Restriction Map of SSN3/YPL042C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SSN3/YPL042C on chromosome XVI from coordinates 474707 to 473040.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.27940

EMBOSS_001 BspMI | StuI | CviJI SduI Csp6I | HaeIII HgiAI* CviJI |RsaI | | CviRI* \ \ \\ \ \ \ ATGTATAATGGCAAGGATAGAGCACAAAACTCCTATCAGCCAATGTACCAAAGGCCTATG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACATATTACCGTTCCTATCTCGTGTTTTGAGGATAGTCGGTTACATGGTTTCCGGATAC / / // // / HgiAI* CviJI |Csp6I || CviRI* SduI RsaI |BspMI HaeIII CviJI StuI M Y N G K D R A Q N S Y Q P M Y Q R P M C I M A R I E H K T P I S Q C T K G L C V * W Q G * S T K L L S A N V P K A Y A ----:----|----:----|----:----|----:----|----:----|----:----| X Y L P L S L A C F E * * G I Y W L G I X T Y H C P Y L V F S R D A L T G F A * H I I A L I S C L V G I L W H V L P R H Cac8I Csp6I | AluI |RsaI | CviJI |SetI MmeI | | SetI Hpy188I \\ \ \ \ \ \ CAGGTACAAGGACAACAGCAAGCTCAATCGTTCGTTGGAAAGAAAAACACAATCGGAAGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCATGTTCCTGTTGTCGTTCGAGTTAGCAAGCAACCTTTCTTTTTGTGTTAGCCTTCA / // / / / / | |Csp6I MmeI | CviJI Hpy188I | RsaI | AluI SetI Cac8I SetI Q V Q G Q Q Q A Q S F V G K K N T I G S R Y K D N S K L N R S L E R K T Q S E V G T R T T A S S I V R W K E K H N R K C ----:----|----:----|----:----|----:----|----:----|----:----| C T C P C C C A * D N T P F F F V I P L A P V L V V A L E I T R Q F S F C L R F L Y L S L L L S L R E N S L F V C D S T FatI CviRI* |CviAII CfrI AsuI* || NlaIII | BalI AvaII || |SfaNI | CviJI |BmgT120I || || CviJI | HaeIII || SetI \\ \\ \ \ \ \\ \ GTGCATGGAAAAGCCCCGATGCTAATGGCCAATAATGATGTTTTTACTATTGGACCTTAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CACGTACCTTTTCGGGGCTACGATTACCGGTTATTACTACAAAAATGATAACCTGGAATA / // // / / /// | |FatI |CviJI | CfrI ||AvaII | | SfaNI HaeIII ||AsuI* | CviAII CviJI |BmgT120I CviRI* BalI SetI NlaIII V H G K A P M L M A N N D V F T I G P Y C M E K P R C * W P I M M F L L L D L I A W K S P D A N G Q * * C F Y Y W T L * ----:----|----:----|----:----|----:----|----:----|----:----| T C P F A G I S I A L L S T K V I P G * H A H F L G S A L P W Y H H K * * Q V K H M S F G R H * H G I I I N K S N S R I Csp6I CviJI AciI |RsaI | BsrDI FauI | BsmI DdeI ||TsoI BbvI | |FauI \ \ \ \ \\\ \ \ \\ AGGGCAAGAAAAGATAGAATGCGGGTATCTGTCTTAGAAAAGTACGAAGTTATTGGCTAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCGTTCTTTTCTATCTTACGCCCATAGACAGAATCTTTTCATGCTTCAATAACCGATG / / / / /// /// FauI | AciI DdeI ||Csp6I ||BsrDI BsmI |RsaI |CviJI TsoI BbvI R A R K D R M R V S V L E K Y E V I G Y G Q E K I E C G Y L S * K S T K L L A T G K K R * N A G I C L R K V R S Y W L H ----:----|----:----|----:----|----:----|----:----|----:----| L A L F S L I R T D T K S F Y S T I P * Y P L F L Y F A P I Q R L F T R L * Q S P C S F I S H P Y R D * F L V F N N A V BetI* TseI |HpaII |BisI || Acc65I ||BlsI || HgiCI* |||AciI || |Csp6I |||| Cac8I || ||RsaI |||| | SduI || ||NlaIV |||| | BseSI || ||| KpnI |||| | | NdeI Hpy166II BaeI || ||| |TspEI \\\\ \ \ \ \ \ \\ \\\ \\ ATTGCTGCGGGCACATATGGTAAAGTTTACAAAGCGAAAAGACAAATCAACTCCGGTACC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGACGCCCGTGTATACCATTTCAAATGTTTCGCTTTTCTGTTTAGTTGAGGCCATGG / /// / / / / ///// | ||| Cac8I NdeI | BaeI ||||HgiCI* | ||| BseSI Hpy166II ||||Acc65I | ||| SduI |||Csp6I | ||| AciI ||NlaIV | ||TseI ||RsaI | |BisI |BetI* | BlsI HpaII FauI KpnI I A A G T Y G K V Y K A K R Q I N S G T L L R A H M V K F T K R K D K S T P V P C C G H I W * S L Q S E K T N Q L R Y Q ----:----|----:----|----:----|----:----|----:----|----:----| M A A P V Y P L T * L A F L C I L E P V C Q Q P C M H Y L K C L S F V F * S R Y N S R A C I T F N V F R F S L D V G T G Hpy188I | Acc65I | HgiCI* | |Csp6I | ||RsaI ApoI | ||NlaIV TspEI AciI BaeI MaeI | ||| KpnI | AciI \ \ \ \ \\\ \ \ \ AATTCCGCTAATGGTTCTAGTCTGAATGGTACCAATGCGAAAATTCCGCAGTTTGACAGC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGGCGATTACCAAGATCAGACTTACCATGGTTACGCTTTTAAGGCGTCAAACTGTCG / / / / / /// / / | BaeI | | | ||HgiCI* | AciI | AciI | | | ||Acc65I TspEI TspEI | | | |Csp6I ApoI | | | NlaIV | | | RsaI | | KpnI | Hpy188I MaeI N S A N G S S L N G T N A K I P Q F D S I P L M V L V * M V P M R K F R S L T A F R * W F * S E W Y Q C E N S A V * Q H ----:----|----:----|----:----|----:----|----:----|----:----| L E A L P E L R F P V L A F I G C N S L W N R * H N * D S H Y W H S F E A T Q C I G S I T R T Q I T G I R F N R L K V A SapI Ksp632I* | FatI | |CviAII | || NspI AluI | || CviRI* CviJI | || NlaIII Cac8I MboII | SetI | || | Cac8I MseI \ \ \ \ \ \\ \ \ \ ACGCAACCAAAATCAAGCTCTTCAATGGACATGCAGGCAAATACAAACGCATTAAGAAGA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGCGTTGGTTTTAGTTCGAGAAGTTACCTGTACGTCCGTTTATGTTTGCGTAATTCTTCT / / / / / / // / / Cac8I | | CviJI | | || Cac8I MseI | | AluI | | |CviRI* | SetI | | |FatI MboII | | CviAII | NlaIII | NspI Ksp632I* SapI T Q P K S S S S M D M Q A N T N A L R R R N Q N Q A L Q W T C R Q I Q T H * E E A T K I K L F N G H A G K Y K R I K K K ----:----|----:----|----:----|----:----|----:----|----:----| V C G F D L E E I S M C A F V F A N L L C A V L I L S K L P C A P L Y L R M L F R L W F * A R * H V H L C I C V C * S S BseGI | MaeIII | Tsp45I | | FokI | | | BssKI | | | SecI* | | | | HpaII MseI | | | | ScrFI |MboII | | | | CauII* MnlI || Hin4II* | | | | TspDTI | MboII TstI \\ \ \ \ \ \ \ \ \ \ AACTTGTTAAAGGATGAAGGAGTGACCCCCGGAAGAATACGAACTACGAGGGAAGATGTA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAACAATTTCCTACTTCCTCACTGGGGGCCTTCTTATGCTTGATGCTCCCTTCTACAT / / / // //// / / / | | BseGI || |||BssKI | MboII TstI | Hin4II* || ||SecI* MnlI | MseI || ||HpaII MboII || |CauII* || |ScrFI || FokI |TspDTI Tsp45I MaeIII N L L K D E G V T P G R I R T T R E D