Restriction Map of MNN9/YPL050C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

MNN9/YPL050C on chromosome XVI from coordinates 461966 to 460779.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 Csp6I MseI |RsaI |HpaI MaeIII || AciI SecI* |HindII Tsp45I || | DdeI DsaI* |Hpy166II \ \\ \ \ \ \\ ATGTCACTTTCTCTTGTATCGTACCGCCTAAGAAAGAACCCGTGGGTTAACATTTTTCTA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTGAAAGAGAACATAGCATGGCGGATTCTTTCTTGGGCACCCAATTGTAAAAAGAT / // / / / // / Tsp45I || AciI DdeI | |MseI SetI MaeIII |Csp6I | Hpy166II RsaI | HindII | HpaI DsaI* SecI* M S L S L V S Y R L R K N P W V N I F L C H F L L Y R T A * E R T R G L T F F Y V T F S C I V P P K K E P V G * H F S T ----:----|----:----|----:----|----:----|----:----|----:----| X D S E R T D Y R R L F F G H T L M K R X T V K E Q I T G G L F S G T P * C K E H * K R K Y R V A * S L V R P N V N K * CfrI Hpy178III* | BalI | MboI | CviJI | | DpnI SetI | HaeIII TspEI | | |BstKTI \ \ \ \ \ \ \\ CCTGTTTTGGCCATATTTCTAATATATATAATTTTTTTCCAGAGAGATCAATCTCTGTTG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GGACAAAACCGGTATAAAGATTATATATATTAAAAAAAGGTCTCTCTAGTTAGAGACAAC / / / / // / | CfrI TspEI | || MboI HaeIII | |DpnI CviJI | BstKTI BalI Hpy178III* P V L A I F L I Y I I F F Q R D Q S L L L F W P Y F * Y I * F F S R E I N L C W C F G H I S N I Y N F F P E R S I S V G ----:----|----:----|----:----|----:----|----:----|----:----| G T K A M N R I Y I I K K W L S * D R N V Q K P W I E L I Y L K K G S L D I E T R N Q G Y K * Y I Y N K E L S I L R Q Q MseI | CfrI | | BalI | | CviJI | | HaeIII | | |BsrI SduI | | || BslFI BseSI \ \ \\ \ \ GGACTTAATGGCCAGTCCATTTCCCAACACAAATGGGCACACGAAAAGGAAAACACATTT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCTGAATTACCGGTCAGGTAAAGGGTTGTGTTTACCCGTGTGCTTTTCCTTTTGTGTAAA / // / / / | || CfrI BslFI BseSI | |HaeIII SduI | |CviJI | |BalI | BsrI MseI G L N G Q S I S Q H K W A H E K E N T F D L M A S P F P N T N G H T K R K T H F T * W P V H F P T Q M G T R K G K H I L ----:----|----:----|----:----|----:----|----:----|----:----| P S L P W D M E W C L H A C S F S F V N P V * H G T W K G V C I P V R F P F C M S K I A L G N G L V F P C V F L F V C K AciI TatI |BisI |Csp6I ||BlsI ||RsaI |||TauI HphI Hin4II* ||ScaI PsiI |||CviJI \ \ \\\ \ \\\\ TATTTTCCCTTCACCAAGAAATACAAAATGCCAAAGTACTCTTATAAGAAAAAAAGCGGC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAAAGGGAAGTGGTTCTTTATGTTTTACGGTTTCATGAGAATATTCTTTTTTTCGCCG / / /// / //// HphI Hin4II* ||TatI PsiI |||CviJI |Csp6I ||BisI ScaI ||AciI RsaI |BlsI TauI Y F P F T K K Y K M P K Y S Y K K K S G I F P S P R N T K C Q S T L I R K K A A F S L H Q E I Q N A K V L L * E K K R L ----:----|----:----|----:----|----:----|----:----|----:----| * K G K V L F Y L I G F Y E * L F F L P K N E R * W S I C F A L T S K Y S F F R I K G E G L F V F H W L V R I L F F A A MboI | DpnI | |BstKTI | || MaeII | || |PmaCI | || |BsaAI | || || SetI Hin4II* | || || TaiI | MboII SetI CviRI* \ \\ \\ \ \ \ \ \ TGGTTGTTCAACGATCACGTGGAAGATATTATCCCAGAAGGTCATATTGCACATTATGAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| ACCAACAAGTTGCTAGTGCACCTTCTATAATAGGGTCTTCCAGTATAACGTGTAATACTA // / // / / / / || | |MaeII | | SetI CviRI* || | BsaAI | MboII || | PmaCI Hin4II* || MboI || TaiI || SetI |DpnI BstKTI W L F N D H V E D I I P E G H I A H Y D G C S T I T W K I L S Q K V I L H I M I V V Q R S R G R Y Y P R R S Y C T L * F ----:----|----:----|----:----|----:----|----:----|----:----| Q N N L S * T S S I I G S P * I A C * S S T T * R D R P L Y * G L L D Y Q V N H P Q E V I V H F I N D W F T M N C M I I MaeII | SetI | TaiI | | Hpy188I | | | TseI | | | |BisI | | | ||BlsI | | | |||AluI | | | |||CviJI | | | |||PvuII TspEI | | | |||NspBII* MlyI | CviRI* | | | |||| SetI BbvI Hin4I PleI HinfI \ \ \ \ \ \\\\ \ \ \ \ \ TTGAACAAATTGCACTCTACGTCAGAAGCAGCTGTCAATAAGGAGCATATTTTGATATTG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTGTTTAACGTGAGATGCAGTCTTCGTCGACAGTTATTCCTCGTATAAAACTATAAC // / / / /// / / // || | | | ||NspBII* | BbvI |PleI || | | | ||PvuII Hin4I MlyI || | | | ||CviJI || | | | ||TseI || | | | ||AluI || | | | |BisI || | | | BlsI || | | | SetI || | | Hpy188I || | MaeII || TaiI || SetI |CviRI* TspEI L N K L H S T S E A A V N K E H I L I L * T N C T L R Q K Q L S I R S I F * Y * E Q I A L Y V R S S C Q * G A Y F D I D ----:----|----:----|----:----|----:----|----:----|----:----| K F L N C E V D S A A T L L S C I K I N N S C I A S * T L L L Q * Y P A Y K S I Q V F Q V R R * F C S D I L L M N Q Y Q BsrI | TspEI | | BfiI | | | TseI | | | |BisI | | | |SfeI* | | | ||BlsI | | | |||TseI | | | |||CviRI* | | | ||||BisI | | | ||||BslFI | | | |||||BlsI | | | |||||PstI | | | ||||||AluI BbvI | | | ||||||CviJI |SecI* TspDTI | | | ||||||| SetI ||AvaI | CviRI* Hin4I BbvI | | | ||||||| |TspEI |||BmeT110I \ \ \ \ \ \ \ \\\\\\\ \\ \\\\ ACTCCAATGCAAACATTTCATCAACAATACTGGGACAATTTGCTGCAGCTAAATTACCCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGGTTACGTTTGTAAAGTAGTTGTTATGACCCTGTTAAACGACGTCGATTTAATGGGA / / / / // / / ////// / / | | | Hin4I |BbvI | | |||||| | TspEI | | CviRI* BsrI | | |||||| BslFI | TspDTI | | |||||CviJI HinfI | | |||||TseI | | |||||AluI | | ||||SfeI* | | ||||BisI | | |||BlsI | | |||SetI | | ||CviRI* | | ||TseI | | |BisI | | BlsI | | PstI | TspEI BfiI T P M Q T F H Q Q Y W D N L L Q L N Y P L Q C K H F I N N T G T I C C S * I T L S N A N I S S T I L G Q F A A A K L P S ----:----|----:----|----:----|----:----|----:----|----:----| V G I C V N * * C Y Q S L K S C S F * G S E L A F M E D V I S P C N A A A L N G S W H L C K M L L V P V I Q Q L * I V R CviJI | AlwNI Hpy178III* | | MaeIII | TspEI | | Tsp45I CviJI | | MnlI | | | BsrI HaeIII | | | TspDTI | | | XcmI | MseI | | | |TspEI | | | TspRI | HphI \ \ \ \\ \ \ \ \ \ \ CGGGAATTGATTGAATTGGGGTTCATTACACCAAGAACAGCCACTGGTGACTTGGCCTTA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GCCCTTAACTAACTTAACCCCAAGTAATGTGGTTCTTGTCGGTGACCACTGAACCGGAAT /// // / / // // / / / / ||| || TspDTI TspEI |AlwNI || | | | MseI ||| |TspEI |CviJI || | | HphI ||| MnlI TspRI || | HaeIII ||Hpy178III* || | CviJI ||AvaI || Tsp45I |BmeT110I || MaeIII |SecI* |XcmI BbvI BsrI R E L I E L G F I T P R T A T G D L A L G N * L N W G S L H Q E Q P L V T W P * G I D * I G V H Y T K N S H W * L G L K ----:----|----:----|----:----|----:----|----:----|----:----| R S N I S N P N M V G L V A V P S K A K E P I S Q I P T * * V L F L W Q H S P R P F Q N F Q P E N C W S C G S T V Q G * BsmI TspEI | MseI SetI TspGWI \ \ \ \ \ AAGAAATTGGAGAATGCTATTAAAAAGGTTCAAACGGACAAGAAAACTCAAAGATTTAGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTAACCTCTTACGATAATTTTTCCAAGTTTGCCTGTTCTTTTGAGTTTCTAAATCA / / / / / TspEI BsmI | SetI TspGWI MseI K K L E N A I K K V Q T D K K T Q R F S R N W R M L L K R F K R T R K L K D L V E I G E C Y * K G S N G Q E N S K I * * ----:----|----:----|----:----|----:----|----:----|----:----| F F N S F A I L F T * V S L F V * L N L L S I P S H * * F P E F P C S F E F I * L F Q L I S N F L N L R V L F S L S K T ApoI Hin4II* TspEI | FalI TspEI EcoRI BccI | FalI \ \ \ \ \ AAAATTACTATTTTGCGACAGAATTCCCAGAGTTTTGATAAGTTGATGGAGAAGGAAAGA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAATGATAAAACGCTGTCTTAAGGGTCTCAAAACTATTCAACTACCTCTTCCTTTCT / / / // TspEI EcoRI | |Hin4II* TspEI | FalI ApoI | FalI BccI K I T I L R Q N S Q S F D K L M E K E R K L L F C D R I P R V L I S * W R R K D N Y Y F A T E F P E F * * V D G E G K T ----:----|----:----|----:----|----:----|----:----|----:----| L I V I K R C F E W L K S L N I S F S L Y F * * K A V S N G S N Q Y T S P S P F F N S N Q S L I G L T K I L Q H L L F S MaeII |BtrI || SetI || TaiI || |TseI || |CviRI* || ||BisI || |||BlsI || |||| MwoI || |||| | CviJI || |||| | |BsrDI || |||| | || BbvI || |||| | || | BsePI || |||| | || | Hin6I || |||| | || | |GlaI || |||| | || | ||HhaI || |||| | || | ||Hin6I || |||| | || | ||Cac8I || |||| | || | ||FnuDII* || |||| | || | |||GlaI FalI || |||| | || | ||||HhaI TspEI FalI || |||| | || | ||||BsgI | BsrDI \ \\ \\\\ \ \\ \ \\\\\ \ \ CACGCTTTAGATGTTCAAAAGGAAAGACGTGCAGCAATGGCTTTGGCGCGCAATGAATTA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GTGCGAAATCTACAAGTTTTCCTTTCTGCACGTCGTTACCGAAACCGCGCGTTACTTAAT / / // //// // ///// / / FalI | || |||MwoI |CviJI ||||| | TspEI FalI | || |||TseI BsrDI ||||| BsrDI | || ||BisI ||||BsePI | || |BlsI ||||Hin6I | || CviRI* |||GlaI | |MaeII ||FnuDII* | BtrI ||Hin6I TaiI ||Cac8I SetI ||BsgI ||HhaI |BbvI |GlaI HhaI H A L D V Q K E R R A A M A L A R N E L T L * M F K R K D V Q Q W L W R A M N Y R F R C S K G K T C S N G F G A Q * I T ----:----|----:----|----:----|----:----|----:----|----:----| C A K S T * F S L R A A I A K A R L S N V R K L H E F P F V H L L P K P A C H I V S * I N L L F S T C C H S Q R A I F * AsuI* AvaII DraII PpuMI |BmgT120I || SetI MnlI CviJI TspDTI || TaqII |TsoI SfaNI |MaeI BsmAI \ \\ \ \\ \ \\ \ CTATTCTCCACCATAGGACCTCACACTTCTTGGGTGCTGTGGCTAGATGCCGATATTATA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GATAAGAGGTGGTATCCTGGAGTGTGAAGAACCCACGACACCGATCTACGGCTATAATAT / /// / / / / / TspDTI ||PpuMI MnlI | | MaeI BsmAI ||DraII TsoI | CviJI ||AvaII SfaNI ||AsuI* ||TaqII |BmgT120I SetI L F S T I G P H T S W V L W L D A D I I Y S P P * D L T L L G C C G * M P I L * I L H H R T S H F L G A V A R C R Y Y R ----:----|----:----|----:----|----:----|----:----|----:----| S N E V M P G * V E Q T S H S S A S I I V I R W W L V E C K K P A T A L H R Y * * E G G Y S R V S R P H Q P * I G I N Y BbvI | AluI | CviJI | | SetI | | | DdeI | | | |MwoI MseI | | | || TseI |TspEI | | | || AluI ||BccI | | | || CviJI ||| Hpy178III* | | | || |BisI ||| | FatI | | | || ||BlsI ||| | |CviAII | | | || ||SetI ||| | || NlaIII | | | || |||CviRI* \\\ \ \\ \ \ \ \ \\ \\\\ GAGACACCACCATCTTTAATTCAAGACATGACCAAACACAACAAAGCTATCTTAGCTGCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTGTGGTGGTAGAAATTAAGTTCTGTACTGGTTTGTGTTGTTTCGATAGAATCGACGT // / / / // / / / ////// || | | | |FatI | | | |||||CviRI* || | | | CviAII | | | |||||TseI || | | NlaIII | | | ||||BisI || | Hpy178III* | | | |||BlsI || TspEI | | | ||CviJI |BccI | | | ||AluI MseI | | | |DdeI | | | SetI | | MwoI | CviJI | AluI | BbvI SetI E T P P S L I Q D M T K H N K A I L A A R H H H L * F K T * P N T T K L S * L Q D T T I F N S R H D Q T Q Q S Y L S C K ----:----|----:----|----:----|----:----|----:----|----:----| S V G G D K I * S M V L C L L A I K A A L S V V M K L E L C S W V C C L * R L Q L C W W R * N L V H G F V V F S D * S C MboII |TspDTI BccI Ksp632I* || MboII |Hpy188I \ \\ \ \\ AACATTTATCAAAGATTTTACGATGAAGAGAAGAAGCAACCATCAATCAGACCATACGAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTAAATAGTTTCTAAAATGCTACTTCTCTTCTTCGTTGGTAGTTAGTCTGGTATGCTA / / / // Ksp632I* | MboII |BccI TspDTI Hpy188I MboII N I Y Q R F Y D E E K K Q P S I R P Y D T F I K D F T M K R R S N H Q S D H T I H L S K I L R * R E E A T I N Q T I R F ----:----|----:----|----:----|----:----|----:----|----:----| F M * * L N * S S S F F C G D I L G Y S L C K D F I K R H L S S A V M L * V M R V N I L S K V I F L L L L W * D S W V I MaeIII TaqII Tsp45I CviJI | AgeI | BccI | BetI* | | DdeI | Cfr10I | | | Hpy188I BspCNI BsrI | |HpaII | | | | MnlI |BseMII \ \ \\ \ \ \ \ \ \\ TTCAACAACTGGCAAGAAAGTGACACCGGTTTAGAAATAGCCTCTCAGATGGGTGATGAC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTGTTGACCGTTCTTTCACTGTGGCCAAATCTTTATCGGAGAGTCTACCCACTACTG / / // / / / // / // / BsrI | |Cfr10I | | | || MnlI || BcgI | |BetI* | | | |DdeI |BseMII | |AgeI | | | Hpy188I BspCNI | HpaII | | BccI Tsp45I | CviJI MaeIII TaqII F N N W Q E S D T G L E I A S Q M G D D S T T G K K V T P V * K * P L R W V M T Q Q L A R K * H R F R N S L S D G * * R ----:----|----:----|----:----|----:----|----:----|----:----| K L L Q C S L S V P K S I A E * I P S S N * C S A L F H C R N L F L R E S P H H E V V P L F T V G T * F Y G R L H T I V BcgI | BsiYI* CviRI* | | CviJI BcgI | TspEI | | HaeIII | HphI | | MwoI | | | MseI CviJI | | MnlI TaqI | | BstAPI | | | VspI | SfaNI \ \ \ \ \ \ \ \ \ \ \ \ \ GAGATTATTGTCGAGGGTTATGCAGAAATTGCCACTTATAGGCCATTAATGGCTCATTTC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTAATAACAGCTCCCAATACGTCTTTAACGGTGAATATCCGGTAATTACCGAGTAAAG / / / / / / / / / / / / | MnlI TaqI | | | | BsiYI* | | CviJI SfaNI HphI | | | BcgI | VspI | | TspEI | MseI | BstAPI HaeIII | MwoI CviJI CviRI* E I I V E G Y A E I A T Y R P L M A H F R L L S R V M Q K L P L I G H * W L I S D Y C R G L C R N C H L * A I N G S F L ----:----|----:----|----:----|----:----|----:----|----:----| S I I T S P * A S I A V * L G N I A * K R S * Q R P N H L F Q W K Y A M L P E N L N N D L T I C F N G S I P W * H S M E Csp6I |RsaI ||BssKI ||SexAI BccI ||EcoRII HphI ||| ScrFI Hin6I FokI ||| BseBI |GlaI | CviJI ||| Ksp632I* ||HhaI | | TatI ||| | BccI |||HaeII BseGI | | |Csp6I ||| | SetI |||MboII |MnlI | | ||RsaI \\\ \ \ \\\\ \\ \ \ \\\ TACGATGCTAATGGCGTACCAGGTGAAGAGATGGCGCTGGATGGTGTTGGTGGAGGCTGT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTACGATTACCGCATGGTCCACTTCTCTACCGCGACCTACCACAACCACCTCCGACA // // / / //// / / / / || || | BccI |||MboII | MnlI | RsaI || || Ksp632I* |||Hin6I BseGI CviJI || || EcoRII ||GlaI FokI || || SexAI ||BccI || || BssKI |HhaI || |BseBI HaeII || |ScrFI HphI || SetI |Csp6I RsaI Y D A N G V P G E E M A L D G V G G G C T M L M A Y Q V K R W R W M V L V E A V R C * W R T R * R D G A G W C W W R L Y ----:----|----:----|----:----|----:----|----:----|----:----| * S A L P T G P S S I A S S P T P P P Q R R H * H R V L H L S P A P H H Q H L S V I S I A Y W T F L H R Q I T N T S A T HgiCI* Tsp4CI* | NlaIV | | FatI Esp3I | | |CviAII BsmAI | | || NlaIII |Hpy166II | | || | TspEI \\ \ \ \\ \ \ ACTTTGGTCAAAGCAGAAGTTCACAGAGACGGTGCCATGTTCCCTAATTTCCCATTTTAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAACCAGTTTCGTCTTCAAGTGTCTCTGCCACGGTACAAGGGATTAAAGGGTAAAATA // / / / / / // / |TatI | BsmAI | | | |FatI TspEI Csp6I | Esp3I | | | CviAII Hpy166II | | HgiCI* | | NlaIII | NlaIV Tsp4CI* T L V K A E V H R D G A M F P N F P F Y L W S K Q K F T E T V P C S L I S H F I F G Q S R S S Q R R C H V P * F P I L S ----:----|----:----|----:----|----:----|----:----|----:----| V K T L A S T * L S P A M N G L K G N * Y K P * L L L E C L R H W T G * N G M K S Q D F C F N V S V T G H E R I E W K I SetI | BccI MwoI Hin4II* | | DdeI Ksp632I* MseI MboII \ \ \ \ \ \ \ CACTTGATTGAAACAGAAGGTTTTGCTAAGATGGCGAAGAGATTAAACTACGATGTATTT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GTGAACTAACTTTGTCTTCCAAAACGATTCTACCGCTTCTCTAATTTGATGCTACATAAA / / / // / / / Hin4II* SetI | |DdeI Ksp632I* | MboII | MwoI MseI BccI H L I E T E G F A K M A K R L N Y D V F T * L K Q K V L L R W R R D * T T M Y L L D * N R R F C * D G E E I K L R C I W ----:----|----:----|----:----|----:----|----:----|----:----| * K I S V S P K A L I A F L N F * S T N D S S Q F L L N Q * S P S S I L S R H I V Q N F C F T K S L H R L S * V V I Y K CviJI MnlI Ksp632I* MboII \ \ \ \ GGCTTACCAAACTATTTGGTTTATCACATAGAGGAAGAGAACCATTGA 1150 1160 1170 1180 ----:----|----:----|----:----|----:----|----:--- CCGAATGGTTTGATAAACCAAATAGTGTATCTCCTTCTCTTGGTAACT / / / / CviJI MnlI Ksp632I* MboII G L P N Y L V Y H I E E E N H * A Y Q T I W F I T * R K R T I X L T K L F G L S H R G R E P L X ----:----|----:----|----:----|----:----|----:--- P K G F * K T * * M S S S F W Q Q S V L S N P K D C L P L S G N A * W V I Q N I V Y L F L V M S # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AgeI 1 AsiGI,BshTI,CspAI,PinAI AluI 4 AluBI AlwNI 1 CaiI ApoI 1 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 2 MlsI,MluNI,MscI,Msp20I BbvI 5 BseXI,BstV1I,Lsp1109I BccI 7 BcgI 1 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BisI 6 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 6 BmeT110I 1 BmgT120I 1 BsaAI 1 BstBAI,Ppu21I BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 1 BsePI 1 BssHII,PauI BseSI 1 BaeGI,BstSLI BsgI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 1 BsrDI 2 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstAPI 1 BstKTI 2 BtrI 1 BmgBI,AjiI Cac8I 1 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI Csp6I 4 CviQI,RsaNI CviAII 2 CviJI 16 CviKI-1 CviRI* 7 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 2 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI Esp3I 1 BsmBI FalI 2 FatI 2 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 GlaI 3 HaeII 1 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 3 BstHHI,CfoI,AspLEI Hin4I 1 Hin4II* 4 HpyAV Hin6I 3 HinP1I,HspAI HindII 1 HincII HinfI 1 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 3 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 3 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 MlyI 1 SchI MnlI 6 MseI 7 Tru1I,Tru9I MwoI 4 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PleI 1 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PpuMI 1 Psp5II,PspPPI PsiI 1 AanI PstI 1 PvuII 1 RsaI 4 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 13 SexAI 1 MabI SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI TaiI 3 TaqI 1 TaqII 2 TatI 2 TauI 1 TseI 5 ApeKI TsoI 1 Tsp45I 3 NmuCI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 13 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI VspI 1 PshBI,AseI XcmI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AhaIII* AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvrII BaeI BamHI BarI BbvCI BbvII* Bce83I* BceAI BciVI BclI BdaI BglI BglII BinI* BmtI BplI Bpu10I BsaBI BsaXI BseRI BseYI BsiI* Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstEII BstXI BstZ17I BtgZI BtsI CauII* Cfr9I ClaI CspCI DinI DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRV EcoT22I EgeI EheI EspI* FauI FseI FspAI GsaI GsuI HgaI HgiAI* HgiJII* HindIII Hpy99I KasI KpnI MauBI McrI* MfeI MluI MmeI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PmeI PpiI PshAI PspOMI PspXI PsrI PvuI RsrII SacI SacII SalI SanDI SapI SauI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TfiI TspMI TstI Tth111I XbaI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769