I K Q Q T I L N N N A A S S L P E Q K R S N N K L S * I I M Q P L L Y Q R R R D Q T T N Y L E * * C S L F F T R G ----:----|----:----|----:----|----:----|----:----|----:----| G S S I L C C V I K F L L A A E E K G S V L L S * V V F * R S Y Y H L R K K V L W F L D F L L S D Q I I I C G R R * W L TseI |BisI ||BlsI |||BspMI |||CviJI ||||AciI ||||BisI |||||BlsI ||||||TseI ||||||TauI ||||||MwoI |||||||BisI ||||||||BlsI |||||||||TseI |||||||||MwoI |||||||||Bce83I* ||||||||||BisI BsmAI |||||||||||BlsI TspEI MaeI SetI | SmlI ||||||||||||BbvI \ \ \ \ \ \\\\\\\\\\\\\ GAATTATTGAACGCACTAGATAAAGGTATGGAAAACTTGAGACAACAGCAGCCGCAGCAG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAATAACTTGCGTGATCTATTTCCATACCTTTTGAACTCTGTTGTCGTCGGCGTCGTC / / / / / //////////// TspEI MaeI SetI | SmlI |||||||||||TseI BsmAI ||||||||||BisI |||||||||BlsI ||||||||TseI |||||||BisI ||||||Bce83I* ||||||BspMI ||||||BlsI |||||MwoI |||||AciI ||||BisI |||BlsI ||CviJI ||MwoI ||TseI ||TauI |BisI BlsI E L L N A L D K G M E N L R Q Q Q P Q Q N Y * T H * I K V W K T * D N S S R S S I I E R T R * R Y G K L E T T A A A A A ----:----|----:----|----:----|----:----|----:----|----:----| S N N F A S S L P I S F K L C C C G C C P I I S R V L Y L Y P F S S V V A A A A F * Q V C * I F T H F V Q S L L L R L L MwoI | AluI | CviJI AsuI* | |SfeI* AvaII TseI | ||SetI CfrI |BmgT120I |BisI EcoP15I | ||| TseI BbvI ||SetI |EcoP15I | BbvI | ||| MwoI | BalI |||BbvI ||BlsI | |EcoP15I | ||| |BisI | CviJI |||| BbvI |||CviJI | || CviJI | ||| ||BlsI | HaeIII \\\\ \ \\\\ \ \\ \ \ \\\ \\\ \ \ CAGGTCCAAAGTTCGCAGCCACAACCACAGCCCCAACAGCTACAGCAGCAACCAAATGGC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCAGGTTTCAAGCGTCGGTGTTGGTGTCGGGGTTGTCGATGTCGTCGTTGGTTTACCG / /// / / /// / // / / / / / /// / | ||| | | ||EcoP15I | || | | | | | ||TseI HaeIII | ||| | | ||CviJI | || | | | | | |BisI CviJI | ||| | | ||TseI | || | | | | | BlsI BalI | ||| | | |BisI | || | | | | SfeI* | ||| | | BlsI | || | | | MwoI | ||| | BbvI | || | | CviJI | ||| BbvI | || | | AluI | ||AvaII | || | SetI | ||AsuI* | || MwoI | |BmgT120I | |BbvI | BbvI | EcoP15I SetI | CviJI EcoP15I Q V Q S S Q P Q P Q P Q Q L Q Q Q P N G R S K V R S H N H S P N S Y S S N Q M A G P K F A A T T T A P T A T A A T K W P ----:----|----:----|----:----|----:----|----:----|----:----| C T W L E C G C G C G W C S C C C G F P A P G F N A A V V V A G V A V A A V L H L D L T R L W L W L G L L * L L L W I A TspEI | EcoP15I | | Hpy178III* | | | MaeIII PsrI | | | Tsp4CI* | BbvI | | | | SfeI* | |TfiI | | | | | TseI | |HinfI | | | | | |BisI | || DdeI | |PsrI | | | ||BlsI | || | Hpy178III* \ \\ \ \ \ \\\ \ \\ \ \ CAAAGACCAAATTATTATCCTGAACCGTTACTACAGCAGCAACAAAGAGATTCTCAGGAG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCTGGTTTAATAATAGGACTTGGCAATGATGTCGTCGTTGTTTCTCTAAGAGTCCTC / / / / / / / / /// / / // BbvI | | | | | | | ||| PsrI | |Hpy178III* CfrI | | | | | | | ||TseI | DdeI | | | | | | | |BisI HinfI | | | | | | | BlsI BbvI | | | | | | SfeI* TfiI | | | | | MaeIII | | | | Tsp4CI* | | | Hpy178III* | | EcoP15I | TspEI PsrI Q R P N Y Y P E P L L Q Q Q Q R D S Q E K D Q I I I L N R Y Y S S N K E I L R S K T K L L S * T V T T A A T K R F S G A ----:----|----:----|----:----|----:----|----:----|----:----| W L G F * * G S G N S C C C C L S E * S G F V L N N D Q V T V V A A V F L N E P L S W I I I R F R * * L L L L S I R L L EcoP15I | TseI BssKI | MwoI EcoRII | BspCNI |SecI* | |BisI ||ScrFI | |BseMII ||BseBI | ||BlsI Hpy188I ||| CviJI BspCNI | ||| TsoI |BbvI ||| EcoP15I |BseMII | ||| | BccI || CviJI ||| | DdeI ||BciVI \ \\\ \ \ \\ \ \\\ \ \ \\\ CAACAGCAGCAAGTTCCGATGGCTACAACCAGGGCTACTCAGTATCCCCCACAAATAAAC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTCGTCGTTCAAGGCTACCGATGTTGGTCCCGATGAGTCATAGGGGGTGTTTATTTG /////// / / / / // / / // / ||||||| | | CviJI | || | DdeI || BciVI ||||||| | | BbvI | || EcoP15I |BseMII ||||||| | Hpy188I | |CviJI BspCNI ||||||| BccI | EcoRII ||||||TseI | BssKI |||||BisI | SecI* |||||TsoI BseBI ||||BlsI ScrFI |||EcoP15I ||BseMII |BspCNI MwoI Q Q Q Q V P M A T T R A T Q Y P P Q I N N S S K F R W L Q P G L L S I P H K * T T A A S S D G Y N Q G Y S V S P T N K Q ----:----|----:----|----:----|----:----|----:----|----:----| C C C C T G I A V V L A V * Y G G C I F A V A A L E S P * L W P * E T D G V F L L L L L N R H S C G P S S L I G W L Y V MnlI | MboI Csp6I | BglII |RsaI | XhoII || SfaNI | | DpnI TspEI || | SetI | | |BstKTI | MseI || | Hin4I | | || Bce83I* \ \ \\ \ \ \ \ \\ \ AGCAATAATTTTAATACTAATCAAGCATCTGTACCTCCACAAATGAGATCTAATCCACAA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTTATTAAAATTATGATTAGTTCGTAGACATGGAGGTGTTTACTCTAGATTAGGTGTT / / /// / / // // | MseI ||| | | || |Bce83I* TspEI ||| | | || XhoII ||| | | || BglII ||| | | || MboI ||| | | |DpnI ||| | | BstKTI ||| | MnlI ||| SfaNI ||Csp6I |RsaI |SetI Hin4I S N N F N T N Q A S V P P Q M R S N P Q A I I L I L I K H L Y L H K * D L I H N Q * F * Y * S S I C T S T N E I * S T T ----:----|----:----|----:----|----:----|----:----|----:----| L L L K L V L * A D T G G C I L D L G C C C Y N * Y * D L M Q V E V F S I * D V A I I K I S I L C R Y R W L H S R I W L AluI CviJI CviJI PvuII |AciI NspBII* |BisI | CfrI ||BlsI | SetI |||TauI | Cac8I |||| SmlI | | BalI |||| Hin4I | | CviJI |||| | Hpy178III* | | HaeIII |||| | | MnlI | | |BsrI TspEI \\\\ \ \ \ \ \ \\ \ CAGCCGCCTCAAGATAAACCAGCTGGCCAGTCAATTTGGTTGTAA 1450 1460 1470 1480 ----:----|----:----|----:----|----:----|----: GTCGGCGGAGTTCTATTTGGTCGACCGGTCAGTTAAACCAACATT //// / / / / /// / / |||AciI | | | | ||| CfrI TspEI ||BisI | | | | ||HaeIII |BlsI | | | | ||CviJI Hin4I | | | | ||BalI CviJI | | | | |BsrI TauI | | | | Cac8I | | | NspBII* | | | PvuII | | | CviJI | | | AluI | | SetI | MnlI Hpy178III* SmlI Q P P Q D K P A G Q S I W L * S R L K I N Q L A S Q F G C X A A S R * T S W P V N L V V X ----:----|----:----|----:----|----:----|----: C G G * S L G A P W D I Q N Y V A A E L Y V L Q G T L K T T L R R L I F W S A L * N P Q L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 4 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 2 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AhaIII* 1 DraI AluI 4 AluBI ApoI 4 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 2 MlsI,MluNI,MscI,Msp20I BbvI 9 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 5 Bce83I* 2 BpuEI BceAI 3 BciVI 1 BfuI BglII 2 BisI 11 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 11 BmgT120I 4 BsaXI 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 3 BseRI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BspCNI 3 BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstAPI 1 BstKTI 7 BstXI 1 BtgZI 1 Cac8I 2 BstC8I CfrI 2 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 2 CviQI,RsaNI CviAII 6 CviJI 20 CviKI-1 CviRI* 5 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 7 MalI DraII 1 EcoO109I DsaI* 3 BtgI,BstDSI Eam1105I 2 AspEI,BmeRI,DriI,AhdI EcoP15I 6 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FatI 6 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI Hin4I 8 Hin4II* 4 HpyAV HinfI 5 HphI 5 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 4 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 5 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 9 MfeI 1 MunI MlyI 1 SchI MnlI 8 MseI 10 Tru1I,Tru9I MwoI 9 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 6 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PleI 1 PpsI PpuMI 1 Psp5II,PspPPI PsrI 1 PvuII 1 RsaI 2 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 4 BseDI,BssECI,BsaJI SetI 16 SfaNI 2 LweI SfeI* 3 BstSFI,SfcI,BfmI SmlI 4 SmoI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 5 TaqII 2 TauI 2 TfiI 4 PfeI TseI 9 ApeKI TsoI 3 Tsp45I 2 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 6 TspEI 11 TasI,Tsp509I,Sse9I XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BamHI BarI BbvCI BcgI BclI BdaI BetI* BfiI BglI BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsePI BseSI BseYI BsgI BsiI* BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstEII BstZ17I BtrI BtsI CauII* Cfr10I Cfr9I CspCI DinI DraIII DrdI EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRI EcoT22I EgeI EheI Esp3I EspI* FalI FseI FspAI GlaI GsaI GsuI HaeII HgiAI* HgiCI* HgiJII* HhaI Hin6I HindII HindIII HinP1I HpaI HpaII Hpy99I HspAI KasI KpnI MauBI McrI* MluI MmeI Mph1103I MroNI MslI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TatI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769