Restriction Map of HHO1/YPL127C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

HHO1/YPL127C on chromosome XVI from coordinates 309604 to 308828.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 CviJI HgiCI* | Cac8I | NlaIV TaqII | | CviRI* \ \ \ \ \ \ ATGGCACCCAAGAAATCCACTACCAAGACCACAAGTAAGGGCAAGAAGCCTGCAACCAGC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGTGGGTTCTTTAGGTGATGGTTCTGGTGTTCATTCCCGTTCTTCGGACGTTGGTCG / / / / / / | HgiCI* TaqII | | CviRI* NlaIV | Cac8I CviJI M A P K K S T T K T T S K G K K P A T S W H P R N P L P R P Q V R A R S L Q P A G T Q E I H Y Q D H K * G Q E A C N Q Q ----:----|----:----|----:----|----:----|----:----|----:----| X A G L F D V V L V V L L P L F G A V L X P V W S I W * W S W L Y P C S A Q L W H C G L F G S G L G C T L A L L R C G A StyI SecI* | CviJI | HaeIII | |AciI | |BisI Hpy178III* | ||BlsI | SecI* | |||TauI | DsaI* MnlI \ \\\\ \ \ \ AAAGGCAAGGAGAAATCAACTTCCAAGGCCGCTATCAAGAAAACCACGGCAAAAAAGGAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCCGTTCCTCTTTAGTTGAAGGTTCCGGCGATAGTTCTTTTGGTGCCGTTTTTTCCTC ///// / / / ||||AciI | | MnlI |||BisI | DsaI* ||BlsI | SecI* |HaeIII Hpy178III* |CviJI |TauI SecI* StyI K G K E K S T S K A A I K K T T A K K E K A R R N Q L P R P L S R K P R Q K R R R Q G E I N F Q G R Y Q E N H G K K G G ----:----|----:----|----:----|----:----|----:----|----:----| L P L S F D V E L A A I L F V V A F F S C L C P S I L K W P R * * S F W P L F P F A L L F * S G L G S D L F G R C F L L BceAI MboI CviJI HindIII BclI | SduI | AluI | DpnI | HgiJII* | CviJI MaeIII | Hin4II* | | Hin4II* | | SetI | MnlI | |BstKTI | | |CviJI MaeII \ \ \ \ \ \ \\ \ \ \\ \ GAAGCTTCCTCCAAGAGTTACAGGGAGTTGATCATTGAAGGGCTCACGGCTTTGAAGGAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGAAGGAGGTTCTCAATGTCCCTCAACTAGTAACTTCCCGAGTGCCGAAACTTCCTT / / / / / // / / / / / / | | HindIII | MaeIII || BclI | | | CviJI TaiI | BceAI MnlI || MboI | | Hin4II* SetI | CviJI |DpnI | CviJI | AluI Hin4II* HgiJII* SetI BstKTI SduI E A S S K S Y R E L I I E G L T A L K E K L P P R V T G S * S L K G S R L * R N S F L Q E L Q G V D H * R A H G F E G T ----:----|----:----|----:----|----:----|----:----|----:----| S A E E L L * L S N I M S P S V A K F S P L K R W S N C P T S * Q L A * P K S P F S G G L T V P L Q D N F P E R S Q L F BinI* BceAI |SetI |TaiI || MboI || BamHI || XhoII || | DpnI MboI || | NlaIV | DpnI || | |BstKTI | |PvuI || | |Bce83I* | |BinI* || | ||BsrI | |McrI* || | ||| BinI* SmlI | |BstKTI || | ||| | HpaII | Hpy178III* MmeI | || BsiYI* \\ \ \\\ \ \ \ \ \ \ \\ \ CGTAAGGGATCCAGTCGTCCGGCACTCAAGAAGTTTATCAAGGAAAACTACCCGATCGTC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GCATTCCCTAGGTCAGCAGGCCGTGAGTTCTTCAAATAGTTCCTTTTGATGGGCTAGCAG /// // / / / / / //// / ||| || | | HpaII | MmeI |||| Hpy188I ||| || | BinI* Hpy178III* |||BinI* ||| || XhoII SmlI |||MboI ||| || BamHI ||Hpy99I ||| || MboI |BsiYI* ||| |NlaIV |DpnI ||| |DpnI BstKTI ||| |BsrI McrI* ||| Bce83I* PvuI ||| BstKTI ||BceAI |BinI* MaeII R K G S S R P A L K K F I K E N Y P I V V R D P V V R H S R S L S R K T T R S S * G I Q S S G T Q E V Y Q G K L P D R R ----:----|----:----|----:----|----:----|----:----|----:----| R L P D L R G A S L F N I L S F * G I T V Y P I W D D P V * S T * * P F S G S R T L S G T T R C E L L K D L F V V R D D MboI BamHI XhoII Hpy99I Hpy188I MroNI | DpnI CviJI | NlaIV