V T C * R M K E * P P E E Y E L R G K M Y L V K G * R S D P R K N T N Y E G R C I ----:----|----:----|----:----|----:----|----:----|----:----| F K N F S S P T V G P L I R V V L S S T F S T L P H L L S G R F F V F * S P L H V Q * L I F S H G G S S Y S S R P F I Y AciI MboII MnlI | BciVI | AciI | | FauI | | NspBII* | | |TspEI TstI MseI | | | Tsp4CI* \ \ \\ \ \ \ \ \ \ TCCCCGCACTATAATTCCCAAAAACAAACCCTCATTAAAAAACCGCTGACGGTATTTTAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AGGGGCGTGATATTAAGGGTTTTTGTTTGGGAGTAATTTTTTGGCGACTGCCATAAAATA / / / / / / / / / / | | | | TspEI TstI | MnlI | Tsp4CI* | | | FauI MseI NspBII* | | BciVI AciI | AciI MboII S P H Y N S Q K Q T L I K K P L T V F Y P R T I I P K N K P S L K N R * R Y F M P A L * F P K T N P H * K T A D G I L C ----:----|----:----|----:----|----:----|----:----|----:----| D G C * L E W F C V R M L F G S V T N * I G A S Y N G F V F G * * F V A S P I K G R V I I G L F L G E N F F R Q R Y K I AcyI |BseGI || TaqI || | Hpy99I Hpy178III* || | | MfeI | Hin4II* || | | FokI | | HgaI || | | TspEI MseI | | |BccI || | | | CviRI* \ \ \ \\ \\ \ \ \ \ GCCATTAAAAAGTTCAAGACAGAGAAGGATGGCGTCGAACAATTGCATTATACGGGAATA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTAATTTTTCAAGTTCTGTCTCTTCCTACCGCAGCTTGTTAACGTAATATGCCCTTAT / / / / // / / // MseI | | HgaI || | TaqI |CviRI* | BccI || AcyI TspEI Hpy178III* |Hpy99I FokI Hin4II* BseGI MfeI A I K K F K T E K D G V E Q L H Y T G I P L K S S R Q R R M A S N N C I I R E Y H * K V Q D R E G W R R T I A L Y G N I ----:----|----:----|----:----|----:----|----:----|----:----| A M L F N L V S F S P T S C N C * V P I H W * F T * S L S P H R R V I A N Y P F G N F L E L C L L I A D F L Q M I R S Y DdeI TaqI | Hpy188I |Hpy178III* | | SfeI* || TspEI | | | BspCNI || | CviRI* | | | |BseMII || | | MwoI MseI \ \ \ \\ \\ \ \ \ \ TCTCAGAGTGCCTGTAGAGAAATGGCATTATGTCGAGAATTGCACAACAAGCATTTAACC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGTCTCACGGACATCTCTTTACCGTAATACAGCTCTTAACGTGTTGTTCGTAAATTGG // // / // // / / |DdeI || SfeI* || || MwoI MseI Hpy188I |BseMII || |CviRI* BspCNI || TspEI |Hpy178III* TaqI S Q S A C R E M A L C R E L H N K H L T L R V P V E K W H Y V E N C T T S I * P S E C L * R N G I M S R I A Q Q A F N H ----:----|----:----|----:----|----:----|----:----|----:----| D * L A Q L S I A N H R S N C L L C K V I E S H R Y L F P M I D L I A C C A N L R L T G T S F H C * T S F Q V V L M * G OliI MslI | BstXI | | ApoI AccI | | TspEI |BssNAI | | |TsoI NdeI |Hpy166II AciI FatI \ \ \\ \ \\ \ \ ACATTAGTGGAAATTTTTTTGGAAAGGAAATGTGTCCATATGGTATACGAATATGCGGAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAATCACCTTTAAAAAAACCTTTCCTTTACACAGGTATACCATATGCTTATACGCCTC / / / / / // / / | MslI TsoI TspEI NdeI |AccI | NlaIII | OliI ApoI Hpy166II AciI BstXI BssNAI T L V E I F L E R K C V H M V Y E Y A E H * W K F F W K G N V S I W Y T N M R S I S G N F F