Restriction Map of NAN1/YPL126W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

NAN1/YPL126W on chromosome XVI from coordinates 310210 to 312900.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.30503

StyI HgaI AvrII SecI* SetI BdaI |MaeI | TaqI Tsp4CI* Tsp4CI* BdaI AciI \\ \ \ \ \ \ \ ATGACGCAATCCCTAGGTATCGAACAGTATAAACTGTCAGTCGTATCTGGTGGGAAACCC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGCGTTAGGGATCCATAGCTTGTCATATTTGACAGTCAGCATAGACCACCCTTTGGG //// / / / / |||HgaI | Tsp4CI* Tsp4CI* BdaI ||SecI* TaqI BdaI ||AvrII ||StyI |MaeI SetI M T Q S L G I E Q Y K L S V V S G G K P * R N P * V S N S I N C Q S Y L V G N P D A I P R Y R T V * T V S R I W W E T R ----:----|----:----|----:----|----:----|----:----|----:----| X V C D R P I S C Y L S D T T D P P F G X S A I G L Y R V T Y V T L R I Q H S V H R L G * T D F L I F Q * D Y R T P F G MaeIII | Cfr10I | |HpaII | |BspCNI | ||BseMII | |||BdaI AciI FauI DdeI | |||BdaI Cac8I FauI \ \ \ \\\\ \ \ GCTTTGAATAATCTCAGTTCAGTAACCGGCAATAAGAATATCGCCCGCCTATCACAAGAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAACTTATTAGAGTCAAGTCATTGGCCGTTATTCTTATAGCGGGCGGATAGTGTTCTG / / / /// // / / / AciI FauI DdeI ||| |Cfr10I | AciI FauI ||| HpaII Cac8I ||MaeIII ||BdaI ||BdaI |BseMII BspCNI A L N N L S S V T G N K N I A R L S Q D L * I I S V Q * P A I R I S P A Y H K T F E * S Q F S N R Q * E Y R P P I T R P ----:----|----:----|----:----|----:----|----:----|----:----| A K F L R L E T V P L L F I A R R D C S R K S Y D * N L L R C Y S Y R G G I V L S Q I I E T * Y G A I L I D G A * * L V MboI Hpy188I | DpnI | |BstKTI MseI | || SetI MaeI \ \ \\ \ \ CAACGAAACTATATTATACCCTTTAACAATCAGATCAAGGTGTATTCTGTGGAAACTAGA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGCTTTGATATAATATGGGAAATTGTTAGTCTAGTTCCACATAAGACACCTTTGATCT / / // // / MseI | || |SetI MaeI | || MboI | |DpnI | BstKTI Hpy188I Q R N Y I I P F N N Q I K V Y S V E T R N E T I L Y P L T I R S R C I L W K L D T K L Y Y T L * Q S D Q G V F C G N * T ----:----|----:----|----:----|----:----|----:----|----:----| W R F * I I G K L L * I L T Y E T S V L G V F S Y * V R * C D S * P T N Q P F * L S V I N Y G K V I L D L H I R H F S S BetI* MlyI BspMII* PleI |HpaII | MseI |Hpy178III* CviRI* | | HinfI CviRI* || SspI | Ksp632I* \ \ \ \ \\ \ \ \ CAATGTGTTAAGACTCTAAAGTTTGCAAATAACTCCTTGTTATCCGGAATATTTCTGCAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTTACACAATTCTGAGATTTCAAACGTTTATTGAGGAACAATAGGCCTTATAAAGACGTT // / / / // / / || MseI HinfI CviRI* || SspI CviRI* |PleI |BspMII* MlyI |BetI* Hpy178III* HpaII Q C V K T L K F A N N S L L S G I F L Q N V L R L * S L Q I T P C Y P E Y F C K M C * D S K V C K * L L V I R N I S A R ----:----|----:----|----:----|----:----|----:----|----:----| C H T L V R F N A F L E K N D P I N R C V I H * S E L T Q L Y S R T I R F I E A L T N L S * L K C I V G Q * G S Y K Q L EcoP15I | MboII | | TfiI | | HinfI TaqII | | MboII |TspDTI Tsp4CI* | | | TaqI ||TfiI BseYI |HphI | | | ClaI ||HinfI | GsaI || AciI \ \ \ \ \\\ \ \ \\ \ GAAGAAGAGAATAATGAATCGATTGTAAAGATTCTGCTGGGTGATATAACCGTTCCGCAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTCTCTTATTACTTAGCTAACATTTCTAAGACGACCCACTATATTGGCAAGGCGTT / / / / / / // / / / // / | | | | | ClaI || | | BseYI |HphI AciI | | | | | TaqI || | GsaI Tsp4CI* | | | | HinfI || HinfI | | | | TfiI || TfiI | | | MboII |TspDTI | | MboII TaqII | EcoP15I Ksp632I* E E E N N E S I V K I L L G D I T V P Q K K R I M N R L * R F C W V I * P F R N R R E * * I D C K D S A G * Y N R S A T ----:----|----:----|----:----|----:----|----:----|----:----| S S S F L S D I T F I R S P S I V T G C L L L S Y H I S Q L S E A P H Y L R E A F F L I I F R N Y L N Q Q T I Y G N R L BbvII* | HgaI | MboII FatI | |Hpy188I |CviAII MseI | || HphI || NlaIII |AhaIII* | || | Tsp4CI* || |TspEI ||TspEI \ \\ \ \ \\ \\ \\\ CAAGAAGACGCTCATCTGATTACCGTATTCACCAATAATGGTCATGTAATTGTTTTAAAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTCTGCGAGTAGACTAATGGCATAAGTGGTTATTACCAGTACATTAACAAAATTTA // // / / // / // || || Tsp4CI* | |FatI | |MseI || |HgaI | | | AhaIII* || HphI | | TspEI |Hpy188I | CviAII BbvII* NlaIII MboII Q E D A H L I T V F T N N G H V I V L N K K T L I * L P Y S P I M V M * L F * I R R R S S D Y R I H Q * W S C N C F K L ----:----|----:----|----:----|----:----|----:----|----:----| C S S A * R I V T N V L L P * T I T K F V L L R E D S * R I * W Y H D H L Q K L L F V S M Q N G Y E G I I T M Y N N * I AluI CviJI DdeI | SetI Bpu10I HindIII PsiI | | TaqI |PleI | AluI | BslFI | | | HinfI ||MlyI | CviJI \ \ \ \ \ \ \\\ \ \ TATAAGGGGAAGCTGGTCGAGTCCCCTAAGCATTTCAAAATCTCTTTGGCAGATGAAAAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTCCCCTTCGACCAGCTCAGGGGATTCGTAAAGTTTTAGAGAAACCGTCTACTTTTC // / / / / // / / |PsiI | CviJI | HinfI |Bpu10I | CviJI TspEI | AluI TaqI |DdeI | AluI BslFI PleI SetI SetI MlyI Y K G K L V E S P K H F K I S L A D E K I R G S W S S P L S I S K S L W Q M K S * G E A G R V P * A F Q N L F G R * K A ----:----|----:----|----:----|----:----|----:----|----:----| * L P F S T S D G L C K L I E K A S S F N Y P S A P R T G * A N * F R K P L H F I L P L Q D L G R L M E F D R Q C I F L AsuI* AvaII DraII BdaI PpuMI SetI BdaI AclI |BmgT120I Cac8I SfeI* MaeII ||NlaIV | CviRI* | ApoI | SetI ||| MaeI | | TspDTI MnlI BsiYI* | TspEI | TaiI ||| PshAI \ \ \ \ \ \ \ \ \ \\\ \ CTTGCAAATGTTTTCCATAGCGAGGGCAACTATAGAATTTTGACAACGTTCAAGGACCCT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GAACGTTTACAAAAGGTATCGCTCCCGTTGATATCTTAAAACTGTTGCAAGTTCCTGGGA / / / / / / / / / / // / | | TspDTI | BsiYI* BdaI | TspEI | MaeII || PshAI | CviRI* MnlI BdaI | ApoI | AclI |PpuMI HindIII SfeI* TaiI |DraII Cac8I SetI |AvaII |AsuI* BmgT120I NlaIV L A N V F H S E G N Y R I L T T F K D P L Q M F S I A R A T I E F * Q R S R T L C K C F P * R G Q L * N F D N V Q G P * ----:----|----:----|----:----|----:----|----:----|----:----| S A F T K W L S P L * L I K V V N L S G A Q L H K G Y R P C S Y F K S L T * P G K C I N E M A L A V I S N Q C R E L V R CviRI* | EcoT22I CviRI* | |MseI BdaI | Csp6I | || SfaNI BdaI | |RsaI SetI | || | SetI \ \ \\ \ \ \\ \ \ AGTCAAAAGGCACATAACTCTTTGCAATCGTACAGGTTATATGCATTAACCTTTGACGAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TCAGTTTTCCGTGTATTGAGAAACGTTAGCATGTCCAATATACGTAATTGGAAACTGCTA // / /// / / / / |BdaI CviRI* ||SetI | | | SfaNI |BdaI |Csp6I | | MseI MaeI RsaI | | SetI | CviRI* EcoT22I S Q K A H N S L Q S Y R L Y A L T F D D V K R H I T L C N R T G Y M H * P L T M S K G T * L F A I V Q V I C I N L * R C ----:----|----:----|----:----|----:----|----:----|----:----| L * F A C L E K C D Y L N Y A N V K S S * D F P V Y S K A I T C T I H M L R Q R T L L C M V R Q L R V P * I C * G K V I AclI MaeII BdaI BdaI | SetI MboII BdaI TspEI CviJI MwoI BdaI | TaiI | SspI \ \ \ \ \ \ \ \ \ GCTAAAAAGCAATTTGAAGTGGCTCATCAGGCAGAATGGCACAACGTTATCTTGTCAAAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTTTTCGTTAAACTTCACCGAGTAGTCCGTCTTACCGTGTTGCAATAGAACAGTTTA / / / / / / / / / BdaI TspEI | MwoI BdaI | MaeII | SspI BdaI CviJI BdaI | AclI MboII TaiI SetI A K K Q F E V A H Q A E W H N V I L S N L K S N L K W L I R Q N G T T L S C Q I * K A I * S G S S G R M A Q R Y L V K Y ----:----|----:----|----:----|----:----|----:----|----:----| A L F C N S T A * * A S H C L T I K D F H * F A I Q L P E D P L I A C R * R T L S F L L K F H S M L C F P V V N D Q * I Hpy166II CviRI* | NheI | AcyI | |MaeI | MaeII | ||Cac8I | |ZraI | ||| BmtI | || SetI | ||| Hin6I | || TaiI MboI | ||| |GlaI | || AatII | DpnI | ||| ||HhaI | || | BsmAI | |BstKTI | ||| ||| NdeI | || | Esp3I | ||Hpy178III* \ \\\ \\\ \ \ \\ \ \ \ \\\ ATTTCTTCCAATGGTAAACTGCTAGCGCATATGTGCAAAGACGTCTCAACAAAAGATCAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGAAGGTTACCATTTGACGATCGCGTATACACGTTTCTGCAGAGTTGTTTTCTAGTG / / ///// / / / // / // / / | | ||||| | | | |MaeII | || | Hpy178III* | | ||||| | | | |AcyI | || MboI | | ||||| | | | ZraI | |DpnI | | ||||| | | AatII | BstKTI | | ||||| | | TaiI Esp3I | | ||||| | | SetI BsmAI | | ||||| | CviRI* | | ||||| NdeI | | ||||Hin6I | | |||GlaI | | ||NheI | | ||HhaI | | |MaeI | | Cac8I | BmtI Hpy166II I S S N G K L L A H M C K D V S T K D H F L P M V N C * R I C A K T S Q Q K I T F F Q W * T A S A Y V Q R R L N K R S R ----:----|----:----|----:----|----:----|----:----|----:----| I E E L P L S S A C I H L S T E V F S * Y K K W H Y V A L A Y T C L R R L L L D N R G I T F Q * R M H A F V D * C F I V ApoI TspEI | MseI | | HindIII | | | AluI | | | CviJI DdeI BspCNI TfiI | | | | FokI | BccI |BseMII HinfI | | | | SetI SecI* \ \ \\ \ \ \ \ \ \ \ GAACACAAATCCATCTCAGTTGTTTCGCTTTTTGATGATTCTGTAAATTTAAGCTTTCCC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTGTTTAGGTAGAGTCAACAAAGCGAAAAACTACTAAGACATTTAAATTCGAAAGGG / / // / / / / / / | BccI |BseMII HinfI | | | | FokI DdeI BspCNI TfiI | | | HindIII | | CviJI | | AluI | MseI | SetI TspEI ApoI E H K S I S V V S L F D D S V N L S F P N T N P S Q L F R F L M I L * I * A F P T Q I H L S C F A F * * F C K F