Restriction Map of MSD1/YPL104W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

MSD1/YPL104W on chromosome XVI from coordinates 355700 to 357676.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.16023

AsuI* |CviJI |HaeIII |BmgT120I || BssKI || EcoRII || |SecI* || |BsiYI* || ||ScrFI || ||BseBI Cac8I || ||BsiYI* | CviRI* MaeI Tsp4CI* Hpy178III* \\ \\\ \ \ \ \ \ ATGTTGGCCCGTTCCAGGGTGTGCTTGCAGACAATCACTAGACGGTTGGCAGACTTTCCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAACCGGGCAAGGTCCCACACGAACGTCTGTTAGTGATCTGCCAACCGTCTGAAAGGT /// // / / / / / / / ||| || | EcoRII | CviRI* | Tsp4CI* Hpy178III* ||| || | BssKI Cac8I MaeI ||| || | SecI* ||| || BseBI ||| || ScrFI ||| |BsiYI* ||| BsiYI* ||AsuI* |BmgT120I HaeIII CviJI M L A R S R V C L Q T I T R R L A D F P C W P V P G C A C R Q S L D G W Q T F Q V G P F Q G V L A D N H * T V G R L S R ----:----|----:----|----:----|----:----|----:----|----:----| X N A R E L T H K C V I V L R N A S K G X T P G N W P T S A S L * * V T P L S E H Q G T G P H A Q L C D S S P Q C V K W MnlI ApoI TaqI | BccI CviJI MseI TspEI Hin4II* SetI | |Tsp4CI* \ \ \ \ \ \ \\ GAAGCCAATGCTATTAAGAAAAAATTTCTCTTTAGGAAGGACACCTCGACCATCAAACAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGGTTACGATAATTCTTTTTTAAAGAGAAATCCTTCCTGTGGAGCTGGTAGTTTGTC / / / / / / / // CviJI MseI | Hin4II* SetI TaqI MnlI |BccI TspEI Tsp4CI* ApoI E A N A I K K K F L F R K D T S T I K Q K P M L L R K N F S L G R T P R P S N S S Q C Y * E K I S L * E G H L D H Q T V ----:----|----:----|----:----|----:----|----:----|----:----| S A L A I L F F N R K L F S V E V M L C L L W H * * S F I E R * S P C R S W * V F G I S N L F F K E K P L V G R G D F L Tsp4CI* | MaeI | | AciI | | |CfrI | | |BisI TatI | | ||BlsI |Csp6I | | |||TauI ||RsaI | | |||CviJI ||ScaI FokI MseI | | |||HaeIII ||| BccI BseGI | CviJI \ \ \ \\\\ \\\ \ \ \ \ TTAAAAGGACTGTCTAGCGGCCAGAAAATAGTACTCAATGGATGGATAGAGCAGAAGCCA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTTCCTGACAGATCGCCGGTCTTTTATCATGAGTTACCTACCTATCTCGTCTTCGGT / / ///// / /// / / / MseI | ||||| CfrI ||| BccI BseGI CviJI | ||||HaeIII ||TatI FokI | ||||CviJI |Csp6I | |||BisI ScaI | |||AciI RsaI | ||BlsI | |TauI | MaeI Tsp4CI* L K G L S S G Q K I V L N G W I E Q K P * K D C L A A R K * Y S M D G * S R S Q K R T V * R P E N S T Q W M D R A E A K ----:----|----:----|----:----|----:----|----:----|----:----| N F P S D L P W F I T S L P H I S C F G T L L V T * R G S F L V * H I S L A S A * F S Q R A A L F Y Y E I S P Y L L L W ApoI MboII TspEI | MboI | | DpnI | | |BstKTI | | || Hpy188I MaeIII | | || | MlyI Tsp45I | | || | PleI Tsp4CI* | | || | MseI HinfI | BslFI BsrI \ \ \\ \ \ \ \ \ \ AAAAGAGTTGGGAAAAATTTGATCTTCGGACTTTTAAGGGACTCTAACGGTGACATTATC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCTCAACCCTTTTTAAACTAGAAGCCTGAAAATTCCCTGAGATTGCCACTGTAATAG / / // / / /// / / / / / / | | || | | ||MseI | | | | | HphI | | || | | |PleI | | | | BsrI | | || | | MlyI | | | BslFI | | || | Hpy188I | | | Hin4I | | || MboI | | | Hin4I | | |DpnI | | Tsp45I | | BstKTI | | MaeIII | TspEI | Tsp4CI* | ApoI HinfI MboII K R V G K N L I F G L L R D S N G D I I K E L G K I * S S D F * G T L T V T L S K S W E K F D L R T F K G L * R * H Y P ----:----|----:----|----:----|----:----|----:----|----:----| F L T P F F K I K P S K L S E L P S M I L F