G K E M C P Y G I R I C G A ----:----|----:----|----:----|----:----|----:----|----:----| V N T S I K K S L F H T W I T Y S Y A S W M L P F K K P F S I H G Y P I R I H P C * H F N K Q F P F T D M H Y V F I R L CviAII | MboI | |NlaIII BseGI | ||DpnI | Hpy178III* | |||MwoI | | BccI | |||BstKTI TstI | | | BsiYI* TaqII | |||BstAPI |TspEI FokI | | | |TstI BseGI |FokI \ \\\\ \\ \ \ \ \ \\ \ \\ CATGATCTGCTACAAATTATCCACTTCCATTCCCATCCCGAAAAAAGGATGATACCACCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GTACTAGACGATGTTTAATAGGTGAAGGTAAGGGTAGGGCTTTTTTCCTACTATGGTGGT /// // / / / //// / / ||| |TstI TspEI FokI BseGI |||BccI BseGI TaqII ||| MboI ||BsiYI* ||DpnI |TstI |BstKTI Hpy178III* |FatI BstAPI CviAII MwoI H D L L Q I I H F H S H P E K R M I P P M I C Y K L S T S I P I P K K G * Y H Q * S A T N Y P L P F P S R K K D D T T K ----:----|----:----|----:----|----:----|----:----|----:----| C S R S C I I W K W E W G S F L I I G G A H D A V F * G S G N G D R F F S S V V M I Q * L N D V E M G M G F F P H Y W W TseI |BisI |Hin4I |Hin4I ||BlsI |||AluI |||CviJI |||| SetI |||| | BarI TspEI |||| | | BbvI Hin4I |||| | | | MboII TaqII Hin4I |||| | | | TspDTI BceAI |TspDTI \\\\ \ \ \ \ \ \\ AGAATGGTTCGGTCTATTATGTGGCAGCTTTTAGACGGCGTATCGTATCTTCATCAAAAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTACCAAGCCAGATAATACACCGTCGAAAATCTGCCGCATAGCATAGAAGTAGTTTTA / / /// /// / // / / FokI | ||CviJI ||BbvI | || | BarI | ||TseI |MboII | || TspDTI | ||AluI TspDTI | |BceAI | ||BarI | Hin4I | |BisI | Hin4I | BlsI TaqII | SetI Hin4I Hin4I R M V R S I M W Q L L D G V S Y L H Q N E W F G L L C G S F * T A Y R I F I K I N G S V Y Y V A A F R R R I V S S S K L ----:----|----:----|----:----|----:----|----:----|----:----| L I T R D I I H C S K S P T D Y R * * F L F P E T * * T A A K L R R I T D E D F S H N P R N H P L K * V A Y R I K M L I MaeIII Tsp45I TaqI BstEII BseGI BarI |Hpy178III* AciI FauI | BccI HphI |MseI \ \\ \ \ \ \ \ \\ TGGGTGCTTCATCGAGATTTGAAACCCGCAAATATAATGGTGACCATAGATGGATGTGTT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCACGAAGTAGCTCTAAACTTTGGGCGTTTATATTACCACTGGTATCTACCTACACAA / // / / / / / TspEI |Hpy178III* AciI FauI | HphI BseGI TaqI BstEII Tsp45I MaeIII BccI W V L H R D L K P A N I M V T I D G C V G C F I E I * N P Q I * W * P * M D V L G A S S R F E T R K Y N G D H R W M C * ----:----|----:----|----:----|----:----|----:----|----:----| Q T S * R S K F G A F I I T V M S P H T N P A E D L N S V R L Y L P S W L H I H P H K M S I Q F G C I Y H H G Y I S T N SetI |HphI ||CfrI ||| BalI ||| CviJI ||| TspDTI ||| HaeIII TseI ||| | ApoI |BisI TspEI ||| | TspEI ||BlsI | FokI ||| | |BbvI |||CviRI* \ \ \\\ \ \\ \\\\ AAAATTGGTGATTTAGGTTTGGCCAGAAAATTTCATAATATGCTGCAAACCCTCTATACT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAACCACTAAATCCAAACCGGTCTTTTAAAGTATTATACGACGTTTGGGAGATATGA / / / / / / / / // /// / MseI | FokI | | | | CfrI |BbvI ||CviRI* MnlI TspEI | | | HaeIII TspEI ||TseI | | | CviJI ApoI |BisI | | | BalI BlsI | | TspDTI | HphI SetI K I G D L G L A R K F H N M L Q T L Y T K L V I * V W P E N F I I C C K P S I L N W * F R F G Q K I S * Y A A N P L Y W ----:----|----:----|----:----|----:----|----:----|----:----| L I P S K P K A L F N * L I S C V R * V * F Q H N L N P W F I E Y Y A A F G R Y F N T I * T Q G S F K M I H Q L G E I S Acc65I HgiCI* |Csp6I ||RsaI ||NlaIV |||BseMII ||||KpnI ||||BspCNI |||||Tsp4CI* ||||||ApaLI ||||||| CviRI* ||||||| Hpy166II ||||||| | SduI ||||||| | BseSI ||||||| | HgiAI* MnlI MaeIII ||||||| | | DdeI SduI | BsrI BfiI Tsp45I ||||||| | | |SetI HgiAI* \ \ \ \ \\\\\\\ \ \ \\ \ GGGGATAAAGTGGTTGTCACTATATGGTACCGTGCACCTGAGTTGCTATTGGGAGCACGG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CCCCTATTTCACCAACAGTGATATACCATGGCACGTGGACTCAACGATAACCCTCGTGCC / / / ///// / /// / / BsrI BfiI | ||||| | ||| DdeI HgiAI* | ||||| | ||ApaLI SduI | ||||| | |SetI | ||||| | Hpy166II | ||||| | CviRI* | ||||| HgiAI* | ||||| BseSI | ||||| SduI | ||||Tsp4CI* | ||||HgiCI* | ||||Acc65I | |||Csp6I | ||BspCNI | ||NlaIV | ||RsaI | |BseMII | KpnI Tsp45I MaeIII G D K V V V T I W Y R A P E L L L G A R G I K W L S L Y G T V H L S C Y W E H G G * S G C H Y M V P C T * V A I G S T A ----:----|----:----|----:----|----:----|----:----|----:----| P S L T T T V I H Y R A G S N S N P A R Q P Y L P Q * * I T G H V Q T A I P L V P I F H N D S Y P V T C R L Q * Q S C P Hin4I Hin4I | AciI | BceAI | | TspGWI | | | BbvI | | | | AsuI* | | | | AvaII | | | | |BmgT120I | | | | || TseI | | | | || CviJI | | | | || |BisI | | | | || ||BlsI | | | | || |||CviRI* | | | | || |||| Hin4I | | | | || |||| Hin4I | | | | || |||| | CviRI* \ \ \ \ \\ \\\\ \ \ CACTATACCCCTGCGGTTGATTTATGGTCCGTTGGCTGCATTTTTGCAGAACTGATAGGA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GTGATATGGGGACGCCAACTAAATACCAGGCAACCGACGTAAAAACGTCTTGACTATCCT / // / // //// / Hin4I |TspGWI | |AvaII |||CviRI* CviRI* Hin4I BceAI | |AsuI* |||TseI AciI | | ||Hin4I | | ||Hin4I | | ||BisI | | |BlsI | | CviJI | BmgT120I BbvI H Y T P A V D L W S V G C I F A E L I G T I P L R L I Y G P L A A F L Q N * * D L Y P C G * F M V R W L H F C R T D R I ----:----|----:----|----:----|----:----|----:----|----:----| C * V G A T S K H D T P Q M K A S S I P A S Y G Q P Q N I T R Q S C K Q L V S L V I G R R N I * P G N A A N K C F Q Y S AluI CviJI | SetI | |MlyI | |PleI | |HphI MseI | || MaeI |AhaIII* | || MboII CviJI || SetI | || | HinfI Tsp4CI* \ \\ \ \ \\ \ \ \ TTACAGCCCATATTTAAAGGTGAAGAAGCTAAACTAGACTCTAAAAAGACTGTTCCATTT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTCGGGTATAAATTTCCACTTCTTCGATTTGATCTGAGATTTTTCTGACAAGGTAAA / /// / / //// / / / CviJI ||SetI | | |||| | HinfI Tsp4CI* |MseI | | |||| MaeI AhaIII* | | |||MboII | | ||PleI | | |MlyI | | HphI | CviJI | AluI SetI L Q P I F K G E E A K L D S K K T V P