Cfr10I | |BstKTI HaeIII | ||AciI TatI |HpaII | ||| Cac8I |Csp6I ||NaeI | ||| BinI* ||RsaI Hin4II* MnlI ||Cac8I \ \\\ \ \\\ \ \ \\\ GGATCCGCAAGCAACTTTGATTTGTACTTCAACAATGCCATAAAGAAGGGTGTGGAGGCC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAGGCGTTCGTTGAAACTAAACATGAAGTTGTTACGGTATTTCTTCCCACACCTCCGG // / / // /// / / / / || | | |BinI* ||TatI Hin4II* MnlI | Cac8I || | | Cac8I |Csp6I | NaeI || | AciI RsaI HaeIII || XhoII CviJI || BamHI || MboI |NlaIV |DpnI BstKTI G S A S N F D L Y F N N A I K K G V E A D P Q A T L I C T S T M P * R R V W R P I R K Q L * F V L Q Q C H K E G C G G R ----:----|----:----|----:----|----:----|----:----|----:----| P D A L L K S K Y K L L A M F F P T S A R I R L C S Q N T S * C H W L S P H P P S G C A V K I Q V E V I G Y L L T H L G AsuI* AvaII DraII PpuMI SanDI |NlaIV GsuI |BmgT120I CfrI ||NlaIV Eco57MI ||| AciI | BalI ||| | NspBII* | CviJI ||| | | FauI | HaeIII CviJI ||| | | | BslFI | |BsrI \ \\\ \ \ \ \ \ \\ GGCGATTTTGAACAGCCAAAGGGACCCGCTGGTGCTGTGAAACTGGCCAAGAAGAAATCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCTAAAACTTGTCGGTTTCCCTGGGCGACCACGACACTTTGACCGGTTCTTCTTTAGA // / /// / / / / // / |Cfr10I CviJI ||| | | | | || CfrI |MroNI ||| | | | | |HaeIII HpaII ||| | | | | |CviJI ||| | | | | |BalI ||| | | | | BsrI ||| | | | Eco57MI ||| | | | GsuI ||| | | BslFI ||| | FauI ||| NspBII* ||| AciI ||SanDI ||PpuMI ||DraII ||AvaII ||AsuI* |BmgT120I |NlaIV NlaIV G D F E Q P K G P A G A V K L A K K K S A I L N S Q R D P L V L * N W P R R N L R F * T A K G T R W C C E T G Q E E I S ----:----|----:----|----:----|----:----|----:----|----:----| P S K S C G F P G A P A T F S A L F F D R R N Q V A L P V R Q H Q S V P W S S I A I K F L W L S G S T S H F Q G L L F R Cac8I | CviJI | |AciI | |BisI Hpy178III* | ||BlsI OliI | MboII MnlI SetI | |||TauI MslI \ \ \ \ \ \\\\ \ CCAGAAGTAAAGAAAGAAAAAGAGGTCAGTCCAAAACCCAAGCAAGCCGCCACTTCTGTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTTCATTTCTTTCTTTTTCTCCAGTCAGGTTTTGGGTTCGTTCGGCGGTGAAGACAC // / / / //// / |Hpy178III* MnlI SetI | |||AciI MslI MboII | ||BisI OliI | |BlsI | CviJI | TauI Cac8I P E V K K E K E V S P K P K Q A A T S V Q K * R K K K R S V Q N P S K P P L L * R S K E R K R G Q S K T Q A S R H F C E ----:----|----:----|----:----|----:----|----:----|----:----| G S T F F S F S T L G F G L C A A V E T E L L L S L F L P * D L V W A L R W K Q W F Y L F F F L D T W F G L L G G S R H SfaNI | NheI | AluI | CviJI | |MaeI MwoI | ||SetI CviJI | ||Cac8I |AciI | ||| BmtI |BisI | ||| Hin6I FokI ||BlsI | ||| |GlaI CviRI* |MwoI |||TauI | ||| ||HhaI | AciI || SfaNI |||BseGI | ||| |||HaeII \ \ \\ \ \\\\ \ \\\ \\\\ AGTGCAACCGCATCAAAAGCGAAAGCCGCATCCACGAAGCTAGCGCCAAAGAAAGTAGTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TCACGTTGGCGTAGTTTTCGCTTTCGGCGTAGGTGCTTCGATCGCGGTTTCTTTCATCAC / / / / // //// / / ///// | | MwoI | || |||AciI | | ||||Hin6I | AciI | || ||BisI | | |||GlaI CviRI* | || |BseGI | | ||NheI | || |BlsI | | ||HhaI | || CviJI | | |HaeII | || TauI | | |MaeI | |SfaNI | | SfaNI | MwoI | | Cac8I FokI | CviJI | AluI | BmtI SetI S A T A S K A K A A S T K L A P K K V V V Q P H Q K R K P H P R S * R Q R K * * C N R I K S E S R I H E A S A K E S S E ----:----|----:----|----:----|----:----|----:----|----:----| L A V A D F A F A A D V F S A G F F T T S H L R M L L S L R M W S A L A L S L L T C G C * F R F G C G R L * R W L