L Q S F N S R R V K L P S * R H C * F S N P F I Q D E S K * P V R V T V N D CviJI HphI |Hin4I Hin4I |Hin4I FokI Hin4I || MnlI BceAI BseGI CviJI \ \\ \ \ \ \ CAGTTGGTTGATAACAAATCGTTGTTGAAAGGCTTTACTTTAGAGGATGTGGTTCAAGCC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTCAACCAACTATTGTTTAGCAACAACTTTCCGAAATGAAATCTCCTACACCAAGTTCGG / / / / / / | | MnlI | BseGI CviJI | CviJI BceAI Hin4I Hin4I Q L V D N K S L L K G F T L E D V V Q A S W L I T N R C * K A L L * R M W F K P V G * * Q I V V E R L Y F R G C G S S R ----:----|----:----|----:----|----:----|----:----|----:----| W N T S L L D N N F P K V K S S T T * A G T P Q Y C I T T S L S * K L P H P E L L Q N I V F R Q Q F A K S * L I H N L G AccI SetI AluI |BssNAI CviJI |Hpy166II | SetI HgaI || Ksp632I* | |MnlI | Csp6I MnlI || |MnlI | |MboII | |RsaI CviRI* \\ \\ \ \\ \ \\ \ GTAGGTATACTCTCTTTGAAGAGGAAGCTATCAAATGAGGACGCAGATGAGTACGAAGTG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CATCCATATGAGAGAAACTTCTCCTTCGATAGTTTACTCCTGCGTCTACTCATGCTTCAC / // / / / / / /// // FokI |AccI | Ksp632I* | | MboII ||HgaI |CviRI* SetI | MnlI | | MnlI |Csp6I MnlI Hpy166II | CviJI RsaI BssNAI | AluI SetI V G I L S L K R K L S N E D A D E Y E V * V Y S L * R G S Y Q M R T Q M S T K C R Y T L F E E E A I K * G R R * V R S A ----:----|----:----|----:----|----:----|----:----|----:----| T P I S E K F L F S D F S S A S S Y S T R L Y V R K S S S A I L H P R L H T R L Y T Y E R Q L P L * * I L V C I L V F H CviRI* Hin6I MfeI Tsp4CI* | EcoT22I |GlaI TspEI | MseI | | SfaNI ||HhaI CviRI* \ \ \ \ \ \ \\\ \ CAATTGGAGGATATTACTGTGTTAAATGCATCTAATAAAAAACCAGCGCAAATGCAGGAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAACCTCCTATAATGACACAATTTACGTAGATTATTTTTTGGTCGCGTTTACGTCCTA / / / / / / /// / TspEI | | | CviRI* | ||Hin6I CviRI* MfeI | | EcoT22I | |GlaI | MseI | HhaI Tsp4CI* SfaNI Q L E D I T V L N A S N K K P A Q M Q D N W R I L L C * M H L I K N Q R K C R I I G G Y Y C V K C I * * K T S A N A G F ----:----|----:----|----:----|----:----|----:----|----:----| C N S S I V T N F A D L L F G A C I C S A I P P Y * Q T L H M * Y F V L A F A P L Q L I N S H * I C R I F F W R L H L I CviJI CviRI* MseI |TstI |MfeI |AhaIII* || BseMII DdeI |TspEI ||TspEI || |BspCNI |SetI AciI || TstI \\\ \\ \\ \\ \ \\ \ TTTAAATTGTCAGCCATATACCCACCTGAGTTCCGCTATTTGCAATTGAGAAATCCCAAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTTAACAGTCGGTATATGGGTGGACTCAAGGCGATAAACGTTAACTCTTTAGGGTTT // // / // / / / // / || || | |BspCNI SetI DdeI AciI || TspEI || || | BseMII || MfeI || || CviJI |CviRI* || |TstI TstI || TspEI |MseI AhaIII* F K L S A I Y P P E F R Y L Q L R N P K L N C Q P Y T H L S S A I C N * E I P N * I V S H I P T * V P L F A I E K S Q I ----:----|----:----|----:----|----:----|----:----|----:----| K L N D A M Y G G S N R * K C N L F G L N * I T L W I G V Q T G S N A I S F D W K F Q * G Y V W R L E A I Q L Q S I G F Hpy178III* | MseI | Ksp632I* | |MnlI MboII | |AhaIII* SetI | DdeI TspEI \ \\ \ \ \ \ TATCAAGATTTTTTAAAGAAGAGGTCATCTATCTCTAAGGAAATAAGAAACTCCTTCAAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGTTCTAAAAAATTTCTTCTCCAGTAGATAGAGATTCCTTTATTCTTTGAGGAAGTTG / //// / / / | |||| SetI MboII DdeI | |||Ksp632I* | ||MseI | |AhaIII* | MnlI Hpy178III* Y Q D F L K K R S S I S K E I R N S F N I K I F * R R G H L S L R K * E T P S T S R F F