Restriction Map of RAD53/YPL153C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RAD53/YPL153C on chromosome XVI from coordinates 264192 to 261727.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.4281

EMBOSS_001 Cac8I SetI SspI MwoI | CviJI | Bce83I* \ \ \ \ \ \ ATGGAAAATATTACACAACCCACACAGCAATCCACGCAGGCTACTCAAAGGTTTTTGATT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTTTATAATGTGTTGGGTGTGTCGTTAGGTGCGTCCGATGAGTTTCCAAAAACTAA / / / / / / SspI MwoI | CviJI SetI Bce83I* Cac8I M E N I T Q P T Q Q S T Q A T Q R F L I W K I L H N P H S N P R R L L K G F * L G K Y Y T T H T A I H A G Y S K V F D * ----:----|----:----|----:----|----:----|----:----|----:----| X S F I V C G V C C D V C A V * L N K I X P F Y * V V W V A I W A P * E F T K S H F I N C L G C L L G R L S S L P K Q N Csp6I SmlI |RsaI | Hpy178III* || SecI* | | MboI || DsaI* | | | DpnI || | FokI | | | |BstKTI CviRI* || | | BsgI \ \ \ \\ \ \\ \ \ \ GAGAAGTTTTCTCAAGAACAGATCGGCGAAAACATTGTGTGCAGGGTCATTTGTACCACG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTCAAAAGAGTTCTTGTCTAGCCGCTTTTGTAACACACGTCCCAGTAAACATGGTGC / // / / // / / | || MboI CviRI* || | DsaI* | |DpnI || | SecI* | BstKTI || BsgI Hpy178III* |Csp6I SmlI RsaI E K F S Q E Q I G E N I V C R V I C T T R S F L K N R S A K T L C A G S F V P R E V F S R T D R R K H C V Q G H L Y H G ----:----|----:----|----:----|----:----|----:----|----:----| S F N E * S C I P S F M T H L T M Q V V Q S T K E L V S R R F C Q T C P * K Y W L L K R L F L D A F V N H A P D N T G R AluI CviJI BseGI PvuII SmlI BinI* ApoI | Hpy188I NspBII* AflII | MboI TspEI | | BccI | SetI |MseI | | DpnI \ \ \ \ \ \ \\ \ \ \ GGTCAAATTCCCATCCGAGATTTGTCAGCTGATATTTCACAAGTGCTTAAGGAAAAACGA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGTTTAAGGGTAGGCTCTAAACAGTCGACTATAAAGTGTTCACGAATTCCTTTTTGCT / / / / / / // / // FokI TspEI | BccI | NspBII* || | |DpnI BseGI Hpy188I | PvuII || | BstKTI ApoI | CviJI || BinI* | AluI |AflII SetI |SmlI MseI G Q I P I R D L S A D I S Q V L K E K R V K F P S E I C Q L I F H K C L R K N D S N S H P R F V S * Y F T S A * G K T I ----:----|----:----|----:----|----:----|----:----|----:----| P * I G M R S K D A S I E C T S L S F R P D F E W G L N T L Q Y K V L A * P F V T L N G D S I Q * S I N * L H K L F F S BseYI | GsaI | CviJI | | MaeIII BstKTI | | Tsp45I XmnI \ \ \ \ \ TCCATAAAGAAAGTTTGGACATTTGGTAGAAACCCAGCCTGTGACTATCATTTAGGAAAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTATTTCTTTCAAACCTGTAAACCATCTTTGGGTCGGACACTGATAGTAAATCCTTTG / / / / / MboI | BseYI Tsp45I XmnI | CviJI MaeIII GsaI S I K K V W T F G R N P A C D Y H L G N P * R K F G H L V E T Q P V T I I * E T H K E S L D I W * K P S L * L S F R K H ----:----|----:----|----:----|----:----|----:----|----:----| D M F F T Q V N P L F G A Q S * * K P F I W L S L K S M Q Y F G L R H S D N L F G Y L F N P C K T S V W G T V I M * S V MaeIII BstEII Tsp4CI* |BbvII* Hpy178III* || MboII | Tsp4CI* MaeI || |SetI \ \ \ \\ \\ ATTTCAAGACTGTCAAATAAGCATTTCCAAATACTACTAGGAGAAGACGGTAACCTTTTA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGTTCTGACAGTTTATTCGTAAAGGTTTATGATGATCCTCTTCTGCCATTGGAAAAT / / / / / / | Tsp4CI* MaeI | | BbvII* Hpy178III* | | BstEII | | MaeIII | | MboII | SetI Tsp4CI* I S R L S N K H F Q I L L G E D G N L L F Q D C Q I S I S K Y Y * E K T V T F Y F K T V K * A F P N T T R R R R * P F I ----:----|----:----|----:----|----:----|----:----|----:----| M E L S D F L C K W I S S P S S P L R K C K L V T L Y A N G F V V L L L R Y G K N * S Q * I L M E L Y * * S F V T V K * TsoI | BsiYI* | | AsuI* | | AvaII | | DraII | | PpuMI | | |NlaIV | | |BmgT120I | | ||BssKI | | ||SexAI | | ||EcoRII | | ||| ScrFI | | ||| BseBI | | ||| |SetI TaqI | | ||| || MseI BslFI |Hpy178III* Bce83I* \ \ \\\ \\ \ \ \\ \ TTGAATGACATTTCCACTAATGGGACCTGGTTAAATGGGCAAAAAGTCGAGAAGAACAGC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTACTGTAAAGGTGATTACCCTGGACCAATTTACCCGTTTTTCAGCTCTTCTTGTCG // /// / / / / // / |BsiYI* ||| | | MseI BslFI || Bce83I* TsoI ||| | EcoRII |Hpy178III* ||| | SexAI TaqI ||| | BssKI ||| BseBI ||| ScrFI ||PpuMI ||DraII ||AvaII ||AsuI* |BmgT120I NlaIV SetI L N D I S T N G T W L N G Q K V E K N S * M T F P L M G P G * M G K K S R R T A E * H F H * W D L V K W A K S R E E Q Q ----:----|----:----|----:----|----:----|----:----|----:----| N F S M E V L P V Q N F P C F T S F F L I S H C K W * H S R T L H A F L R S S C Q I V N G S I P G P * I P L F D L L V A MboII | MaeIII | | AlwNI Hin4I | | | Tsp4CI* Hin4I | | | | SmlI | TfiI | | | | | AjuI HphI | AjuI | | | | | BsmAI | Tsp4CI* | HinfI | | | | | | SetI | | TspDTI | | Hpy188I \ \ \ \ \ \ \ \ \ \ \ \ \ AATCAGTTACTGTCTCAAGGTGATGAAATAACCGTTGGTGTAGGCGTGGAATCAGATATT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTCAATGACAGAGTTCCACTACTTTATTGGCAACCACATCCGCACCTTAGTCTATAA / / / / // / / / / / / // | | | AjuI || BsmAI | | | | AjuI |Hpy188I | | | |SmlI | | | Hin4I HinfI | | | SetI | | | Hin4I TfiI | | Tsp4CI* | | TspDTI | | MaeIII | Tsp4CI* | AlwNI HphI MboII N Q L L S Q G D E I T V G V G V E S D I I S Y C L K V M K * P L V * A W N Q I F S V T V S R * * N N R W C R R G I R Y F ----:----|----:----|----:----|----:----|----:----|----:----| L * N S D * P S S I V T P T P T S D S I C D T V T E L H H F L R Q H L R P I L Y I L * Q R L T I F Y G N T Y A H F * I N AvaI XhoI SmlI BtsI PspXI TspRI ApoI |TaqI Hin4I TspEI |BmeT110I TspDTI Hin4I | MseI || MnlI MboI \ \ \ \ \\ \ \ TTATCTCTGGTCATTTTCATAAACGACAAATTTAAGCAGTGCCTCGAGCAGAACAAAGTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AATAGAGACCAGTAAAAGTATTTGCTGTTTAAATTCGTCACGGAGCTCGTCTTGTTTCAA / / / / / // / TspDTI Hin4I | TspRI BtsI || MnlI Hin4I | MseI |PspXI TspEI |SmlI ApoI |XhoI |AvaI BmeT110I TaqI L S L V I F I N D K F K Q C L E Q N K V Y L W S F S * T T N L S S A S S R T K L I S G H F H K R Q I * A V P R A E Q S * ----:----|----:----|----:----|----:----|----:----|----:----| K D R T M K M F S L N L C H R S C F L T K I E P * K * L R C I * A T G R A S C L * R Q D N E Y V V F K L L A E L L V F N MnlI |AluI |CviJI MboI || SetI BglII || | BssKI XhoII || | EcoRII DpnI | DpnI || | | ScrFI |BstKTI | |BstKTI SetI SetI || | | BseBI \\ \ \\ \ \ \\ \ \ \ GATCGCATAAGATCTAACCTGAAAAATACCTCTAAAATAGCTTCTCCTGGTCTTACATCA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGCGTATTCTAGATTGGACTTTTTATGGAGATTTTATCGAAGAGGACCAGAATGTAGT // / // / / / / / / / || MboI || | SetI SetI | CviJI | EcoRII |DpnI || XhoII | AluI | BssKI BstKTI || BglII MnlI BseBI || MboI SetI ScrFI |DpnI BstKTI D R I R S N L K N T S K I A S P G L T S I A * D L T * K I P L K * L L L V L H H S H K I * P E K Y L * N S F S W S Y I I ----:----|----:----|----:----|----:----|----:----|----:----| S R M L D L R F F V E L I A E G P R V D Q D C L I * G S F Y R * F L K E Q D * M I A Y S R V Q F I G R F Y S R R T K C * SfaNI | CfrI | | BalI | | CviJI CviRI* | | HaeIII BsrI MseI TaqI \ \ \ \ \ \ \ TCTACTGCATCATCAATGGTGGCCAACAAGACTGGTATTTTTAAGGATTTTTCGATTATT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGACGTAGTAGTTACCACCGGTTGTTCTGACCATAAAAATTCCTAAAAAGCTAATAA / / / / / / / CviRI* | | CfrI BsrI MseI TaqI | HaeIII | CviJI | BalI SfaNI S T A S S M V A N K T G I F K D F S I I L L H H Q W W P T R L V F L R I F R L L Y C I I N G G Q Q D W Y F * G F F D Y * ----:----|----:----|----:----|----:----|----:----|----:----| D V A D D I T A L L V P I K L S K E I I M * Q M M L P P W C S Q Y K * P N K S * R S C * * H H G V L S T N K L I K R N N AsuI* |BmgT120I ||BssKI ||CviJI ||EcoRII ||HaeIII |||SecI* ||||ScrFI ||||BseBI CviRI* Tsp4CI* CviJI \\\\\ \ \ \ GACGAAGTGGTGGGCCAGGGTGCATTTGCCACAGTAAAGAAAGCCATTGAAAGAACTACT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTTCACCACCCGGTCCCACGTAAACGGTGTCATTTCTTTCGGTAACTTTCTTGATGA // / / / / / || | | CviRI* Tsp4CI* CviJI || | EcoRII || | BssKI || | SecI* || BseBI || ScrFI |AsuI* BmgT120I HaeIII CviJI D E V V G Q G A F A T V K K A I E R T T T K W W A R V H L P Q * R K P L K E L L R S G G P G C I C H S K E S H * K N Y W ----:----|----:----|----:----|----:----|----:----|----:----| S S T T P W P A N A V T F F A M S L V V Q R L P P G P H M Q W L L S L W Q F F * V F H H A L T C K G C Y L F G N F S S S PsiI BsrI | HphI BseGI | XmnI AciI | | MboII MaeIII | |BfiI FnuDII* | | |Hpy166II BccI Tsp45I \ \\ \ \ \ \\ \ \ GGGAAAACATTCGCGGTGAAGATTATAAGTAAACGCAAAGTAATAGGCAATATGGATGGT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CCCTTTTGTAAGCGCCACTTCTAATATTCATTTGCGTTTCATTATCCGTTATACCTACCA / / / / // / / / / BsrI BfiI | AciI || | Hpy166II BccI BseGI XmnI FnuDII* || MboII |HphI PsiI G K T F A V K I I S K R K V I G N M D G G K H S R * R L * V N A K * * A I W M V E N I R G E D Y K * T Q S N R Q Y G W C ----:----|----:----|----:----|----:----|----:----|----:----| P F V N A T F I I L L R L T I P L I S P Q S F M R P S S * L Y V C L L L C Y P H P F C E R H L N Y T F A F Y Y A I H I T FokI |CviRI* || AluI || CviJI || | SetI || | | BseGI || | | | StyI Csp6I FokI || | | | SecI* |RsaI \ \\ \ \ \ \ \\ GTGACAAGAGAGTTAGAAGTATTGCAAAAGCTCAATCATCCAAGGATAGTACGATTGAAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CACTGTTCTCTCAATCTTCATAACGTTTTCGAGTTAGTAGGTTCCTATCATGCTAACTTT / / / // / / / // | FokI | || | BseGI SecI* |Csp6I Tsp45I | || CviJI StyI RsaI MaeIII | || AluI | |SetI | FokI CviRI* V T R E L E V L Q K L N H P R I V R L K * Q E S * K Y C K S S I I Q G * Y D * K D K R V R S I A K A Q S S K D S T I E R ----:----|----:----|----:----|----:----|----:----|----:----| T V L S N S T N C F S L * G L I T R N F H S L L T L L I A F A * D D L S L V I S H C S L * F Y Q L L E I M W P Y Y S Q F BseMII MboII MaeIII |BspCNI DdeI |TspDTI BccI HphI Tsp45I \\ \ \\ \ \ \ GGATTTTATGAAGATACTGAGAGTTATTATATGGTGATGGAGTTCGTTTCTGGTGGTGAC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAAAATACTTCTATGACTCTCAATAATATACCACTACCTCAAGCAAAGACCACCACTG // // / / / |BspCNI |TspDTI BccI HphI Tsp45I BseMII |MboII MaeIII DdeI G F Y E D T E S Y Y M V M E F V S G G D D F M K I L R V I I W * W S S F L V V T I L * R Y * E L L Y G D G V R F W W * L ----:----|----:----|----:----|----:----|----:----|----:----| P N * S S V S L * * I T I S N T E P P S L I K H L Y Q S N N Y P S P T R K Q H H S K I F I S L T I I H H H L E N R T T V MmeI | TseI | |BisI | ||BlsI | ||| FatI | ||| |CviAII EcoRV | ||| || MwoI MnlI | BssKI MseI | ||| || NlaIII | BseYI | EcoRII | BbvI | ||| || | AciI | | GsaI | | ScrFI | | HphI | ||| || | | SfaNI | | | MboII | | BseBI \ \ \ \ \\\ \\ \ \ \ \ \ \ \ \ \ \ TTAATGGATTTTGTTGCTGCTCATGGTGCGGTTGGAGAAGATGCTGGGAGGGAGATATCC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AATTACCTAAAACAACGACGAGTACCACGCCAACCTCTTCTACGACCCTCCCTCTATAGG / // / /// // // / / / / // / | || MmeI ||| || |FatI | SfaNI | | |MboII EcoRV | |BbvI ||| || | AciI | | BseYI | HphI ||| || CviAII | GsaI MseI ||| |MwoI MnlI ||| NlaIII ||TseI |BisI BlsI L M D F V A A H G A V G E D A G R E I S * W I L L L L M V R L E K M L G G R Y P N G F C C C S W C G W R R C W E G D I Q ----:----|----:----|----:----|----:----|----:----|----:----| K I S K T A A * P A T P S S A P L S I D S L P N Q Q Q E H H P Q L L H Q S P S I * H I K N S S M T R N S F I S P P L Y G CviJI | SfaNI | | MaeIII | | Tsp45I | | Hpy178III* | | | BccI | | | | SetI \ \ \ \ \ AGGCAGATACTCACAGCAATAAAATACATTCACTCTATGGGCATCAGCCATCGTGACCTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCCGTCTATGAGTGTCGTTATTTTATGTAAGTGAGATACCCGTAGTCGGTAGCACTGGAT / / / // / | EcoRII CviJI || Tsp45I | BssKI || MaeIII BseBI || BccI ScrFI |SetI Hpy178III* SfaNI R Q I L T A I K Y I H S M G I S H R D L G R Y S Q Q * N T F T L W A S A I V T * A D T H S N K I H S L Y G H Q P S * P K ----:----|----:----|----:----|----:----|----:----|----:----| L C I S V A I F Y M * E I P M L W R S R W A S V * L L L I C E S * P C * G D H G P L Y E C C Y F V N V R H A D A M T V * BinI* | MboI | | DpnI CviJI SspI | | |BstKTI PshAI \ \ \ \ \\ \ AAGCCCGATAATATTCTTATTGAACAAGACGATCCTGTATTGGTAAAGATAACCGACTTT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGGGCTATTATAAGAATAACTTGTTCTGCTAGGACATAACCATTTCTATTGGCTGAAA / / / // / / CviJI SspI | || MboI PshAI | |DpnI | BstKTI BinI* K P D N I L I E Q D D P V L V K I T D F S P I I F L L N K T I L Y W * R * P T L A R * Y S Y * T R R S C I G K D N R L W ----:----|----:----|----:----|----:----|----:----|----:----| F G S L I R I S C S S G T N T F I V S K L A R Y Y E * Q V L R D Q I P L S L R S L G I I N K N F L V I R Y Q Y L Y G V K TatI |Csp6I XmnI TspDTI ||RsaI | SetI | Hin4II* NdeI \\\ \ \ \ \ \ GGTCTGGCAAAAGTACAAGGAAATGGGTCTTTTATGAAAACCTTCTGTGGCACTTTGGCA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGACCGTTTTCATGTTCCTTTACCCAGAAAATACTTTTGGAAGACACCGTGAAACCGT /// // / / ||TatI |XmnI | Hin4II* |Csp6I SetI TspDTI RsaI G L A K V Q G N G S F M K T F C G T L A V W Q K Y K E M G L L * K P S V A L W H S G K S T R K W V F Y E N L L W H F G I ----:----|----:----|----:----|----:----|----:----|----:----| P R A F T C P F P D K I F V K Q P V K A Q D P L L V L F H T K * S F R R H C K P T Q C F Y L S I P R K H F G E T A S Q C FokI |Hpy188I ||BaeI ||BaeI MwoI ||| SetI | HgiCI* ||| TspGWI | | NlaIV ||| | Eco57I Hpy178III* | | | SetI ||| | Eco57MI | BaeI | | | | MnlI ||| | | BseGI | BaeI \ \ \ \ \ \\\ \ \ \ \ \ TATGTGGCACCTGAAGTCATCAGAGGTAAAGATACATCCGTATCTCCTGATGAATACGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| ATACACCGTGGACTTCAGTAGTCTCCATTTCTATGTAGGCATAGAGGACTACTTATGCTT // / / / / / / / / / / / |NdeI | | | | | | | | BseGI | BaeI MwoI | | | | | | | Eco57MI | BaeI | | | | | | | Eco57I Hpy178III* | | | | | | TspGWI | | | | | | FokI | | | | | SetI | | | | Hpy188I | | | BaeI | | | BaeI | | MnlI | HgiCI* NlaIV SetI Y V A P E V I R G K D T S V S P D E Y E M W H L K S S E V K I H P Y L L M N T K C G T * S H Q R * R Y I R I S * * I R R ----:----|----:----|----:----|----:----|----:----|----:----| Y T A G S T M L P L S V D T D G S S Y S M H P V Q L * * L Y L Y M R I E Q H I R I H C R F D D S T F I C G Y R R I F V F TspDTI | MboII | | MboII | | |TatI BseGI | | ||Csp6I Hin4I | Hin4I | | |||RsaI Hin4I | Hin4I | | |||ScaI | Ksp632I* TstI | | FokI \ \ \\\\ \ \ \ \ \ \ GAAAGGAATGAGTACTCTTCGTTAGTGGATATGTGGTCAATGGGATGTCTTGTGTATGTT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCCTTACTCATGAGAAGCAATCACCTATACACCAGTTACCCTACAGAACACATACAA / / / /// / / // / | | | ||TatI | TstI |BseGI FokI | | | |Csp6I Ksp632I* Hin4I | | | |Hin4I Hin4I | | | |Hin4I | | | ScaI | | | RsaI | | MboII | MboII TspDTI E R N E Y S S L V D M W S M G C L V Y V K G M S T L R * W I C G Q W D V L C M L K E * V L F V S G Y V V N G M S C V C Y ----:----|----:----|----:----|----:----|----:----|----:----| S L F S Y E E N T S I H D I P H R T Y T L F S H T S K T L P Y T T L P I D Q T H F P I L V R R * H I H P * H S T K H I N TstI | AsuI* AsuI* | |BmgT120I AvaII | ||CviJI SetI |BmgT120I Ksp632I* | ||HaeIII | BsiYI* || TspEI |MnlI \ \\\ \ \ \\ \ \\ ATCCTAACGGGCCACTTACCTTTTAGTGGTAGCACACAGGACCAATTATATAAACAGATT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGATTGCCCGGTGAATGGAAAATCACCATCGTGTGTCCTGGTTAATATATTTGTCTAA / // / / // / / / TstI || SetI BsiYI* || TspEI | Ksp632I* |AsuI* |AvaII MnlI BmgT120I |AsuI* HaeIII BmgT120I CviJI I L T G H L P F S G S T Q D Q L Y K Q I S * R A T Y L L V V A H R T N Y I N R L P N G P L T F * W * H T G P I I * T D W ----:----|----:----|----:----|----:----|----:----|----:----| I R V P W K G K L P L V C S W N Y L C I * G L P G S V K * H Y C V P G I I Y V S D * R A V * R K T T A C L V L * I F L N CviJI | Hin4II* | |MboII | ||FatI | ||BspHI | |||CviAII | |||Hpy178III* | |||| NlaIII | |||| | AsuI* | |||| | DraII | |||| | Bsp120I | |||| | |AsuI* | |||| | |DraII | |||| | |BmgT120I | |||| | ||CviJI | |||| | ||NlaIV | |||| | ||HaeIII | |||| | ||BmgT120I | |||| | |||NlaIV | |||| | ||||ApaI | |||| | ||||SduI | |||| | ||||BseSI | |||| | ||||HgiJII* | |||| | ||||| TspDTI | |||| | ||||| | MnlI | |||| | ||||| | |BetI* | |||| | ||||| | |BspMII* | |||| | ||||| | ||HpaII | |||| | ||||| | ||Hpy178III* | |||| | ||||| | ||| EcoRV | |||| | ||||| | ||| | Hpy188I | |||| | ||||| | ||| | | TspDTI \ \\\\ \ \\\\\ \ \\\ \ \ \ GGAAGAGGCTCATATCATGAAGGGCCCCTCAAAGATTTCCGGATATCTGAAGAAGCAAGA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTCTCCGAGTATAGTACTTCCCGGGGAGTTTCTAAAGGCCTATAGACTTCTTCGTTCT / // / // / /// / / // / / / / | || | || | ||| | MnlI || | | TspDTI TspDTI | || | || | ||| TspDTI || | Hpy188I MboII | || | || | ||Bsp120I || EcoRV | || | || | ||DraII |BspMII* | || | || | ||AsuI* |BetI* | || | || | |BmgT120I Hpy178III* | || | || | |DraII HpaII | || | || | |AsuI* | || | || | |NlaIV | || | || | BmgT120I | || | || | HaeIII | || | || | NlaIV | || | || | CviJI | || | || HgiJII* | || | || BseSI | || | || SduI | || | || ApaI | || | |BspHI | || | |FatI | || | Hpy178III* | || | CviAII | || NlaIII | |MboII | Hin4II* CviJI G R G S Y H E G P L K D F R I S E E A R E E A H I M K G P S K I S G Y L K K Q E K R L I S * R A P Q R F P D I * R S K R ----:----|----:----|----:----|----:----|----:----|----:----| P L P E Y * S P G R L S K R I D S S A L Q F L S M D H L A G * L N G S I Q L L L S S A * I M F P G E F I E P Y R F F C S SalI |TaqI |AccI |SetI ||HindII ||Hpy166II ||| TseI MaeIII ||| AluI | BinI* ||| CviJI | | SetI ||| PvuII | | |MboI ||| NspBII* | | |BamHI ||| |BisI MboII | | |XhoII ||| ||BlsI |TspDTI | | || DpnI ||| ||SetI || Eco57I | | || NlaIV ||| |||CviRI* || Eco57MI | | || |BstKTI ||| ||||FokI || | TfiI | | || || BinI* ||| ||||| MwoI || | HinfI | | || || |BbvI ||| ||||| | CviJI \\ \ \ \ \ \\ \\ \\ \\\ \\\\\ \ \ GATTTCATAGATTCATTGTTACAGGTGGATCCAAATAATAGGTCGACAGCTGCAAAAGCC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAAGTATCTAAGTAACAATGTCCACCTAGGTTTATTATCCAGCTGTCGACGTTTTCGG / / // // / / // //// //// // | HinfI || || | | || |||| |||| |CviJI | TfiI || || | | || |||| |||| FokI Eco57MI || || | | || |||| |||CviRI* Eco57I || || | | || |||| |||MwoI || || | | || |||| |||TseI || || | | || |||| ||BisI || || | | || |||| |BlsI || || | | || |||| NspBII* || || | | || |||| PvuII || || | | || |||| CviJI || || | | || |||| AluI || || | | || |||SetI || || | | || ||SalI || || | | || |AccI || || | | || |TaqI || || | | || Hpy166II || || | | || HindII || || | | |BbvI || || | | SetI || || | BinI* || || XhoII || || BamHI || || MboI || |NlaIV || |DpnI || BstKTI |BinI* MaeIII SetI D F I D S L L Q V D P N N R S T A A K A I S * I H C Y R W I Q I I G R Q L Q K P F H R F I V T G G S K * * V D S C K S L ----:----|----:----|----:----|----:----|----:----|----:----| S K M S E N N C T S G F L L D V A A F A L N * L N M T V P P D L Y Y T S L Q L L I E Y I * Q * L H I W I I P R C S C F G TfiI HinfI | BseGI | | BssKI | | SecI* | | EcoRII | | | ScrFI | | | BseBI | | | | MboI | | | | | DpnI PleI | | | | | |BstKTI |MlyI | | | | | ||Hpy178III* || CviJI | | | | | ||| BinI* || | SduI | | | | | ||| | HinfI || | HgiJII* NdeI \ \ \ \ \ \\\ \ \ \\ \ \ \ TTGAATCATCCCTGGATCAAGATGAGTCCATTGGGCTCACAATCATATGGTGATTTTTCA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTAGTAGGGACCTAGTTCTACTCAGGTAACCCGAGTGTTAGTATACCACTAAAAAGT / / //// / / / / / / / / | HinfI |||| | | | HinfI | CviJI NdeI HphI | TfiI |||| | | BinI* HgiJII* BseGI |||| | Hpy178III* PleI |||| MboI MlyI |||DpnI SduI ||EcoRII ||BstKTI ||BssKI |SecI* BseBI ScrFI L N H P W I K M S P L G S Q S Y G D F S * I I P G S R * V H W A H N H M V I F H E S S L D Q D E S I G L T I I W * F F T ----:----|----:----|----:----|----:----|----:----|----:----| K F * G Q I L I L G N P E C D Y P S K E R S D D R S * S S D M P S V I M H H N K Q I M G P D L H T W Q A * L * I T I K * TseI |BisI TspEI HphI ||BlsI | BbvI SfaNI EcoP15I \ \\\ \ \ \ \ CAAATATCCTTATCACAATCGTTGTCGCAGCAGAAATTATTAGAAAATATGGACGATGCT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTATAGGAATAGTGTTAGCAACAGCGTCGTCTTTAATAATCTTTTATACCTGCTACGA /// / / / / ||TseI | BbvI SfaNI EcoP15I |BisI TspEI BlsI Q I S L S Q S L S Q Q K L L E N M D D A K Y P Y H N R C R S R N Y * K I W T M L N I L I T I V V A A E I I R K Y G R C S ----:----|----:----|----:----|----:----|----:----|----:----| C I D K D C D N D C C F N N S F I S S A V F I R I V I T T A A S I I L F Y P R H L Y G * * L R Q R L L F * * F I H V I S Hin6I ApoI |GlaI Hpy178III* TspEI ||HhaI TspEI | MboI \ \\\ \ \ \ CAATACGAATTTGTCAAAGCGCAAAGGAAATTACAAATGGAGCAACAACTTCAAGAACAG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GTTATGCTTAAACAGTTTCGCGTTTCCTTTAATGTTTACCTCGTTGTTGAAGTTCTTGTC / /// / / TspEI ||Hin6I TspEI Hpy178III* ApoI |GlaI HhaI Q Y E F V K A Q R K L Q M E Q Q L Q E Q N T N L S K R K G N Y K W S N N F K N R I R I C Q S A K E I T N G A T T S R T G ----:----|----:----|----:----|----:----|----:----|----:----| * Y S N T L A C L F N C I S C C S * S C E I R I Q * L A F S I V F P A V V E L V L V F K D F R L P F * L H L L L K L F L DpnI |BstKTI ||Hpy178III* ||| BinI* ||| | BccI ||| | | BbvII* ||| | | | MboII ||| | | | | ApoI MseI ||| | | | | TspEI |AhaIII* AciI FauI TaqI \\\ \ \ \ \ \ \\ \ \ \ GATCAGGAAGACCAAGATGGAAAAATTCAAGGATTTAAAATACCCGCACACGCCCCTATT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGTCCTTCTGGTTCTACCTTTTTAAGTTCCTAAATTTTATGGGCGTGTGCGGGGATAA // / / / / / / // / / || | | | BccI BbvII* TspEI |MseI AciI FauI || | | BinI* MboII ApoI AhaIII* || | Hpy178III* || MboI |DpnI BstKTI D Q E D Q D G K I Q G F K I P A H A P I I R K T K M E K F K D L K Y P H T P L F S G R P R W K N S R I * N T R T R P Y S ----:----|----:----|----:----|----:----|----:----|----:----| S * S S W S P F I * P N L I G A C A G I P D P L G L H F F E L I * F V R V R G * I L F V L I S F N L S K F Y G C V G R N BseMII CviJI MaeI |BspCNI \ \ \\ CGATATACACAGCCCAAAAGCATTGAAGCAGAAACTAGAGAACAAAAACTTTTACATTCC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GCTATATGTGTCGGGTTTTCGTAACTTCGTCTTTGATCTCTTGTTTTTGAAAATGTAAGG / / / // TaqI CviJI MaeI |BspCNI BseMII R Y T Q P K S I E A E T R E Q K L L H S D I H S P K A L K Q K L E N K N F Y I P I Y T A Q K H * S R N * R T K T F T F Q ----:----|----:----|----:----|----:----|----:----|----:----| R Y V C G L L M S A S V L S C F S K C E E I Y V A W F C Q L L F * L V F V K V N S I C L G F A N F C F S S F L F K * M G Hpy178III* | AluI | CviJI | Ecl136II | | SetI | | SduI | | SacI | | HgiAI* SetI MseI DdeI | | HgiJII* | MseI |AhaIII* \ \ \ \ \ \ \\ AATAATACTGAGAATGTCAAGAGCTCAAAGAAAAAGGGTAATGGTAGGTTTTTAACTTTA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTATGACTCTTACAGTTCTCGAGTTTCTTTTTCCCATTACCATCCAAAAATTGAAAT / // / / / // DdeI || Ecl136II SetI