K L S P ----:----|----:----|----:----|----:----|----:----|----:----| S C L D M E T T E S K S S E T F K L K G R V C I W R L Q K A K Q H N Q L N L S E F V F G D * N N R K K I I R Y I * A K G Csp6I |RsaI |SetI NlaIV ||MaeII | MboII BccI ||| SetI | BseGI | MlyI ||| TaiI | | MnlI | PleI HinfI ||| | MaeI \ \ \ \ \ \ \\\ \ \ CTCGGTTCCATCCTTTCTTCACAGACTCAATCCCTATCCTATAACACAAGGTACGTTTCT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GAGCCAAGGTAGGAAAGAAGTGTCTGAGTTAGGGATAGGATATTGTGTTCCATGCAAAGA / // / /// / / // / | || MnlI ||PleI HinfI | || MaeII | |MboII |MlyI | |Csp6I | NlaIV BccI | RsaI | BseGI | TaiI SecI* | SetI SetI L G S I L S S Q T Q S L S Y N T R Y V S S V P S F L H R L N P Y P I T Q G T F L R F H P F F T D S I P I L * H K V R F * ----:----|----:----|----:----|----:----|----:----|----:----| R P E M R E E C V * D R D * L V L Y T E G R N W G K K V S E I G I R Y C L T R K E T G D K R * L S L G * G I V C P V N R FatI |CviAII BetI* || CfrI BspMII* || |NlaIII |HpaII || ||BalI |Hpy178III* || ||CviJI XcmI HindII CviJI || MnlI || ||HaeIII | MmeI Hpy166II |BsrI || |PsiI \\ \\\ \ \ \ \\ \\ \\ AGCATGGCCATAGACAATATGGGTCAACAACTGGCTGTTGGATTTGCCTCCGGAGTTATA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTACCGGTATCTGTTATACCCAGTTGTTGACCGACAACCTAAACGGAGGCCTCAATAT // /// / / / / // // / / || ||| CfrI | MmeI | |CviJI || | PsiI || ||HaeIII XcmI | BsrI || MnlI || ||CviJI Hpy166II |BspMII* || ||BalI HindII |BetI* || |FatI Hpy178III* || CviAII HpaII |NlaIII MaeI S M A I D N M G Q Q L A V G F A S G V I A W P * T I W V N N W L L D L P P E L * H G H R Q Y G S T T G C W I C L R S Y K ----:----|----:----|----:----|----:----|----:----|----:----| L M A M S L I P * C S A T P N A E P T I * C P W L C Y P D V V P Q Q I Q R R L * A H G Y V I H T L L Q S N S K G G S N Y BssKI CviJI EcoRII | ScrFI | BseBI | |CfrI | || CviJI | || HaeIII | || | MboI MwoI | || | | DpnI | MlyI | || | | |BstKTI | PleI HinfI \ \\ \ \ \\ \ \ \ AGTATCGTAAGCCTGGCCGATCTACAAATAAGACTGCTCAAATGGCATATAGACTCTGTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TCATAGCATTCGGACCGGCTAGATGTTTATTCTGACGAGTTTACCGTATATCTGAGACAC / / / /// / / // / | | | ||| MboI MwoI |PleI HinfI | | | ||DpnI MlyI | | | |BstKTI | | | CfrI | | EcoRII | | HaeIII | | BssKI | | CviJI | BseBI | ScrFI CviJI S I V S L A D L Q I R L L K W H I D S V V S * A W P I Y K * D C S N G I * T L C Y R K P G R S T N K T A Q M A Y R L C A ----:----|----:----|----:----|----:----|----:----|----:----| L I T L R A S R C I L S S L H C I S E T L Y R L G P R D V F L V A * I A Y L S Q T D Y A Q G I * L Y S Q E F P M Y V R H BccI | Hpy178III* | |BinI* | || MboI | || BamHI | || XhoII | || | DpnI | || | NlaIV MaeIII | || | |BstKTI Tsp45I TstI | || | || BinI* TstI \ \ \ \\ \ \\ \ \ CTGTCACTCTCATTCTCTCACGATGGATCCTATTTGCTATCTGGTGGTTGGGAAAAAGTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GACAGTGAGAGTAAGAGAGTGCTACCTAGGATAAACGATAGACCACCAACCCTTTTTCAA / / / / // / / / | Tsp45I | | || | | TstI | MaeIII | | || | BinI* TstI | | || XhoII | | || BamHI | | || MboI | | |NlaIV | | |DpnI | | BstKTI | Hpy178III* | BinI* BccI L S L S F S H D G S Y L L S G G W E K V C H S H S L T M D P I C Y L V V G K K L V T L I L S R W I L F A I W W L G K S Y ----:----|----:----|----:----|----:----|----:----|----:----| S D S E N E * S P D * K S D P P Q S F T A T V R M R E R H I R N A I Q H N P F L Q * E * E R V I S G I Q * R T T P F F N MfeI MnlI TspEI TspEI | Tsp4CI* \ \ \ \ ATGAGTTTATGGCAATTGGAAACAAACTCTCAACAATTCCTGCCTCGTTTGAACGGTATT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCAAATACCGTTAACCTTTGTTTGAGAGTTGTTAAGGACGGAGCAAACTTGCCATAA / / / / TspEI TspEI | Tsp4CI* MfeI MnlI M S L W Q L E T N S Q Q F L P R L N G I * V Y G N W K Q T L N N S C L V * T V L E F M A I G N K L S T I P A S F E R Y Y ----:----|----:----|----:----|----:----|----:----|----:----| I L K H C N S V F E * C N R G R K F P I * S N I A I P F L S E V I G A E N S R Y H T * P L Q F C V R L L E Q R T Q V T N AsuI* AvaII DraII PpuMI |NlaIV |BmgT120I Tsp4CI* || PpiI PsiI |Bce83I* || |SmlI MnlI | TaqI || SetI || ||SetI BslFI MseI PpiI \ \ \\ \ \\ \\\ \ \ \ ATAATCGACTGTCAGGTATTGGGACCTCAAGGGAACTACTACTCTTTAATCCTACAAATG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TATTAGCTGACAGTCCATAACCCTGGAGTTCCCTTGATGATGAGAAATTAGGATGTTTAC / / / / / /// / / / / / PsiI | | SetI | ||| | MnlI BslFI | PpiI | Tsp4CI* | ||| SmlI MseI | Bce83I* | ||PpuMI TaqI | ||DraII | ||AvaII | ||AsuI* | |BmgT120I | NlaIV | SetI PpiI I I D C Q V L G P Q G N Y