K E E V I Y L * G N K K L L Q Q ----:----|----:----|----:----|----:----|----:----|----:----| Y * S K K F F L D D I E L S I L F E K L I D L N K L S S T M * R * P F L F S R * I L I K * L L P * R D R L F Y S V G E V BsmAI MseI Eco31I |AhaIII* | TaqI || AluI | SetI || CviJI Hin6I Hin4II* | |Hpy178III* || | SetI |GlaI | MnlI | || TspGWI || | |Hin4II* ||HhaI \ \ \ \\ \ \\ \ \\ \\\ AATTTTGATTTTACGGAGGTCGAGACCCCAATGTTATTTAAAGCTACCCCAGAAGGCGCA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAAACTAAAATGCCTCCAGCTCTGGGGTTACAATAAATTTCGATGGGGTCTTCCGCGT / / / / / // / /// / / /// | | MnlI | | || TspGWI ||| | Hin4II* ||Hin6I | TspEI | | |Hpy178III* ||| CviJI |GlaI Hin4II* | | TaqI ||| AluI HhaI | Eco31I ||SetI | BsmAI |MseI SetI AhaIII* N F D F T E V E T P M L F K A T P E G A I L I L R R S R P Q C Y L K L P Q K A Q F * F Y G G R D P N V I * S Y P R R R K ----:----|----:----|----:----|----:----|----:----|----:----| L K S K V S T S V G I N N L A V G S P A C N Q N * P P R S G L T I * L * G L L R I K I K R L D L G W H * K F S G W F A C BinI* | BccI | MboI | XhoII | | DpnI | | |BstKTI | | || Hpy188I | | || | MmeI NlaIV | | || | | Hpy166II BccI XbaI \ \ \ \\ \ \ \ \ \ AGAGAGTTTCTGGTTCCAACAAGGACAAAGAGATCCGATGGTAAACCATCGTTTTATGCT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCTCAAAGACCAAGGTTGTTCCTGTTTCTCTAGGCTACCATTTGGTAGCAAAATACGA / / // / / / / NlaIV | || | MmeI Hpy166II BccI | || Hpy188I | || XhoII | || MboI | |DpnI | BstKTI | BccI BinI* R E F L V P T R T K R S D G K P S F Y A E S F W F Q Q G Q R D P M V N H R F M L R V S G S N K D K E I R W * T I V L C S ----:----|----:----|----:----|----:----|----:----|----:----| L S N R T G V L V F L D S P L G D N * A L L T E P E L L S L S I R H Y V M T K H S L K Q N W C P C L S G I T F W R K I S MaeI Hpy178III* | MboI | | DpnI | | |BstKTI | | || Hpy188I | | || | CviJI FalI | | || | | SduI FalI | | || | | HgiJII* | HindII | | || | | | FalI CviJI | Hpy166II | | || | | | FalI MnlI TsoI MseI |MaeI | | SspI \ \ \\ \ \ \ \ \ \ \ \\ \ \ \ CTAGATCAGAGCCCTCAACAATACAAGCAACTCTTAATGGCTAGTGGTGTCAACAAATAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GATCTAGTCTCGGGAGTTGTTATGTTCGTTGAGAATTACCGATCACCACAGTTGTTTATA /// / / / / / / / / / / ||| | | CviJI | TsoI | | FalI | SspI ||| | | FalI MnlI | | FalI Hpy166II ||| | | FalI | | MaeI HindII ||| | HgiJII* | CviJI ||| | SduI MseI ||| Hpy188I ||| MboI ||DpnI |BstKTI |XbaI Hpy178III* MaeI L D Q S P Q Q Y K Q L L M A S G V N K Y * I R A L N N T S N S * W L V V S T N I R S E P S T I Q A T L N G * W C Q Q I L ----:----|----:----|----:----|----:----|----:----|----:----| R S * L G * C Y L C S K I A L P T L L Y E L D S G E V I C A V R L P * H H * C I * I L A R L L V L L E * H S T T D V F I MboII |TspDTI || BseMII || |BspCNI || || TseI || || |BisI || || ||BlsI || || |||CviJI Hpy166II SetI MseI || || |||| DdeI |BbvI \ \ \\ \\ \\\\ \ \\ TATCAAATGGCAAGGTGCTTTAGAGATGAAGATTTAAGAGCAGACAGGCAGCCTGAGTTT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGTTTACCGTTCCACGAAATCTCTACTTCTAAATTCTCGTCTGTCCGTCGGACTCAAA / / / // /// / / SetI | | || ||| | Hpy166II | | || ||| DdeI | | || ||CviJI | | || ||TseI | | || |BisI | | || BlsI | | |BspCNI | | BseMII | TspDTI | MboII MseI Y Q M A R C F R D E D L R A D R Q P E F I K W Q G A L E M K I * E Q T G S L S L S N G K V L * R * R F K S R Q A A * V Y ----:----|----:----|----:----|----:----|----:----|----:----| * * I A L H K L S S S K L A S L C G S N N D F P L T S * L H L N L L L C A A Q T I L H C P A K S I F I * S C V P L R L K FatI BspHI |CviAII |Hpy178III* CviJI || NlaIII Eco57I SetI HaeIII TspEI Hpy188I || |MboII Eco57MI \ \ \ \ \\ \\ \ ACACAGGTTGATATGGAAATGGCCTTTGCTAATTCTGAAGATGTCATGAAAATCATAGAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGTCCAACTATACCTTTACCGGAAACGATTAAGACTTCTACAGTACTTTTAGTATCTT / / // / // / / BbvI HaeIII |Hpy188I | |MboII | TspDTI SetI CviJI TspEI | |BspHI Eco57MI | |FatI Eco57I | Hpy178III* | CviAII NlaIII T Q V D M E M A F A N S E D V M K I I E H R L I W K W P L L I L K M S * K S * K T G * Y G N G L C * F * R C H E N H R K ----:----|----:----|----:----|----:----|----:----|----:----| V C T S I S I A K A L E S S T M F I M S * V P Q Y P F P R Q * N Q L H * S F * L C L N I H F H G K S I R F I D H F D Y F TspDTI | Tsp4CI* ApoI | | AlwNI TspEI MnlI BaeI \ \ \ \ \ \ AAGACAGTTTCTGGGGTATGGAGTAAATTTTCCAAAAAACGAGGATTATTGACTTTAGAC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTGTCAAAGACCCCATACCTCATTTAAAAGGTTTTTTGCTCCTAATAACTGAAATCTG / / / / / / | AlwNI | MnlI BaeI Tsp4CI* Tsp4CI* TspEI ApoI K T V S G V W S K F S K K R G L L T L D R Q F L G Y G V N F P K N E D Y * L * T D S F W G M E * I F Q K T R I I D F R Q ----:----|----:----|----:----|----:----|----:----|----:----| F V T E P T H L L N E L F R P N N V K S F S L K Q P I S Y I K W F V L I I S K L L C N R P Y P T F K G F F S S * Q S * V Tsp4CI* | Csp6I | |RsaI Cac8I BaeI Tsp4CI* BceAI \ \\ \ \ \ \ AGTAAGGGTACATTAGTGCCTGCGAAAAAGGAAAACGGCACAGTATCTATCTTTCGTATG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTCCCATGTAATCACGGACGCTTTTTCCTTTTGCCGTGTCATAGATAGAAAGCATAC // / / / / / |Csp6I Cac8I BaeI Tsp4CI* BceAI SetI RsaI S K G T L V P A K K E N G T V S I F R M V R V H * C L R K R K T A Q Y L S F V * * G Y I S A C E K G K R H S I Y L S Y D ----:----|----:----|----:----|----:----|----:----|----:----| L L P V N T G A F F S F P V T D I K R I C Y P Y M L A Q S F P F R C L I * R E Y T L T C * H R R F L F V A C Y R D K T H CviJI BdaI |FatI BdaI ||CviAII |Hin6I ||| NlaIII ||GlaI ||| | SetI |||HhaI SetI ||| | | NdeI MnlI CviJI ||||HaeII \ \\\ \ \ \ \ \ \\\\\ ACCTACGAACAAGCCATGACCTCATATGGTATTGACAAGCCAGATTTGAGAGCGCCAGAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TGGATGCTTGTTCGGTACTGGAGTATACCATAACTGTTCGGTCTAAACTCTCGCGGTCTA // // / / / / //// || |FatI | MnlI CviJI | |||Hin6I || |SetI NdeI | ||GlaI || CviAII | |HhaI |NlaIII | HaeII CviJI BdaI BdaI T Y E Q A M T S Y G I D K P D L R A P D P T N K P * P H M V L T S Q I * E R Q I L R T S H D L I W Y * Q A R F E S A R F ----:----|----:----|----:----|----:----|----:----|----:----| V * S C A M V E Y P I S L G S K L A G S S R R V L W S R M H Y Q C A L N S L A L G V F L G H G * I T N V L W I Q S R W I BcgI | TspEI BdaI ApoI | | MboII BdaI BcgI TspEI \ \ \ \ \ \ TTGAAGATTATCAATTTAGGCGAGTTCAATGCCTTTAGTCATTTGAACAAAAAATTTCCC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTCTAATAGTTAAATCCGCTCAAGTTACGGAAATCAGTAAACTTGTTTTTTAAAGGG / / / / / / BcgI | TspEI BdaI BcgI TspEI MboII BdaI ApoI L K I I N L G E F N A F S H L N K K F P * R L S I * A S S M P L V I * T K N F P E D Y Q F R R V Q C L * S F E Q K I S R ----:----|----:----|----:----|----:----|----:----|----:----| K