MseI |MseI || CviJI AhaIII* || AluI |HgiJII* |HgiAI* |SacI |SduI |SetI Hpy178III* N N T E N V K S S K K K G N G R F L T L I I L R M S R A Q R K R V M V G F * L * * Y * E C Q E L K E K G * W * V F N F K ----:----|----:----|----:----|----:----|----:----|----:----| L L V S F T L L E F F F P L P L N K V K W Y Y Q S H * S S L S F P Y H Y T K L K I I S L I D L A * L F L T I T P K * S * Hpy178III* | BssKI | CviJI SetI | EcoRII | TfiI | | ScrFI | HinfI | | BseBI | TspDTI | | | TfiI | |GsuI BsrDI | | | HinfI | |Eco57MI \ \ \ \ \ \ \\ AAACCATTGCCTGACAGCATTATTCAAGAAAGCCTGGAGATTCAGCAAGGTGTGAATCCA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGTAACGGACTGTCGTAATAAGTTCTTTCGGACCTCTAAGTCGTTCCACACTTAGGT / / / / / / / // / BsrDI | | | | | SetI || HinfI | | | | HinfI || TfiI | | | | TfiI |Eco57MI | | | EcoRII |GsuI | | | BssKI TspDTI | | BseBI | | ScrFI | CviJI Hpy178III* K P L P D S I I Q E S L E I Q Q G V N P N H C L T A L F K K A W R F S K V * I H T I A * Q H Y S R K P G D S A R C E S I ----:----|----:----|----:----|----:----|----:----|----:----| F G N G S L M I * S L R S I * C P T F G L V M A Q C C * E L F G P S E A L H S D F W Q R V A N N L F A Q L N L L T H I W BcgI BbvII* | SetI | MboII | TspDTI BinI* | | AvaI | MnlI | | XhoI | |MboI | | SmlI | |XhoII | | Hpy178III* | || DpnI | | |TaqI | || |BstKTI CviRI* | | |BmeT110I | || ||SecI* |MfeI | | || BsmAI | || |||Hpy188I |TspEI TspEI | | || |TspDTI \ \\ \\\\ \\ \ \ \ \\ \\ TTTTTCATTGGTAGATCCGAGGATTGCAATTGTAAAATTGAAGACAATAGGTTGTCTCGA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAAGTAACCATCTAGGCTCCTAACGTTAACATTTTAACTTCTGTTATCCAACAGAGCT / / // / / / / / / / // /// | | || | | | TspEI TspEI | | |BbvII* ||SmlI | | || | | | MfeI | | |MboII ||XhoI | | || | | CviRI* | | TspDTI ||AvaI | | || | SecI* | SetI |BmeT110I | | || Hpy188I BcgI |TaqI | | || XhoII Hpy178III* | | || MboI TspDTI | | |DpnI | | BstKTI | MnlI BinI* F F I G R S E D C N C K I E D N R L S R F S L V D P R I A I V K L K T I G C L E F H W * I R G L Q L * N * R Q * V V S S ----:----|----:----|----:----|----:----|----:----|----:----| N K M P L D S S Q L Q L I S S L L N D R M K * Q Y I R P N C N Y F Q L C Y T T E K E N T S G L I A I T F N F V I P Q R S FatI |CviAII FatI ||Cac8I |CviAII ||| SphI || NspI ||| NspI || NlaIII MnlI ||| NlaIII || | TfiI BsrDI | BcgI ||| |SfeI* || | HinfI HpaII \ \ \ \\\ \\ \\ \ \ \ GTTCATTGCTTCATTTTCAAAAAGAGGCATGCTGTAGGCAAAAGCATGTATGAATCTCCG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGTAACGAAGTAAAAGTTTTTCTCCGTACGACATCCGTTTTCGTACATACTTAGAGGC / / / / / /// / / // / / | BsmAI | BcgI | ||FatI SfeI* | |FatI | HpaII BsrDI MnlI | |CviAII | CviAII HinfI | Cac8I NlaIII TfiI NlaIII NspI NspI SphI V H C F I F K K R H A V G K S M Y E S P F I A S F S K R G M L * A K A C M N L R S L L H F Q K E A C C R Q K H V * I S G ----:----|----:----|----:----|----:----|----:----|----:----| T * Q K M K L F L C A T P L L M Y S D G L E N S * K * F S A H Q L C F C T H I E N M A E N E F L P M S Y A F A H I F R R MaeII | SetI | TaiI | | AluI | | CviJI | | | SetI BsiYI* | | | | MseI |TspDTI BetI* | | | | |SwaI || SetI TstI |HpaII | | | | |AhaIII* \\ \ \ \\ \ \ \ \ \\ GCACAAGGTTTAGATGATATTTGGTATTGCCACACCGGAACTAACGTGAGCTATTTAAAT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGTTCCAAATCTACTATAAACCATAACGGTGTGGCCTTGATTGCACTCGATAAATTTA / / / / // / / / / // | | SetI TstI || | | | CviJI |MseI | TspDTI || | | | AluI AhaIII* BsiYI* || | | SetI TstI || | MaeII SwaI || TaiI || SetI |BetI* HpaII A Q G L D D I W Y C H T G T N V S Y L N H K V * M I F G I A T P E L T * A I * I T R F R * Y L V L P H R N * R E L F K * ----:----|----:----|----:----|----:----|----:----|----:----| A C P K S S I Q Y Q W V P V L T L * K F P V L N L H Y K T N G C R F * R S S N L C L T * I I N P I A V G S S V H A I * I Hpy178III* AciI Csp6I | MboI | FatI |RsaI | TspGWI | |CviAII || ApoI | | DpnI TstI | || NlaIII || TspEI Hin4I | | |BstKTI \ \ \\ \ \\ \ \ \ \ \\ AATAACCGCATGATACAGGGTACGAAATTCCTTTTACAAGACGGAGATGAAATCAAGATC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTGGCGTACTATGTCCCATGCTTTAAGGAAAATGTTCTGCCTCTACTTTAGTTCTAG / // // // / /// / | |FatI |Csp6I |Hin4I | ||| TspDTI | CviAII RsaI TspEI | ||| MboI NlaIII ApoI | ||DpnI AciI | |BstKTI | Hpy178III* TspGWI N N R M I Q G T K F L L Q D G D E I K I I T A * Y R V R N S F Y K T E M K S R S * P H D T G Y E I P F T R R R * N Q D H ----:----|----:----|----:----|----:----|----:----|----:----| L L R M I C P V F N R K C