Y S L I L Q M * S T V R Y W D L K G T T T L * S Y K * N R L S G I G T S R E L L L F N P T N D ----:----|----:----|----:----|----:----|----:----|----:----| I I S Q * T N P G * P F * * E K I R C I * L R S D P I P V E L S S S S K L G V F Y D V T L Y Q S R L P V V V R * D * L H Hin4I ApoI Hpy188I | BsmI TspEI TspEI | TspEI | | Hpy188I \ \ \ \ \ \ \ ACTGAAAACAATTCAAATTCTGACTACCAATTTTTACTTTTGAATGCTTCTGATTTGACC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTTTTGTTAAGTTTAAGACTGATGGTTAAAAATGAAAACTTACGAAGACTAAACTGG / // / / / / / TspEI |Hpy188I TspEI Hin4I | | SetI TspEI | Hpy188I ApoI BsmI T E N N S N S D Y Q F L L L N A S D L T L K T I Q I L T T N F Y F * M L L I * P * K Q F K F * L P I F T F E C F * F D L ----:----|----:----|----:----|----:----|----:----|----:----| V S F L E F E S * W N K S K F A E S K V S Q F C N L N Q S G I K V K S H K Q N S S F V I * I R V V L K * K Q I S R I Q G SetI | TspEI | | MnlI | | |TaqI | | || MseI | | || |Hin4I | | || || AsuI* | | || || |BmgT120I | | || || ||CviJI | | || || ||HaeIII | | || || ||| AgeI | | || || ||| BetI* | | || || ||| Cfr10I | | || || ||| |HpaII NmeAIII \ \ \\ \\ \\\ \\ \ TCCAAATTGTCGATTAACGGGCCATTACCGGTGTTCAATAGCACCATAAAACACATTCAG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTTAACAGCTAATTGCCCGGTAATGGCCACAAGTTATCGTGGTATTTTGTGTAAGTC / / / / // // / | | | MseI |AsuI* |Cfr10I NmeAIII | | TaqI BmgT120I |BetI* | Hin4I HaeIII |AgeI TspEI CviJI HpaII MnlI S K L S I N G P L P V F N S T I K H I Q P N C R L T G H Y R C S I A P * N T F S Q I V D * R A I T G V Q * H H K T H S A ----:----|----:----|----:----|----:----|----:----|----:----| E L N D I L P G N G T N L L V M F C M * R W I T S * R A M V P T * Y C W L V C E G F Q R N V P W * R H E I A G Y F V N L CfrI | CviJI | HaeIII | |FatI PpiI | ||CviAII | MnlI | ||| NlaIII | | MmeI | ||| |PpiI TspDTI TspEI SetI | | | DdeI \ \\\ \\ \ \ \ \ \ \ \ CAACCAATCTCGGCCATGAATACCAAGAACTCCAACTCAATTACCTCTCTCAATCACTCT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGGTTAGAGCCGGTACTTATGGTTCTTGAGGTTGAGTTAATGGAGAGAGTTAGTGAGA /// // / / / // ||| |FatI TspDTI | PpiI |MmeI ||| CviAII TspEI MnlI ||CfrI SetI |NlaIII |PpiI HaeIII CviJI Q P I S A M N T K N S N S I T S L N H S N Q S R P * I P R T P T Q L P L S I T L T N L G H E Y Q E L Q L N Y L S Q S L * ----:----|----:----|----:----|----:----|----:----|----:----| C G I E A M F V L F E L E I V E R L * E A V L R P W S Y W S S W S L * R E * D S L W D R G H I G L V G V * N G R E I V R XbaI TaqI |MaeI |Hpy178III* |Hpy178III* || HphI || TspEI || | BbvII* ||MboII | MseI || | | MboII \\\ \ \ \\ \ \ \ AAGAAGAAACAATCTAGAAAACTAATTAAATCGAGAAGACAAGATTTCACCACTAATGTA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTCTTTGTTAGATCTTTTGATTAATTTAGCTCTTCTGTTCTAAAGTGGTGATTACAT / / // // // / / DdeI | |XbaI |MseI || HphI BbvII* | Hpy178III* TspEI |Hpy178III* MboII | MaeI TaqI MboII K K K Q S R K L I K S R R Q D F T T N V R R N N L E N * L N R E D K I S P L M * E E T I * K T N * I E K T R F H H * C R ----:----|----:----|----:----|----:----|----:----|----:----| L F F C D L F S I L D L L C S K V V L T * S S V I * F V L * I S F V L N * W * H L L F L R S F * N F R S S L I E G S I Y MseI ApoI | EcoP15I TspEI \ \ \ GAAATAAACCCTATTAACAAGAACTTGTATTTCCCACACATTTCTGCTGTTCAAATTTTT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTATTTGGGATAATTGTTCTTGAACATAAAGGGTGTGTAAAGACGACAAGTTTAAAAA / / / | EcoP15I TspEI MseI ApoI E I N P I N K N L Y F P H I S A V Q I F K * T L L T R T C I S H T F L L F K F L N K P Y * Q E L V F P T H F C C S N F * ----:----|----:----|----:----|----:----|----:----|----:----| S I F G I L L F K Y K G C M E A T * I K L F L G * * C S S T N G V C K Q Q E F K F Y V R N V L V Q I E W V N R S N L N K MseI SetI |HpaI | HindII |HindII | Hpy166II |Hpy166II MseI | | TspEI \\ \ \ \ \ GACTTCTATAAAAATGAGCAAGTTAACTATCAGTATTTAACATCAGGTGTCAACAATTCT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAAGATATTTTTACTCGTTCAATTGATAGTCATAAATTGTAGTCCACAGTTGTTAAGA // / / / / |MseI MseI SetI | TspEI Hpy166II Hpy166II HindII HindII HpaI D F Y K N E Q V N Y Q Y L T S G V N N S T S I K M S K L T I S I * H Q V S T I L L L * K * A S * L S V F N I R C Q Q F Y ----:----|----:----|----:----|----:----|----:----|----:----| S K * L F S C T L * * Y K V D P T L L E Q S R Y F H A L * S D T N L M L H * C N V E I F I L L N V I L I * C * T D V I R ApoI PsrI TspEI PsrI HphI Hpy166II \ \ \ \ \ ATGGGTAAAGTTAGATTTGAACTGAATTTACAAGACCCAATAATAACTGATTTGAAGTTC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCATTTCAATCTAAACTTGACTTAAATGTTCTGGGTTATTATTGACTAAACTTCAAG / / / / / PsrI TspEI PsrI HphI Hpy166II ApoI M G K V R F E L N L Q D P I I T D L K F W V K L D L N * I Y K T Q * * L I * S S G * S * I * T E F T R P N N N * F E V H ----:----|----:----|----:----|----:----|----:----|----:----| I P L T L N S S F K C S G I I V S K F N * P Y L * I Q V S N V L G L L L Q N S T H T F N S K F Q I * L V W Y Y S I Q L E FokI AciI BciVI BsrDI | EciI Hin4I | MboII BccI BsiYI* | BseGI | TspEI Hin4I | | SetI \ \ \ \ \ \ \ \ \ \ ACCAAAGATGGGCAATGGATGATTACATACGAAATTGAGTATCCGCCAAATGACCTCTTA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTTCTACCCGTTACCTACTAATGTATGCTTTAACTCATAGGCGGTTTACTGGAGAAT / / / / / / / / / / / | BsiYI* | BseGI | | | Hin4I | | MboII BccI BsrDI | | | Hin4I | | SetI | | TspEI | BciVI | FokI AciI EciI T K D G Q W M I T Y E I E Y P P N D L L P K M G N G * L H T K L S I R Q M T S Y Q R W A M D D Y I R N * V S A K * P L I ----:----|----:----|----:----|----:----|----:----|----:----| V L S P C H I I V Y S I S Y G G F S R K * W L H A I S S * M R F Q T D A L H G R G F I P L P H N C V F N L I R W I V E * MnlI MseI Hpy178III* AsuI* |StyI | Hin4I | ApoI AvaII |SecI* | Hin4I | TspEI |BmgT120I BsmAI TspEI \\ \ \ \ \ \\ \ \ TCTTCCAAGGACTTAACTCATATCTTGAAATTTTGGACCAAAAACGATAATGAGACAAAT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGGTTCCTGAATTGAGTATAGAACTTTAAAACCTGGTTTTTGCTATTACTCTGTTTA / // / / / // / MnlI || MseI | | |AvaII BsmAI |Hin4I | | |AsuI* |Hin4I | | BmgT120I SecI* | TspEI StyI | ApoI Hpy178III* S S K D L T H I L K F W T K N D N E T N L P R T * L I S * N F G P K T I M R Q I F Q G L N S Y L E I L D Q K R * * D K L ----:----|----:----|----:----|----:----|----:----|----:----| D E L S K V * I K F N Q V L F S L S V F I K W P S L E Y R S I K S W F R Y H S L R G L V * S M D Q F K P G F V I I L C I ApoI TspEI BslFI TspEI HphI \ \ \ \ TGGAATTTGAAAACGAAAGTAATAAATCCACACGGGATAAGTGTCCCAATTACCAAGATA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTTAAACTTTTGCTTTCATTATTTAGGTGTGCCCTATTCACAGGGTTAATGGTTCTAT / / / / / TspEI TspEI BslFI TspEI HphI ApoI W N L K T K V I N P H G I S V P I T K I G I * K R K * * I H T G * V S Q L P R Y E F E N E S N K S T R D K C P N Y Q D I ----:----|----:----|----:----|----:----|----:----|----:----| Q F K F V F T I F G C P I L T G I V L I N S N S F S L L L D V R S L H G L * W S P I Q F R F Y Y I W V P Y T D W N G L Y MboI |Hin4II* ||DpnI CviJI |||BstKTI | CspCI Tsp4CI* |||| MseI | |MseI CviJI |BceAI \\\\ \ \ \\ \ \\ TTGCCTTCACCAAGATCAGTTAATAATAGTCAAGGCTGTTTAACGGCTGACAACAACGGT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AACGGAAGTGGTTCTAGTCAATTATTATCAGTTCCGACAAATTGCCGACTGTTGTTGCCA /// / / / / / / / ||| MboI MseI | | | CviJI Tsp4CI* ||DpnI | | MseI |BstKTI | CspCI Hin4II* CviJI L P S P R S V N N S Q G C L T A D N N G C L H Q D Q L I I V K A V * R L T T T V A F T K I S * * * S R L F N G * Q Q R W ----:----|----:----|----:----|----:----|----:----|----:----| N G E G L D T L L L * P Q K V A S L L P I A K V L I L * Y Y D L S N L P Q C C R Q R * W S * N I I T L A T * R S V V V T AsuI* AvaII CspCI |BmgT120I ||MlyI ||PleI ||| TaqI ||| | HinfI ||| | | FatI ||| | | BspHI ||| | | Hin4II* Hpy166II ||| | | |CviAII MwoI | ApoI ||| | | |Hpy178III* BstAPI ApoI | TspEI ||| | | || NlaIII | BsrI TspEI \ \ \\\ \ \ \\ \ \ \ \ GGACTGAAATTTTGGTCCTTCGACTCTCATGAGAGCAACTGGTGCTTGAAAAAAATTTCT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CCTGACTTTAAAACCAGGAAGCTGAGAGTACTCTCGTTGACCACGAACTTTTTTTAAAGA / // // / /// // / / / Hpy166II || || | ||| |BspHI | BsrI TspEI BceAI || || | ||| |FatI BstAPI ApoI || || | ||| | MwoI || || | ||| Hpy178III* || || | ||| CviAII || || | ||NlaIII || || | |Hin4II* || || | HinfI || || TaqI || |AvaII || |AsuI* || |PleI || BmgT120I || MlyI |CspCI TspEI ApoI G L K F W S F D S H E S N W C L K K I S D * N F G P S T L M R A T G A * K K F L T E I L V L R L S * E Q L V L E K N F F ----:----|----:----|----:----|----:----|----:----|----:----| P S F N Q D K S E * S L L Q H K F F I E H V S I K T R R S E H S C S T S S F F K S Q F K P G E V R M L A V P A Q F F N R SmlI AluI | Hpy178III* TspGWI CviJI | |BsmAI MseI | MaeIII Bce83I* | SetI | |Eco31I \ \ \ \ \ \ \ \\ TTACCAAACTTTAATCATTTCAGTAACTCCGTTTCTTTAGCTTGGTCTCAAGACGGGTCT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| AATGGTTTGAAATTAGTAAAGTCATTGAGGCAAAGAAATCGAACCAGAGTTCTGCCCAGA / / / / / / / / | TspGWI | Bce83I* | CviJI | Eco31I MseI MaeIII | AluI | BsmAI SetI