F I I L K P S N L A K L * K F L F N G N S S * * N L R T * H R * D N S C F I E Q L N D I * A L E I G K T M Q V F F K G TatI |Csp6I ||RsaI ||| BccI TspEI DdeI Ksp632I* ||| | MboII \ \ \ \\\ \ \ GTTTTTGAAGTAATTATTCTAAGAAGTGCCTTTTCAAATATGGAAGAGTACAAAGAACGA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAAACTTCATTAATAAGATTCTTCACGGAAAAGTTTATACCTTCTCATGTTTCTTGCT / / / /// / TspEI DdeI | ||| MboII | ||| BccI | ||TatI | |Csp6I | RsaI Ksp632I* V F E V I I L R S A F S N M E E Y K E R F L K * L F * E V P F Q I W K S T K N D F * S N Y S K K C L F K Y G R V Q R T M ----:----|----:----|----:----|----:----|----:----|----:----| T K S T I I R L L A K E F I S S Y L S R R K Q L L * E L F H R K L Y P L T C L V N K F Y N N * S T G K * I H F L V F F S Tsp4CI* MfeI Hpy188I | TspEI TspEI TspEI \ \ \ \ \ TGGTCGTTTCTGACAAATAACAGTAATTACAATTATAGAGTTCCAATAGTGCTACCAATT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| ACCAGCAAAGACTGTTTATTGTCATTAATGTTAATATCTCAAGGTTATCACGATGGTTAA / / / / / Hpy188I | TspEI TspEI TspEI Tsp4CI* MfeI W S F L T N N S N Y N Y R V P I V L P I G R F * Q I T V I T I I E F Q * C Y Q L V V S D K * Q * L Q L * S S N S A T N * ----:----|----:----|----:----|----:----|----:----|----:----| H D N R V F L L L * L * L T G I T S G I I T T E S L Y C Y N C N Y L E L L A V L P R K Q C I V T I V I I S N W Y H * W N AluI CviJI FatI | SetI |CviAII MaeII | TspEI || CviRI* |BdaI | | BdaI TspDTI || NlaIII |BdaI | | BdaI | ApoI || |MfeI || SetI | | | TspEI | TspEI || |TspEI || TaiI \ \ \ \ \ \ \\ \\ \\ \ GAAAATGACGAACAAGCTAATTCAAATTGGTTTGAGAATTTTCATGCAATTGCCACGTTT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTACTGCTTGTTCGATTAAGTTTAACCAAACTCTTAAAAGTACGTTAACGGTGCAAA / / / / // / / // / / / | | | TspEI |TspDTI | | || | | MaeII | | BdaI TspEI | | || | BdaI | | BdaI | | || | BdaI | CviJI | | || | TaiI | AluI | | || | SetI SetI | | || TspEI | | || MfeI | | |CviRI* | | |FatI | | CviAII | NlaIII TspEI ApoI E N D E Q A N S N W F E N F H A I A T F K M T N K L I Q I G L R I F M Q L P R L K * R T S * F K L V * E F S C N C H V * ----:----|----:----|----:----|----:----|----:----|----:----| S F S S C A L E F Q N S F K * A I A V N Q F H R V L * N L N T Q S N E H L Q W T F I V F L S I * I P K L I K M C N G R K MaeIII ApoI Hpy188I Tsp45I HphI TspEI | TsoI | SetI |AciI \ \ \ \ \ \\ GAAAACCCACATCTAATAACCAAATTTCTGAAACTGAAAAAAGGTGACATTGTATGCGGT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTGGGTGTAGATTATTGGTTTAAAGACTTTGACTTTTTTCCACTGTAACATACGCCA / / / / / / / | | TsoI SetI | | AciI | Hpy188I | HphI TspEI Tsp45I ApoI MaeIII E N P H L I T K F L K L K K G D I V C G K T H I * * P N F * N * K K V T L Y A V K P T S N N Q I S E T E K R * H C M R L ----:----|----:----|----:----|----:----|----:----|----:----| S F G C R I V L N R F S F F P S M T H P Q F G V D L L W I E S V S F L H C Q I R F V W M * Y G F K Q F Q F F T V N Y A T BssKI SecI* EcoRII |PasI TaqI |SecI* |Hpy178III* ||ScrFI Csp6I || TfiI ||BseBI |RsaI CviJI || HinfI ||| BsmAI \\ \ \\ \ \\\ \ TGTACGAGAGAGCCAAACCATTCCATTTTCGAGAATCCTACTCCCCTGGGAAGATTGAGA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| ACATGCTCTCTCGGTTTGGTAAGGTAAAAGCTCTTAGGATGAGGGGACCCTTCTAACTCT // / // / /// / |Csp6I CviJI || HinfI ||| BsmAI RsaI || TfiI ||EcoRII |Hpy178III* ||BssKI TaqI ||SecI* |SecI* |PasI BseBI ScrFI C