S P S S I L I Y Y G C S V P Y S I G K V L R L H F * S I V A H Y L T R F E K * L V S I F D L D CviJI TspDTI ApoI | MseI TspEI | Hin4I TspEI | |AhaIII* | MseI SfeI* \ \ \ \ \\ \ \ \ ATTTGGGATAAAAACAATAAATTTGTCATTGGCTTTAAAGTGGAAATTAACGATACTACA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TAAACCCTATTTTTGTTATTTAAACAGTAACCGAAATTTCACCTTTAATTGCTATGATGT / / / // // // Hin4I TspEI | |MseI |MseI |SfeI* ApoI | AhaIII* TspEI SetI CviJI I W D K N N K F V I G F K V E I N D T T F G I K T I N L S L A L K W K L T I L Q L G * K Q * I C H W L * S G N * R Y Y R ----:----|----:----|----:----|----:----|----:----|----:----| M Q S L F L L N T M P K L T S I L S V V * K P Y F C Y I Q * Q S * L P F * R Y * N P I F V I F K D N A K F H F N V I S C TatI |Csp6I ||RsaI ||ScaI SetI ||| SmlI | MnlI SetI ||| AflII | | MseI | MaeIII ||| |MseI \ \ \ \ \ \\\ \\ GGTCTGTTTAACGAGGGATTAGGTATGTTACAAGAACAAAGAGTAGTACTTAAGCAAACA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGACAAATTGCTCCCTAATCCATACAATGTTCTTGTTTCTCATCATGAATTCGTTTGT / / / / /// // MnlI MseI SetI MaeIII ||| |AflII ||| |SmlI ||| MseI ||TatI |Csp6I ScaI RsaI G L F N E G L G M L Q E Q R V V L K Q T V C L T R D * V C Y K N K E * Y L S K Q S V * R G I R Y V T R T K S S T * A N S ----:----|----:----|----:----|----:----|----:----|----:----| P R N L S P N P I N C S C L T T S L C V L D T * R P I L Y T V L V F L L V * A F T Q K V L S * T H * L F L S Y Y K L L C PflMI BsiYI* | TseI | |BisI | ||BlsI | |||AluI | |||CviJI | |||NmeAIII MseI | |||| SetI |HpaI | |||| | MaeII |HindII | |||| | |MwoI |Hpy166II | |||| | || SetI ||HphI | |||| | || TaiI ||Hin4I | |||| | || |BbvI CviJI MboII ||| BccI | |||| | || |CviRI* \ \ \\\ \ \ \\\\ \ \\ \\ GCCGAAGAAAAAGATTTGGTGAAAAAGTTAACCCAGATGATGGCAGCTCAACGTGCAAAT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCTTCTTTTTCTAAACCACTTTTTCAATTGGGTCTACTACCGTCGAGTTGCACGTTTA / / / // / / /// // / / / / CviJI MboII | || | BsiYI* ||| || | | | BbvI | || | PflMI ||| || | | Hin4I | || BccI ||| || | CviRI* | |MseI ||| || MaeII | Hpy166II ||| |TaiI | HindII ||| |SetI | HphI ||| MwoI | HpaI ||CviJI Hin4I ||TseI ||AluI |BisI NmeAIII BlsI SetI A E E K D L V K K L T Q M M A A Q R A N P K K K I W * K S * P R * W Q L N V Q I R R K R F G E K V N P D D G S S T C K S ----:----|----:----|----:----|----:----|----:----|----:----| A S S F S K T F F N V W I I A A * R A F L R L F L N P S F T L G S S P L E V H L G F F F I Q H F L * G L H H C S L T C I Hin4I | MboII CviJI | SecI* |AciI | | MboII |BisI | | TspDTI ||BlsI | | | CviJI CviJI |||TauI | | | | MnlI |DdeI ||||BsrI \ \ \ \ \ \\ \\\\\ CAACCCTCGGCTTCTTCTTCATCAATGTCGGCTAAGAAGCCGCCAGTTAGCGATACAAAT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGGGAGCCGAAGAAGAAGTAGTTACAGCCGATTCTTCGGCGGTCAATCGCTATGTTTA / // // / / / //// | || || MnlI | | |||AciI | || |CviJI | | ||BisI | || SecI* | | ||BsrI | |MboII | | |BlsI | TspDTI | | CviJI MboII | | TauI | DdeI CviJI Q P S A S S S S M S A K K P P V S D T N N P R L L L H Q C R L R S R Q L A I Q I T L G F F F I N V G * E A A S * R Y K * ----:----|----:----|----:----|----:----|----:----|----:----| * G E A E E E D I D A L F G G T L S V F D V R P K K K M L T P * S A A L * R Y L L G R S R R * * H R S L L R W N A I C I PleI Csp6I HinfI |MlyI |RsaI |MaeIII ||MseI TspEI ||BceAI HphI |Tsp45I ||VspI \ \\\ \ \\ \\\ AATAACGGCAATAATTCGGTACTAAACGACTTGGTAGAGTCACCGATTAATGCGAATACG 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTGCCGTTATTAAGCCATGATTTGCTGAACCATCTCAGTGGCTAATTACGCTTATGC / // / / / / / / | || BceAI HphI | | | VspI | |Csp6I | | | MseI | RsaI | | PleI TspEI | | MlyI | Tsp45I | MaeIII HinfI N N G N N S V L N D L V E S P I N A N T I T A I I R Y * T T W * S H R L M R I R * R Q * F G T K R L G R V T D * C E Y G ----:----|----:----|----:----|----:----|----:----|----:----| L L P L L E T S F S K T S D G I L A F V Y Y R C Y N P V L R S P L T V S * H S Y I V A I I R Y * V V Q Y L * R N I R I R BinI* |TspEI || MboI || | DpnI || | |BstKTI XmnI || | || MaeI Ksp632I* | MboII || | || |Hin4II* \ \ \ \\ \ \\ \\ GGGAACATTTTGAAGAGAATACATTCGGTAAGTTTATCGCAATCACAAATTGATCCTAGT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CCCTTGTAAAACTTCTCTTATGTAAGCCATTCAAATAGCGTTAGTGTTTAACTAGGATCA / / / / /// // / Ksp632I* | MboII | ||| || MaeI XmnI | ||| |Hin4II* | ||| MboI | ||DpnI | |BstKTI | TspEI BinI* G N I L K R I H S V S L S Q S Q I D P S G T F * R E Y I R * V Y R N H K L I L V E H F E E N T F G K F I A I T N * S * * ----:----|----:----|----:----|----:----|----:----|----:----| P F M K F L I C E T L K D C D C I S G L P S C K S S F V N P L N I A I V F Q D * P V N Q L S Y M R Y T * R L * L N I R T AsuI* DraII |CviJI |HaeIII |BmgT120I ||MnlI ||NlaIV Hin4I |||AvaI | TspEI ||||BmeT110I | | AsuI* ||||| ApoI MseI | | AvaII ||||| TspEI CviRI* SetI | | |BmgT120I SetI ||||| Hin4I |TspEI \ \ \ \\ \ \\\\\ \ \\ AAGAAGGTTAAAAGGGCAAAATTGGACCAAACCTCAAAAGGCCCCGAGAATTTGCAATTT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTCCAATTTTCCCGTTTTAACCTGGTTTGGAGTTTTCCGGGGCTCTTAAACGTTAAA / // / // / /// // / / / SetI |Hin4I | || SetI ||| |AvaI | | TspEI MseI | |AvaII ||| | | CviRI* | |AsuI* ||| | TspEI | BmgT120I ||| | ApoI TspEI ||| BmeT110I ||Hin4I ||DraII ||AsuI* |BmgT120I |NlaIV HaeIII CviJI MnlI K K V K R A K L D Q T S K G P E N L Q F R R L K G Q N W T K P Q K A P R I C N F E G * K G K I G P N L K R P R E F A I F ----:----|----:----|----:----|----:----|----:----|----:----| L F T L L A F N S W V E F P G S F K C N Y S P * F P L I P G F R L L G R S N A I L L N F P C F Q V L G * F A G L I Q L K TCGTAA ----:- AGCATT S * R X V X ----:- E Y K T R L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 5 BspACI,SsiI AflII 2 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AhaIII* 4 DraI AjuI 1 AluI 7 AluBI AlwNI 1 CaiI ApaI 1 ApoI 7 AcsI,XapI AsuI* 8 Cfr13I,PspPI,Sau96I,AspS9I AvaI 3 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BaeI 2 BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 1 BbvI 4 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 6 Bce83I* 2 BpuEI BceAI 1 BcgI 1 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 8 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmeT110I 3 BmgT120I 8 BseBI 6 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 2 BseSI 1 BaeGI,BstSLI BseYI 2 BsgI 1 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI Bsp120I 1 PspOMI BspCNI 2 BspHI 1 CciI,PagI,RcaI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 2 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 11 BtsI 1 Cac8I 2 BstC8I CfrI 1 AcoI,EaeI Csp6I 7 CviQI,RsaNI CviAII 5 CviJI 27 CviKI-1 CviRI* 8 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 11 MalI DraII 4 EcoO109I DsaI* 1 BtgI,BstDSI Ecl136II 1 EcoICRI Eco57I 2 AcuI Eco57MI 3 EcoP15I 1 EcoRII 6 AjnI,Psp6I,PspGI EcoRV 2 Eco32I FatI 5 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 GlaI 1 GsaI 2 GsuI 1 BpmI HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 3 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 7 Hin4II* 3 HpyAV Hin6I 1 HinP1I,HspAI HindII 2 HincII HinfI 8 HpaI 1 KspAI HpaII 3 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 14 Hpy188III Hpy188I 5 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 9 MboI 11 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 15 MfeI 1 MunI MlyI 2 SchI MmeI 1 MnlI 11 MseI 16 Tru1I,Tru9I MwoI 5 HpyF10VI,BstMWI NdeI 2 FauNDI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 2 MspA1I NspI 2 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PleI 2 PpsI PpuMI 1 Psp5II,PspPPI PshAI 1 BstPAI,BoxI PsiI 1 AanI PspXI 1 PvuII 2 RsaI 7 AfaI SacI 1 Psp124BI,SstI SalI 1 ScaI 2 BmcAI,AssI,ZrmI ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 6 BseDI,BssECI,BsaJI SetI 30 SexAI 1 MabI SfaNI 4 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 6 SmoI SphI 1 PaeI,BbuI SspI 2 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 2 TaqI 6 TatI 3 TauI 1 TfiI 6 PfeI TseI 4 ApeKI TsoI 1 Tsp45I 5 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 14 TspEI 17 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI TstI 2 VspI 1 PshBI,AseI XhoI 2 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 4 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflIII AgeI AlfI AloI ApaLI AscI Asp718I AsuII AvrII BarI BbvCI BciVI BclI BdaI BglI BmtI BplI Bpu10I BsaAI BsaBI BsaXI BsePI BseRI BsiI* BsmI Bsp1407I BspLU11I* BspMI BspOI BsrBI BssNAI Bst1107I BstAPI BstXI BstZ17I BtgZI BtrI CauII* Cfr10I Cfr9I ClaI CspCI DinI DraIII DrdI Eam1105I EciI Eco31I Eco47III EcoNI EcoRI EcoT22I EgeI EheI Esp3I EspI* FalI FseI FspAI HaeII HgaI HindIII Hpy99I KasI KpnI MauBI McrI* MluI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NgoMIV NheI NotI NruI NsiI OliI PacI PasI PfoI PmaCI PmeI PpiI PsrI PstI PvuI RsrII SacII SanDI SapI SauI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I StuI TaqII TspMI Tth111I XbaI XcmI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769