Hpy178III* SmlI L P N F N H F S N S V S L A W S Q D G S Y Q T L I I S V T P F L * L G L K T G L T K L * S F Q * L R F F S L V S R R V S ----:----|----:----|----:----|----:----|----:----|----:----| K G F K L * K L L E T E K A Q D * S P D K V L S * D N * Y S R K K L K T E L R T * W V K I M E T V G N R * S P R L V P R BsmAI Eco31I | SspI | | FatI | | NcoI | | StyI | | SecI* | | DsaI* | | |CviAII CviRI* | | || NlaIII | ApoI MseI | | || | TaqI | TspEI TaqI |AhaIII* \ \ \\ \ \ \ \ \ \\ CTAATATTCCATGGTTTCGATGACAAGTTGCAAATTTTAGATTTCGACACTTTTAAAAAG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| GATTATAAGGTACCAAAGCTACTGTTCAACGTTTAAAATCTAAAGCTGTGAAAATTTTTC // / // / / / / // || | |DsaI* TaqI | TspEI TaqI |MseI || | |SecI* | ApoI AhaIII* || | |StyI CviRI* || | |NcoI || | |FatI || | CviAII || NlaIII |Eco31I |BsmAI SspI L I F H G F D D K L Q I L D F D T F K K * Y S M V S M T S C K F * I S T L L K S N I P W F R * Q V A N F R F R H F * K V ----:----|----:----|----:----|----:----|----:----|----:----| R I N W P K S S L N C I K S K S V K L F E L I G H N R H C T A F K L N R C K * F * Y E M T E I V L Q L N * I E V S K F L TspRI | Hpy166II | | MlyI | | PleI | | MaeII | | | SetI | | | TaiI TfiI | | | | HinfI HinfI Tsp4CI* | | | | | Hpy188I \ \ \ \ \ \ \ \ TTTGAATCATTGGAAAATACAAAGACGGTCAGTGAGTTCACGTTAGACTCTGAAATCCAA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTTAGTAACCTTTTATGTTTCTGCCAGTCACTCAAGTGCAATCTGAGACTTTAGGTT / // ///// // HinfI |TspRI ||||MaeII |Hpy188I TfiI Tsp4CI* |||PleI HinfI ||MlyI |TaiI |SetI Hpy166II F E S L E N T K T V S E F T L D S E I Q L N H W K I Q R R S V S S R * T L K S K * I I G K Y K D G Q * V H V R L * N P N ----:----|----:----|----:----|----:----|----:----|----:----| N S D N S F V F V T L S N V N S E S I W T Q I M P F Y L S P * H T * T L S Q F G K F * Q F I C L R D T L E R * V R F D L CfrI | BalI | CviJI | HaeIII | | BssKI ApoI | | EcoRII MseI TspEI | | | ScrFI Tsp4CI* VspI | MseI | | | BseBI MseI \ \ \ \ \ \ \ \ \ ACCGTCAAGTTGATTAATGACACAAATTTAATAGTGGCCACCAGGACTACATTAAACGCC 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCAGTTCAACTAATTACTGTGTTTAAATTATCACCGGTGGTCCTGATGTAATTTGCGG / / / / / / / / / Tsp4CI* VspI | MseI | | | EcoRII MseI MseI TspEI | | | BssKI ApoI | | BseBI | | ScrFI | CfrI HaeIII CviJI BalI T V K L I N D T N L I V A T R T T L N A P S S * L M T Q I * * W P P G L H * T P R Q V D * * H K F N S G H Q D Y I K R H ----:----|----:----|----:----|----:----|----:----|----:----| V T L N I L S V F K I T A V L V V N F A F R * T S * H C L N L L P W W S * M L R G D L Q N I V C I * Y H G G P S C * V G MseI |HpaI FauI |HindII | BccI AciI TspGWI |Hpy166II \ \ \ \ \\ ATCAACTTATTGCGGGGTCAAGTCATAAATAGTTTTGACTTATATCCGTTTGTTAACGGA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTGAATAACGCCCCAGTTCAGTATTTATCAAAACTGAATATAGGCAAACAATTGCCT // / / // |BccI AciI TspGWI |MseI FauI Hpy166II HindII HpaI I N L L R G Q V I N S F D L Y P F V N G S T Y C G V K S * I V L T Y I R L L T E Q L I A G S S H K * F * L I S V C * R S ----:----|----:----|----:----|----:----|----:----|----:----| M L K N R P * T M F L K S K Y G N T L P W * S I A P D L * L Y N Q S I D T Q * R D V * Q P T L D Y I T K V * I R K N V S TspGWI | MaeIII | Tsp45I | | FatI | | |CviAII | | || NlaIII MaeIII TsoI | | || | CviJI Tsp45I |BsrDI \ \ \\ \ \ \ \\ GTGTATAAAAATGGTCACATGGATAGGCTTATTACTTGTGACGAAAGGACAGGCAACATT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CACATATTTTTACCAGTGTACCTATCCGAATAATGAACACTGCTTTCCTGTCCGTTGTAA / // // / / // TspGWI || |FatI CviJI Tsp45I |BsrDI || CviAII MaeIII TsoI |Tsp45I |MaeIII NlaIII V Y K N G H M D R L I T C D E R T G N I C I K M V T W I G L L L V T K G Q A T L V * K W S H G * A Y Y L * R K D R Q H C ----:----|----:----|----:----|----:----|----:----|----:----| T Y L F P * M S L S I V Q S S L V P L M L T Y F H D C P Y A * * K H R F S L C C H I F I T V H I P K N S T V F P C A V N MboI |BccI BssKI ||DpnI SecI* |||BstKTI EcoRII ||||Hpy178III* | ScrFI ||||| Csp6I | BseBI PsiI |||||TaqI |RsaI TspEI \ \ \ \\\\\\ \\ \ GCCCTGGTTATAAATCAACAACTAACTGATCTCGATGGCGTACCAACTATCAATTACAAA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CGGGACCAATATTTAGTTGTTGATTGACTAGAGCTACCGCATGGTTGATAGTTAATGTTT /// / // / // // / ||| PsiI || | |TaqI |Csp6I TspEI ||EcoRII || | | RsaI ||BssKI || | Hpy178III* |SecI* || MboI BseBI |DpnI ScrFI |BccI BstKTI A L V I N Q Q L T D L D G V P T I N Y K P W L * I N N * L I S M A Y Q L S I T N P G Y K S T T N * S R W R T N Y Q L Q I ----:----|----:----|----:----|----:----|----:----|----:----| A R T I F * C S V S R S P T G V I L * L Q G P * L D V V L Q D R H R V L * * N C G Q N Y I L L * S I E I A Y W S D I V F TaqI FatI | TfiI BspHI | HinfI |CviAII | | Hpy188I TspEI TspEI |Hpy178III* \ \ \ \ \ \\ TCCCGTATTATTATATTCGATTCTGACTTATCTACAAAATTGGGTAATTTTACGCATCAT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| AGGGCATAATAATATAAGCTAAGACTGAATAGATGTTTTAACCCATTAAAATGCGTAGTA / // / / / // | |Hpy188I TspEI TspEI | |Hpy178III* | HinfI | |CviAII | TfiI | MmeI TaqI NlaIII S R I I I F D S D L S T K L G N F T H H P V L L Y S I L T Y L Q N W V I L R I M P Y Y Y I R F * L I Y K I G * F Y A S * ----:----|----:----|----:----|----:----|----:----|----:----| D R I I I N S E S K D V F N P L K V C * I G Y * * I R N Q S I * L I P Y N * A D G T N N Y E I R V * R C F Q T I K R M M MmeI MmeI NlaIII Hin4I |TfiI | SfaNI TspDTI TspEI TspDTI Hin4I |HinfI \ \ \ \ \ \ \\ GAATACATATCTTGGATTGGTTGGAATTATGATACTGATTTCATATTTTTGGACATAGAA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATGTATAGAACCTAACCAACCTTAATACTATGACTAAAGTATAAAAACCTGTATCTT / / / / / / BspHI | TspDTI TspDTI Hin4I MmeI FatI SfaNI TspEI Hin4I E Y I S W I G W N Y D T D F I F L D I E N T Y L G L V G I M I L I S Y F W T * N I H I L D W L E L * Y * F H I F G H R I ----:----|----:----|----:----|----:----|----:----|----:----| S Y M D Q I P Q F * S V S K M N K S M S H I C I K S Q N S N H Y Q N * I K P C L F V Y R P N T P I I I S I E Y K Q V Y F MaeI | DraIII | |TstI | ||SetI | ||| Hin4I | ||| Hin4I | ||| | Hpy188I Tsp4CI* TstI MseI | ||| | | NlaIV | TspRI | Hpy188I | Hin4II* \ \\\ \ \ \ \ \ \ \ \ \ TCAACACTAGGTGTTGTCGGAACCACTGTGAATACTCAACTATCTGATGAAGTTAATAAC 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTGTGATCCACAACAGCCTTGGTGACACTTATGAGTTGATAGACTACTTCAATTATTG / ///// / / / / / // / | ||||Hin4I | | Tsp4CI* TstI Hpy188I |MseI TspDTI | ||||Hin4I | NlaIV Hin4II* | |||MaeI | TspRI | ||SetI Hpy188I | |DraIII | TstI HinfI TfiI S T L G V V G T T V N T Q L S D E V N N Q H * V L S E P L * I L N Y L M K L I T N T R C C R N H C E Y S T I * * S * * R ----:----|----:----|----:----|----:----|----:----|----:----| D V S P T T P V V T F V * S D S S T L L I L V L H Q R F W Q S Y E V I Q H L * Y * C * T N D S G S H I S L * R I F N I V BssKI CviJI EcoRII HaeIII TspDTI |BseGI | BccI ||ScrFI FokI BcgI | |SspI ||BseBI MaeIII FokI BccI BseGI SfaNI \ \\ \\\ \ \ \ \ \ GAAGGAATATTGGATGGCCTGGTAAGTAACACCATCACAACTTCGGCATCCAATAGCGAT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCCTTATAACCTACCGGACCATTCATTGTGGTAGTGTTGAAGCCGTAGGTTATCGCTA / // / / // / / / / SspI || | EcoRII |MaeIII | | BseGI SfaNI BccI || | BssKI FokI | | BcgI || BseBI | BccI || ScrFI FokI |HaeIII |CviJI BseGI E G I L D G L V S N T I T T S A S N S D K E Y W M A W * V T P S Q L R H P I A I R N I G W P G K * H H H N F G I Q * R Y ----:----|----:----|----:----|----:----|----:----|----:----| S P I N S P R T L L V M V V E A D L L S R L F I P H G P L Y C W * L K P M W Y R F S Y Q I A Q Y T V G D C S R C G I A I CviRI* | MfeI | TspEI | | CviRI* Tsp4CI* MaeIII | | | BcgI | MaeI Tsp45I MaeI \ \ \ \ \ \ \ \ ATTTTTGCAGAACAATTGCATAAACTGTCGTCTAGGGGCAAAAAAAGTGACACTAGAGAT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAACGTCTTGTTAACGTATTTGACAGCAGATCCCCGTTTTTTTCACTGTGATCTCTA / // / / / / CviRI* |CviRI* Tsp4CI* MaeI | MaeI |BcgI Tsp45I TspEI MaeIII MfeI I F A E Q L H K L S S R G K K S D T R D F L Q N N C I N C R L G A K K V T L E I F C R T I A * T V V * G Q K K * H * R * ----:----|----:----|----:----|----:----|----:----|----:----| I K A S C N C L S D D L P L F L S V L S Y K Q L V I A Y V T T * P C F F H C * L N K C F L Q M F Q R R P A F F T V S S I MboII | EcoRV | | MboII | | |TspDTI | | || MboII | | || | ApoI Hpy99I | | || | TspEI PsiI \ \ \ \\ \ \ \ AAAAATACCAATGATAACGACGAAGATGAAGAAGATATCGCTTTGGAATTTATAAATGGC 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTATGGTTACTATTGCTGCTTCTACTTCTTCTATAGCGAAACCTTAAATATTTACCG / / / / / / / Hpy99I | | | MboII | PsiI | | TspDTI TspEI | | MboII ApoI | EcoRV MboII K N T N D N D E D E E D I A L E F I N G K I P M I T T K M K K I S L W N L * M A K Y Q * * R R R * R R Y R F G I Y K W R ----:----|----:----|----:----|----:----|----:----|----:----| L F V L S L S S S S S S I A K S N I F P Y F Y W H Y R R L H L L Y R K P I * L H F I G I I V V F I F F I D S Q F K Y I A BdaI BdaI | TspDTI AluI | |FatI CviJI | ||CviAII |MaeI | ||| NspI ||SetI | ||| NlaIII \\\ \ \\\ \ GAAAAGAAAGATAAGCTAGTCAATATGAATAGTTTTACGAGCATGTTTGACAACATTCAA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTCTTTCTATTCGATCAGTTATACTTATCAAAATGCTCGTACAAACTGTTGTAAGTT / / / / / / // | | MaeI | | | |FatI | CviJI | | | CviAII | AluI | | NlaIII SetI | | NspI | TspDTI BdaI BdaI E K K D K L V N M N S F T S M F D N I Q K R K I S * S I * I V L R A C L T T F K K E R * A S Q Y E * F Y E H V * Q H S K ----:----|----:----|----:----|----:----|----:----|----:----| S F F S L S T L I F L K V L M N S L M * R F S L Y A L * Y S Y N * S C T Q C C E F L F I L * D I H I T K R A H K V V N L MaeII | SetI | TaiI | |BciVI | |CviRI* MboI | || BdaI | DpnI | || BdaI | |BstKTI MseI TspDTI \ \\ \ \ \\ \ \ AACGTGCAAATGGATACATTTTTTGATCGTGTGATGAAAGTATTAACATAG 2650 2660 2670 2680 2690 ----:----|----:----|----:----|----:----|----:----|- TTGCACGTTTACCTATGTAAAAAACTAGCACACTACTTTCATAATTGTATC / /// / // / / / | ||| BdaI || MboI | TspDTI | ||| BdaI |DpnI MseI | ||CviRI* BstKTI | |BciVI | MaeII TaiI SetI N V Q M D T F F D R V M K V L T * T C K W I H F L I V * * K Y * H X R A N G Y I F * S C D E S I N I X ----:----|----:----|----:----|----:----|----:----|- F T C I S V N K S R T I F T N V Y F R A F P Y M K Q D H S S L I L M V H L H I C K K I T H H F Y * C L # Enzymes that cut Frequency Isoschizomers AatII 1 AciI 5 BspACI,SsiI AclI 2 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 2 DraI AluI 5 AluBI ApoI 12 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AvaII 4 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BalI 2 MlsI,MluNI,MscI,Msp20I BamHI 1 BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 8 Bce83I* 2 BpuEI BceAI 1 BcgI 1 BciVI 2 BfuI BdaI 8 BetI* 3 BsaWI BinI* 2 AlwI,BspPI,AclWI BmgT120I 5 BmtI 1 BspOI Bpu10I 1 BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 2 BseYI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 4 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 2 BspHI 2 CciI,PagI,RcaI BspMII* 2 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 2 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstAPI 1 BstKTI 7 Cac8I 3 BstC8I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 4 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 3 CviQI,RsaNI CspCI 1 CviAII 8 CviJI 17 CviKI-1 CviRI* 10 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 7 MalI DraII 2 EcoO109I DraIII 1 AdeI DsaI* 1 BtgI,BstDSI EciI 1 Eco31I 2 Bso31I,BspTNI,BsaI EcoP15I 2 EcoRII 4 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI FatI 8 FauI 3 SmuI FokI 4 GlaI 1 GsaI 1 HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HhaI 1 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 3 HpyAV Hin6I 1 HinP1I,HspAI HindII 4 HincII HindIII 2 HinfI 12 HpaI 2 KspAI HpaII 4 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 11 Hpy188III Hpy188I 8 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 10 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 7 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 11 MfeI 2 MunI MlyI 6 SchI MmeI 4 MnlI 8 MseI 22 Tru1I,Tru9I MwoI 3 HpyF10VI,BstMWI NcoI 1 Bsp19I NdeI 1 FauNDI NheI 1 AsuNHI NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NmeAIII 1 NspI 1 BstNSI,XceI PleI 6 PpsI PpiI 2 PpuMI 2 Psp5II,PspPPI PshAI 1 BstPAI,BoxI PsiI 5 AanI PsrI 1 RsaI 3 AfaI ScrFI 4 BmrFI,MspR9I,Bme1390I SecI* 5 BseDI,BssECI,BsaJI SetI 23 SfaNI 3 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 2 SmoI SspI 4 StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaiI 6 TaqI 11 TaqII 1 TfiI 6 PfeI TsoI 1 Tsp45I 4 NmuCI Tsp4CI* 11 HpyCH4III,TaaI,Bst4CI TspDTI 9 TspEI 31 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 2 TscAI TstI 2 VspI 1 PshBI,AseI XbaI 1 XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AccI AflII AflIII AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI BaeI BarI BbvCI BbvI BclI BfiI BglI BglII BisI BlsI BmeT110I BplI BsaAI BsaBI BsaXI BsePI BseRI BseSI BsgI BsiI* Bsp120I Bsp1407I BspLU11I* BspMI BsrBI BssNAI Bst1107I BstEII BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr9I DinI DrdI Eam1105I Ecl136II Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRI EgeI EheI EspI* FalI Fnu4HI FnuDII* FseI FspAI GsuI HaeII HgiAI* HgiCI* HgiJII* KasI KpnI MauBI McrI* MluI MroNI MslI MstI* NaeI NarI NgoMIV NotI NruI NspBII* OliI PacI PasI PflMI PfoI PmaCI PmeI PspOMI PspXI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TatI TauI TseI TspMI Tth111I XhoI XmaCI XmaI XmaIII* XmnI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769