T R E P N H S I F E N P T P L G R L R V R E S Q T I P F S R I L L P W E D * D Y E R A K P F H F R E S Y S P G K I E T ----:----|----:----|----:----|----:----|----:----|----:----| Q V L S G F W E M K S F G V G R P L N L N Y S L A L G N W K R S D * E G P F I S T R S L W V M G N E L I R S G Q S S Q S FatI FatI |CviAII MboII |CviAII || NlaIII Tsp4CI* || NlaIII || | Hin4I BseGI \ \\ \ \\ \ \ \ CAGTTGGTGCTACAAAGTGAGCATGGGAAAAATATCTATCATGCTGTCAATAAGGATGTT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GTCAACCACGATGTTTCACTCGTACCCTTTTTATAGATAGTACGACAGTTATTCCTACAA / / // / /// / Tsp4CI* | |FatI | ||FatI BseGI MboII | CviAII | |CviAII NlaIII | Hin4I NlaIII Q L V L Q S E H G K N I Y H A V N K D V S W C Y K V S M G K I S I M L S I R M L V G A T K * A W E K Y L S C C Q * G C C ----:----|----:----|----:----|----:----|----:----|----:----| C N T S C L S C P F F I * * A T L L S T V T P A V F H A H S F Y R D H Q * Y P H L Q H * L T L M P F I D I M S D I L I N FatI |CviAII || FokI FalI || |NlaIII PsiI FalI || || MnlI Hin4I |TspEI | MboII \\ \\ \ \ \\ \ \ GCCTCATGGATTGTGGATTTCCCGTTATTTTCTCCCGTTATAATTGAAGATAAGTCTGGT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAGTACCTAACACCTAAAGGGCAATAAAAGAGGGCAATATTAACTTCTATTCAGACCA / // / / / / / / | || | Hin4I PsiI TspEI FalI MboII | || FokI FalI | || MnlI | |FatI | CviAII NlaIII A S W I V D F P L F S P V I I E D K S G P H G L W I S R Y F L P L * L K I S L V L M D C G F P V I F S R Y N * R * V W * ----:----|----:----|----:----|----:----|----:----|----:----| A E H I T S K G N N E G T I I S S L D P Q R M S Q P N G T I K E R * L Q L Y T Q G * P N H I E R * K R G N Y N F I L R T HindIII | AluI | CviJI | | SetI | | Cac8I | | | CviRI* | | | | BetI* | | | | BspMII* | | | | |HpaII | | | | |Hpy178III* | | | | || Csp6I | | | | || |RsaI | | | | || |FalI TstI | | | | || |FalI | FokI BseGI \ \ \ \ \\ \\ \ \ \ AAAAAAGAAAAGCTTGCATATCCGGAGTACGAAAAGGATAGACTATGTTCCACGCATCAT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTCTTTTCGAACGTATAGGCCTCATGCTTTTCCTATCTGATACAAGGTGCGTAGTA / / / / /// // / / / | | | CviRI* ||| |Csp6I TstI FokI BseGI | | HindIII ||| RsaI | | Cac8I ||BspMII* | CviJI ||BetI* | AluI |Hpy178III* SetI |HpaII FalI FalI K K E K L A Y P E Y E K D R L C S T H H K K K S L H I R S T K R I D Y V P R I I K R K A C I S G V R K G * T M F H A S S ----:----|----:----|----:----|----:----|----:----|----:----| L F S F S A Y G S Y S F S L S H E V C * Y F L F A Q M D P T R F P Y V I N W A D F F F L K C I R L V F L I S * T G R M M TstI | HindIII | | AluI | | CviJI | | | MseI AcyI | | | SetI | HpaII SfaNI | | | | HphI TspEI | | HgaI \ \ \ \ \ \ \ \ \ \ CCTTTTACTATGGTGAAGCTTAAAGACTACGAAAAATTAGAAAAGACGCCGGAAAAGTGC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAAATGATACCACTTCGAATTTCTGATGCTTTTTAATCTTTTCTGCGGCCTTTTCACG / / / / / // / / / / | TstI | | | |HphI TspEI | HpaII HgaI SfaNI | | | MseI AcyI | | HindIII | CviJI | AluI SetI P F T M V K L K D Y E K L E K T P E K C L L L W * S L K T T K N * K R R R K S A F Y Y G E A * R L R K I R K D A G K V L ----:----|----:----|----:----|----:----|----:----|----:----| G K V I T F S L S * S F N S F V G S F H D K * * P S A * L S R F I L F S A P F T R K S H H L K F V V F F * F L R R F L A MseI |HpaI |HindII |Hpy166II ApoI ||MnlI TspEI SetI ||| Tsp4CI* CviJI EcoRI \ \\\ \ \ \ TTGGGTCGGCATTATGACCTCGTAGTTAACGGTGTGGAACTTGGTGGTGGCTCAACAAGA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCAGCCGTAATACTGGAGCATCAATTGCCACACCTTGAACCACCACCGAGTTGTTCT / // / / SetI || Tsp4CI* CviJI |MseI Hpy166II HindII MnlI HpaI L G R H Y D L V V N G V E L G G G S T R W V G I M T S * L T V W N L V V A Q Q E G S A L * P R S * R C G T W W W L N K N ----:----|----:----|----:----|----:----|----:----|----:----| K P R C * S R T T L P T S S P P P E V L S P D A N H G R L * R H P V Q H H S L L Q T P M I V E Y N V T H F K T T A * C S BinI* | Hpy178III* | | MboI CviRI* | | | DpnI TaqI | NdeI | | | |BstKTI AsuII EcoRV MboII MnlI | EcoT22I \ \ \ \\ \ \ \ \ \ \ ATTCACGATCCAAGATTACAAGACTATATTTTCGAAGATATCCTCAAAATAGATAATGCA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTGCTAGGTTCTAATGTTCTGATATAAAAGCTTCTATAGGAGTTTTATCTATTACGT // /// / / / / / / / || ||| MboI | EcoRV MboII MnlI | CviRI* || ||DpnI AsuII EcoT22I || |BstKTI TaqI || Hpy178III* |EcoRI |TspEI |ApoI BinI* I H D P R L Q D Y I F E D I L K I D N A F T I Q D Y K T I F S K I S S K * I M H S R S K I T R L Y F R R Y P Q N R * C I ----:----|----:----|----:----|----:----|----:----|----:----| I * S G L N C S * I K S S I R L I S L A F E R D L I V L S Y K R L Y G * F L Y H N V I W S * L V I N E F I D E F Y I I C CfrI | BalI | CviJI | HaeIII PflMI | | TspDTI BsmI AciI BsiYI* \ \ \ \ \ \ TATGAACTATTTGGCCATTTACTGAATGCTTTTGATATGGGAACACCGCCACACGCTGGA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTTGATAAACCGGTAAATGACTTACGAAAACTATACCCTTGTGGCGGTGTGCGACCT / /// / / / / NdeI ||CfrI BsmI | | MwoI |TspDTI | BsiYI* HaeIII | PflMI CviJI AciI BalI Y E L F G H L L N A F D M G T P P H A G M N Y L A I Y * M L L I W E H R H T L D * T I W P F T E C F * Y G N T A T R W I ----:----|----:----|----:----|----:----|----:----|----:----| Y S S N P W K S F A K S I P V G G C A P M H V I Q G N V S H K Q Y P F V A V R Q I F * K A M * Q I S K I H S C R W V S S Hin6I |GlaI ||HhaI ||| MboI ||| | DpnI MboI ||| | |BseMII | DpnI ||| | |BstKTI MwoI | |BstKTI ||| | ||BspCNI DdeI MaeII \ \ \\ \\\ \ \\\ \ \ TTTGCTATTGGTTTTGATCGTATGTGCGCTATGATCTGTGAAACTGAGAGTATAAGGGAC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGATAACCAAAACTAGCATACACGCGATACTAGACACTTTGACTCTCATATTCCCTG // / /// // / / / || MboI ||| || MboI DdeI TaiI |DpnI ||| |BspCNI SetI BstKTI ||| |DpnI ||| BstKTI ||| BseMII ||Hin6I |GlaI HhaI F A I G F D R M C A M I C E T E S I R D L L L V L I V C A L * S V K L R V * G T C Y W F * S Y V R Y D L * N * E Y K G R ----:----|----:----|----:----|----:----|----:----|----:----| N A I P K S R I H A I I Q S V S L I L S I Q * Q N Q D Y T R * S R H F Q S Y L P K S N T K I T H A S H D T F S L T Y P V Hin4II* | BssKI | |SecI* | |HpaII | ||ScrFI SetI | ||CauII* Hpy178III* PleI TaiI BslFI | ||| CviJI | HinfI |MlyI \ \ \ \\\ \ \ \ \\ GTAATCGCCTTCCCAAAAAGTATTACCGGGGCTGATTTGGTTGTCAAGAGTCCAAGTGTG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CATTAGCGGAAGGGTTTTTCATAATGGCCCCGACTAAACCAACAGTTCTCAGGTTCACAC / / / / // / / / MaeII | Hin4II* | |CviJI | HinfI PleI BslFI | BssKI | MlyI | SecI* Hpy178III* CauII* HpaII ScrFI V I A F P K S I T G A D L V V K S P S V * S P S Q K V L P G L I W L S R V Q V * N R L P K K Y Y R G * F G C Q E S K C D ----:----|----:----|----:----|----:----|----:----|----:----| T I A K G F L I V P A S K T T L L