F Y H MaeIII Tsp4CI* | AciI | |Hin4II* | || MboII | || | BglI | || | MwoI | || | | StuI | || | | CviJI | || | | HaeIII | || | | | MboII | || | | | TspDTI | || | | | | Ksp632I* Hin4II* | || | | | | | MnlI | SetI \ \\ \ \ \ \ \ \ \ \ AAAAAAAAATCGCCTACTGTTACCGCCAAGAAGGCCTCTTCGCCTTCTTCATTGACCTAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTTTTAGCGGATGACAATGGCGGTTCTTCCGGAGAAGCGGAAGAAGTAACTGGATG / / / / / // // / / | | | MboII | |MboII || | SetI | | | MwoI | TspDTI || Hin4II* | | | BglI HaeIII |Ksp632I* | | AciI CviJI MnlI | Hin4II* StuI | MaeIII Tsp4CI* K K K S P T V T A K K A S S P S S L T Y K K N R L L L P P R R P L R L L H * P T K K I A Y C Y R Q E G L F A F F I D L Q ----:----|----:----|----:----|----:----|----:----|----:----| F F F D G V T V A L F A E E G E E N V * S F F I A * Q * R W S P R K A K K M S R F F F R R S N G G L L G R R R R * Q G V MseI |GsuI |Eco57MI || MnlI || | BceAI FatI || | | Tsp4CI* BinI* |CviAII || | | | CviJI | MboI ||Cac8I || | | | |NlaIV | | DpnI ||| SphI || | | | ||SduI | | |BstKTI ||| NspI || | | | ||HgiJII* | | || MseI ||| NlaIII || | | | ||| CviJI \ \ \\ \ \\\ \ \\ \ \ \ \\\ \ AAGGAAATGATCCTTAAAAGCATGCCTCAACTTAATGACGGTAAGGGCTCCAGCCGTATC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTTTACTAGGAATTTTCGTACGGAGTTGAATTACTGCCATTCCCGAGGTCGGCATAG / // / / / /// / / // / // / | || | | | ||FatI | MnlI || | || CviJI | || | | | |CviAII | MseI || | |NlaIV | || | | | Cac8I Eco57MI || | CviJI | || | | NlaIII GsuI || HgiJII* | || | | NspI || SduI | || | | SphI |BceAI | || | MseI Tsp4CI* | || MboI | |DpnI | BstKTI BinI* K E M I L K S M P Q L N D G K G S S R I R K * S L K A C L N L M T V R A P A V S G N D P * K H A S T * * R * G L Q P Y R ----:----|----:----|----:----|----:----|----:----|----:----| L S I I R L L M G * S L S P L P E L R I C P F S G * F C A E V * H R Y P S W G Y L F H D K F A H R L K I V T L A G A T D MnlI |BsaXI || Hin4I || | AluI || | CviJI || | | SetI MseI BsaXI || | | | ApoI |AhaIII* Hin4I BseRI || | | | TspEI \\ \ \ \\ \ \ \ \ GTTTTAAAGAAGTATGTCAAGGACACTTTCTCCTCCAAGTTGAAAACAAGCTCAAATTTT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAATTTCTTCATACAGTTCCTGTGAAAGAGGAGGTTCAACTTTTGTTCGAGTTTAAAA // / / / // / / / || | BsaXI BseRI |MnlI | CviJI TspEI || Hin4I Hin4I | AluI ApoI |MseI BsaXI SetI AhaIII* V L K K Y V K D T F S S K L K T S S N F F * R S M S R T L S P P S * K Q A Q I L F K E V C Q G H F L L Q V E N K L K F * ----:----|----:----|----:----|----:----|----:----|----:----| T K F F Y T L S V K E E L N F V L E F K R K L S T H * P C K R R W T S F L S L N N * L L I D L V S E G G L Q F C A * I K Hin6I |GlaI |Eco47III ||HhaI |||HaeII CviRI* |||| Hpy178III* | BceAI \\\\ \ \ \ GACTATCTGTTCAATAGCGCTATCAAGAAATGTGTTGAAAACGGCGAGTTAGTGCAACCA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTGATAGACAAGTTATCGCGATAGTTCTTTACACAACTTTTGCCGCTCAATCACGTTGGT //// / / / |||Hin6I Hpy178III* | BceAI ||Eco47III CviRI* ||GlaI |HhaI HaeII D Y L F N S A I K K C V E N G E L V Q P T I C S I A L S R N V L K T A S * C N Q L S V Q * R Y Q E M C * K R R V S A T K ----:----|----:----|----:----|----:----|----:----|----:----| S * R N L L A I L F H T S F P S N T C G Q S D T * Y R * * S I H Q F R R T L A V V I Q E I A S D L F T N F V A L * H L W AsuI* DraII Bsp120I |AsuI* |DraII |BmgT120I ||CviJI ||NlaIV ||HaeIII ||BmgT120I |||NlaIV ||||ApaI ||||SduI ||||BseSI ||||HgiJII* MaeII ||||| BglI |BsaAI ||||| MwoI MnlI SetI || SetI ||||| HpaII | MseI Hin4II* | MboII || TaiI \\\\\ \ \ \ \ \ \ \\ \ AAGGGCCCCTCCGGCATTATTAAACTAAACAAGAAGAAGGTCAAACTCTCCACGTAA 730 740 750 760 770 ----:----|----:----|----:----|----:----|----:----|----:-- TTCCCGGGGAGGCCGTAATAATTTGATTTGTTCTTCTTCCAGTTTGAGAGGTGCATT / //// / / / / / / / // | |||MwoI | MnlI MseI Hin4II* SetI MboII | |MaeII | |||BglI HpaII | BsaAI | ||Bsp120I TaiI | ||DraII SetI | ||AsuI* | |BmgT120I | |DraII | |AsuI* | |NlaIV | BmgT120I | HaeIII | NlaIV | CviJI HgiJII* BseSI SduI ApaI K G P S G I I K L N K K K V K L S T * R A P P A L L N * T R R R S N S P R X G P L R H Y * T K Q E E G Q T L H V X ----:----|----:----|----:----|----:----|----:----|----:-- F P G E P M I L S F L F F T L S E V Y L P G R R C * * V L C S S P * V R W T L A G G A N N F * V L L L D F E G R L # Enzymes that cut Frequency Isoschizomers AciI 7 BspACI,SsiI AhaIII* 1 DraI AluI 3 AluBI ApaI 1 ApoI 1 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 2 Bce83I* 1 BpuEI BceAI 4 BclI 1 FbaI,Ksp22I BglI 2 BinI* 5 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 3 BmtI 1 BspOI BsaAI 1 BstBAI,Ppu21I BsaXI 1 BseGI 1 BstF5I,BtsCI BseRI 1 BseSI 1 BaeGI,BstSLI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI Bsp120I 1 PspOMI BsrI 2 BseNI,Bse1I,BsrSI BstKTI 5 Cac8I 6 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 1 CviQI,RsaNI CviAII 1 CviJI 16 CviKI-1 CviRI* 3 HpyCH4V DpnI 5 MalI DraII 3 EcoO109I DsaI* 1 BtgI,BstDSI Eco47III 1 Aor51HI,AfeI Eco57MI 2 FatI 1 FauI 1 SmuI FokI 1 GlaI 2 GsuI 2 BpmI HaeII 2 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 3 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 1 Hin4II* 6 HpyAV Hin6I 2 HinP1I,HspAI HindIII 1 HpaII 3 HapII,BsiSI,MspI Hpy178III* 4 Hpy188III Hpy188I 1 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 2 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 McrI* 1 BsiEI,BstMCI,Bsh1285I MmeI 1 MnlI 8 MroNI 1 NgoMIV MseI 4 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NaeI 1 PdiI NheI 1 AsuNHI NlaIII 1 Hin1II,Hsp92II,FaeI NlaIV 8 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 1 BstNSI,XceI OliI 1 AleI PpuMI 1 Psp5II,PspPPI PvuI 1 MvrI,Ple19I,BpvUI RsaI 1 AfaI SanDI 1 SduI 3 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 8 SfaNI 2 LweI SmlI 1 SmoI SphI 1 PaeI,BbuI StuI 1 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqII 1 TatI 1 TauI 3 Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 1 TasI,Tsp509I,Sse9I XhoII 2 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BarI BbvCI BbvI BbvII* BccI BcgI BciVI BdaI BetI* BfiI BglII BmeT110I BplI Bpu10I BsaBI BseBI BseMII BsePI BseYI BsgI BsiI* BsmAI BsmI Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr9I ClaI CspCI DdeI DinI DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco57I EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FnuDII* FseI FspAI GsaI HgaI HgiAI* HindII HinfI HpaI HphI Hpy166II Hpy8I KasI KpnI MauBI MfeI MluI MlyI Mph1103I MstI* MvaI NarI NcoI NdeI NmeAIII NotI NruI NsiI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PshAI PsiI PspXI PsrI PstI PvuII RsrII SacI SacII SalI SapI SauI* ScaI SchI ScrFI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I SspI StyD4I SwaI TaqI TfiI TseI TsoI Tsp45I TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769