Restriction Map of YPL135C-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YPL135C-A on chromosome XVI from coordinates 297851 to 297678.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.16933

EMBOSS_001 AciI | NlaIV ApoI | |CviJI TspEI | || BseGI EciI | MboII BsrI HinfI \ \\ \ \ \ \ \ \ ATGGCGGAGCCACATCCAAAAGTTTTGAATTTGACATCTTCAATAACGCCAGTAGAGTCG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGCCTCGGTGTAGGTTTTCAAAACTTAAACTGTAGAAGTTATTGCGGTCATCTCAGC / /// / / / / / | ||BseGI EciI | TspEI BsrI HinfI | |CviJI | ApoI | NlaIV MboII AciI M A E P H P K V L N L T S S I T P V E S W R S H I Q K F * I * H L Q * R Q * S R G G A T S K S F E F D I F N N A S R V V ----:----|----:----|----:----|----:----|----:----|----:----| X A S G C G F T K F K V D E I V G T S D X P P A V D L L K S N S M K L L A L L T H R L W M W F N Q I Q C R * Y R W Y L R HindII Hpy166II |PleI MnlI ||MlyI | AciI ||| MboI | | Cac8I ||| | DpnI | | | BsiYI* ||| | |BstKTI | | | | Cac8I ||| | || CviRI* | | | | | Hin6I ||| | || | HphI | | | | | |GlaI ||| | || | SetI | | | | | ||HhaI MaeI BsrI TaqII \\\ \ \\ \ \ \ \ \ \ \ \\\ \ \ \ TTGACTTTGATCTGCAACCTCATCACATCACCGCACGCTGGCGCACCCACTAGACCAGTG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AACTGAAACTAGACGTTGGAGTAGTGTAGTGGCGTGCGACCGCGTGGGTGATCTGGTCAC / / // / / / / / /// / /// // / | PleI || | | | HphI MnlI ||| | ||Hin6I || TaqII | MlyI || | | SetI ||| | |GlaI |TspRI | || | CviRI* ||| | HhaI |BsrI | || MboI ||| Cac8I MaeI | |DpnI ||Cac8I | BstKTI |BsiYI* Hpy166II AciI HindII L T L I C N L I T S P H A G A P T R P V * L * S A T S S H H R T L A H P L D Q C D F D L Q P H H I T A R W R T H * T S A ----:----|----:----|----:----|----:----|----:----|----:----| N V K I Q L R M V D G C A P A G V L G T T S K S R C G * * M V A R Q R V W * V L Q S Q D A V E D C * R V S A C G S S W H TspRI | MaeII | | Hpy99I CviJI | | |SetI | MaeII | | |TaiI | | Hpy99I | | |BsiYI* | | |SetI | | || TspEI | | |TaiI BseGI \ \ \\ \ \ \ \\ \ CCGACGTTGGGCAATTTTTTATCTAATGAGCCGACGTTTCTTGGATGTGTATAA 130 140 150 160 170 ----:----|----:----|----:----|----:----|----:----|---- GGCTGCAACCCGTTAAAAAATAGATTACTCGGCTGCAAAGAACCTACACATATT / // / / // / / / | || MaeII TspEI || | MaeII BseGI | |BsiYI* || TaiI | TaiI || SetI | SetI |Hpy99I Hpy99I CviJI P T L G N F L S N E P T F L G C V * R R W A I F Y L M S R R F L D V Y X D V G Q F F I * * A D V S W M C I X ----:----|----:----|----:----|----:----|----:----|---- G V N P L K K D L S G V N R P H T Y A S T P C N K I * H A S T E Q I H I R R Q A I K * R I L R R K K S T Y L # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI ApoI 1 AcsI,XapI BseGI 2 BstF5I,BtsCI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsrI 2 BseNI,Bse1I,BsrSI BstKTI 1 Cac8I 2 BstC8I CviJI 2 CviKI-1 CviRI* 1 HpyCH4V DpnI 1 MalI EciI 1 GlaI 1 HhaI 1 BstHHI,CfoI,AspLEI Hin6I 1 HinP1I,HspAI HindII 1 HincII HinfI 1 HphI 1 AsuHPI Hpy166II 1 Hpy8I Hpy99I 2 MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 1 MlyI 1 SchI MnlI 1 NlaIV 1 BspLI,BmiI,PspN4I PleI 1 PpsI SetI 3 TaiI 2 TaqII 1 TspEI 2 TasI,Tsp509I,Sse9I TspRI 1 TscAI # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AluI AlwNI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BisI BlsI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviAII CviQI DdeI DinI DraII DraIII DrdI DsaI* Eam1105I Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FatI FauI Fnu4HI FnuDII* FokI FseI FspAI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* Hin4I Hin4II* HindIII HpaI HpaII Hpy178III*Hpy188I KasI KpnI Ksp632I* MaeIII MauBI McrI* MfeI MluI MmeI Mph1103I MroNI MseI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI ScrFI SduI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaqI TatI TauI TfiI TseI TsoI Tsp45I Tsp4CI* TspDTI TspGWI TspMI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769