G L T R L R R G L F Y * R P Q N P Q * S D L H Y D G E W F T N G P S I Q N D L T W T H Hpy178III* BsmI | NlaIV SetI XmnI | | SetI TspEI \ \ \ \ \ \ ATACCTGAAAGCATTCTGGAACCTTACAATATCAAGTATAGTAATTCAAAAAAATGA 1930 1940 1950 1960 1970 ----:----|----:----|----:----|----:----|----:----|----:-- TATGGACTTTCGTAAGACCTTGGAATGTTATAGTTCATATCATTAAGTTTTTTTACT / / / / / / SetI | XmnI | NlaIV TspEI BsmI | SetI Hpy178III* I P E S I L E P Y N I K Y S N S K K * Y L K A F W N L T I S S I V I Q K N X T * K H S G T L Q Y Q V * * F K K M X ----:----|----:----|----:----|----:----|----:----|----:-- I G S L M R S G * L I L Y L L E F F H S V Q F C E P V K C Y * T Y Y N L F I Y R F A N Q F R V I D L I T I * F F S # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 4 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 3 DraI AluI 5 AluBI AlwNI 1 CaiI ApoI 7 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BaeI 1 BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 1 BseXI,BstV1I,Lsp1109I BccI 5 BceAI 2 BcgI 1 BdaI 4 BetI* 1 BsaWI BinI* 2 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 3 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 3 BspHI 1 CciI,PagI,RcaI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 1 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 6 Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 2 AcoI,EaeI Csp6I 6 CviQI,RsaNI CviAII 6 CviJI 22 CviKI-1 CviRI* 8 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 6 MalI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 1 EcoRI 1 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 2 Mph1103I,NsiI,Zsp2I FalI 4 FatI 6 FokI 4 GlaI 4 HaeII 1 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 4 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 4 HpyAV Hin6I 4 HinP1I,HspAI HindII 2 HincII HindIII 2 HinfI 3 HpaI 1 KspAI HpaII 3 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 10 Hpy188III Hpy188I 6 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 2 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 10 MfeI 4 MunI MlyI 2 SchI MmeI 1 MnlI 13 MseI 11 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NdeI 2 FauNDI NlaIII 6 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I PasI 1 PflMI 1 BasI,AccB7I,Van91I PleI 2 PpsI PsiI 1 AanI RsaI 6 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 20 SfaNI 2 LweI SspI 1 TaiI 2 TaqI 4 TatI 2 TauI 1 TfiI 1 PfeI TseI 1 ApeKI TsoI 2 Tsp45I 2 NmuCI Tsp4CI* 11 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 23 TasI,Tsp509I,Sse9I TspGWI 1 TstI 2 XbaI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AflII AflIII AgeI AjuI AlfI AloI ApaI ApaLI AscI Asp718I AvaI AvaII AvrII BamHI BarI BbvCI BbvII* Bce83I* BciVI BclI BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BsePI BseRI BseSI BseYI BsgI BsiI* Bsp120I Bsp1407I BspLU11I* BspMI BspOI BsrBI BsrDI BstAPI BstEII BstXI BtgZI BtrI BtsI Cfr10I Cfr9I ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoP15I EgeI EheI Esp3I EspI* FauI FnuDII* FseI FspAI GsaI GsuI HgiAI* HgiCI* Hpy99I KasI KpnI MauBI McrI* MluI MroNI MslI MstI* NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NspBII* NspI OliI PacI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaqII TspMI TspRI Tth111I VspI XcmI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769