F Y S P Y L K V K K L N * T L K R L F H F T A H I * R * R S * T R L * K D C S I S ----:----|----:----|----:----|----:----|----:----|----:----| N C G M N L P S S A L S S E L F V T G N I V A W I * L H L L * V L S * F S Q E M * L G Y K F T F F S F * V R F L S N W K Hpy178III* | MboI | | DpnI | | |BstKTI TfiI ApoI | | || ApoI CviJI HinfI SfeI* TspEI | | || TspEI HaeIII \ \ \ \ \ \\ \ \ CAAGTGAATCAACTACAGAGAATTTTGGAAGTTCTTGGCACTCCCGATCAAAAAATTTGG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCACTTAGTTGATGTCTCTTAAAACCTTCAAGAACCGTGAGGGCTAGTTTTTTAAACC / / / /// / / / HinfI SfeI* TspEI ||| MboI | HaeIII TfiI ApoI ||DpnI | CviJI |BstKTI TspEI Hpy178III* ApoI Q V N Q L Q R I L E V L G T P D Q K I W K * I N Y R E F W K F L A L P I K K F G S E S T T E N F G S S W H S R S K N L A ----:----|----:----|----:----|----:----|----:----|----:----| * T F * S C L I K S T R P V G S * F I Q E L S D V V S F K P L E Q C E R D F F K L H I L * L S N Q F N K A S G I L F N P Hpy178III* | BciVI | |MboI | |BclI | || DpnI | || |BstKTI | || || TspEI \ \\ \\ \ CCTTATTTGGAGAAGTATCCAGAATATGATCAAATTACGAAGTTTCCAAAGTATAGGGAT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GGAATAAACCTCTTCATAGGTCTTATACTAGTTTAATGCTTCAAAGGTTTCATATCCCTA / / // / / | | || BclI TspEI | | || MboI | | |DpnI | | BstKTI | BciVI Hpy178III* P Y L E K Y P E Y D Q I T K F P K Y R D L I W R S I Q N M I K L R S F Q S I G I L F G E V S R I * S N Y E V S K V * G * ----:----|----:----|----:----|----:----|----:----|----:----| G * K S F Y G S Y S * I V F N G F Y L S A K N P S T D L I H D F * S T E L T Y P R I Q L L I W F I I L N R L K W L I P I FatI |CviAII FatI || NlaIII |CviAII || | FauI ||Cac8I || | | MnlI ||| SphI || | | |AciI ||| NspI || | | |SecI* ||| NlaIII || | | |DsaI* ||| | MseI || | | || AciI ||| | BslFI || | | || FnuDII* ||| | | HindIII || | | || NspBII* ||| | | | AluI || | | || |SacII ||| | | | CviJI SetI || | | || |Hin4II* ||| | | | | SetI \ \\ \ \ \\ \\ \\\ \ \ \ \ \ AACCTTGCTACATGGTATCATTCCGCGGGAGGAAGGGACAAGCATGCTTTAAGCTTACTT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGAACGATGTACCATAGTAAGGCGCCCTCCTTCCCTGTTCGTACGAAATTCGAATGAA / / // // // / / /// / / / SetI | |FatI || || DsaI* | ||FatI | | HindIII | CviAII || || SecI* | || | BslFI NlaIII || || AciI | || | CviJI || |NspBII* | || | AluI || |FnuDII* | || MseI || |Hin4II* | || SetI || |AciI | |CviAII || SacII | Cac8I |MnlI NlaIII FauI NspI SphI N L A T W Y H S A G G R D K H A L S L L T L L H G I I P R E E G T S M L * A Y F P C Y M V S F R G R K G Q A C F K L T L ----:----|----:----|----:----|----:----|----:----|----:----| L R A V H Y * E A P P L S L C A K L K S Y G Q * M T D N R P L F P C A H K L S V V K S C P I M G R S S P V L M S * A * K MseI | TspEI | |BinI* | || MboI | || | DpnI | || | |BstKTI CviRI* | || | || TspEI | EcoT22I | || | || | MseI | | MseI | || | || | |SfaNI | | | MwoI | || | || | || MmeI | | | BstAPI \ \\ \ \\ \ \\ \ \ \ \ \ TACCACTTGTTAAATTATGATCCAATTAAAAGAATAGATGCATTTAATGCGTTGGAACAT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGTGAACAATTTAATACTAGGTTAATTTTCTTATCTACGTAAATTACGCAACCTTGTA / / / // / // // / / / / | | | || MboI || |SfaNI | | | MseI | | | |DpnI || MmeI | | BstAPI | | | BstKTI |MseI | | MwoI | | TspEI TspEI | CviRI* | BinI* EcoT22I MseI Y H L L N Y D P I K R I D A F N A L E H T T C * I M I Q L K E * M H L M R W N I P L V K L * S N * K N R C I * C V G T * ----:----|----:----|----:----|----:----|----:----|----:----| * W K N F * S G I L L I S A N L A N S C K G S T L N H D L * F F L H M * H T P V V V Q * I I I W N F S Y I C K I R Q F M TatI |Csp6I ||RsaI ||ScaI Hin4II* SetI \\\ \ \ AAGTACTTCACAGAAAGTGATATTCCTGTTAGTGAAAATGTATTTGAAGGTCTAACTTAC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTCATGAAGTGTCTTTCACTATAAGGACAATCACTTTTACATAAACTTCCAGATTGAATG /// / / ||TatI Hin4II* SetI |Csp6I ScaI RsaI K Y F T E S D I P V S E N V F E G L T Y S T S Q K V I F L L V K M Y L K V * L T V L H R K * Y S C * * K C I * R S N L Q ----:----|----:----|----:----|----:----|----:----|----:----| L Y K V S L S I G T L S F T N S P R V * Y T S * L F H Y E Q * H F H I Q L D L K L V E C F T I N R N T F I Y K F T * S V FatI BspHI |CviAII |Hpy178III* || MboI || | DpnI BssKI || | |BstKTI | HpaII ApoI || TfiI | ||Hpy178III* | ScrFI TspEI || HinfI | ||| TspDTI | CauII* EcoRI MboII || NlaIII | ||| | BinI* \ \ \ \ \\ \ \ \\\ \ \ AAATACCCGGCAAGAAGAATTCACACGAACGATAATGACATCATGAATCTTGGATCAAGA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTTATGGGCCGTTCTTCTTAAGTGTGCTTGCTATTACTGTAGTACTTAGAACCTAGTTCT /// / / / // / // / / ||BssKI | MboII | || | || | Hpy178III* |HpaII EcoRI | || | || TspDTI CauII* TspEI | || | || MboI ScrFI ApoI | || | |DpnI | || | BstKTI | || HinfI | || TfiI | |BspHI | |FatI | Hpy178III* | CviAII NlaIII K Y P A R R I H T N D N D I M N L G S R N T R Q E E F T R T I M T S * I L D Q E I P G K K N S H E R * * H H E S W I K N ----:----|----:----|----:----|----:----|----:----|----:----| L Y G A L L I * V F S L S M M F R P D L C I G P L F F E C S R Y H C * S D Q I L F V R C S S N V R V I I V D H I K S * S HgiCI* | SetI HindIII | NlaIV | AluI | |MwoI | CviJI | ||AciI | | HphI | ||BisI | | SetI | |||BlsI | | | Hpy178III* | ||||TseI | | | | AarI | ||||TauI | | | | BspMI | ||||NspBII* | | | | |TfiI | |||||BisI | | | | |HinfI | ||||||BlsI Eco57I | | | | || BbvI | |||||||CviRI* Eco57MI | | | | || | AciI | |||||||| MwoI SetI \ \ \ \ \ \\ \ \ \ \\\\\\\\ \ \ ACGAAAAACAATACACAAGCTTCAGGAATCACCGCAGGTGCCGCTGCAAATGCGTTAGGT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTTTTTGTTATGTGTTCGAAGTCCTTAGTGGCGTCCACGGCGACGTTTACGCAATCCA / / / /// / / // / //////// / | Eco57MI | ||| | | || | |||||||CviRI* SetI | Eco57I | ||| | | || | |||||||MwoI BinI* | ||| | | || | |||||||TseI | ||| | | || | ||||||BisI | ||| | | || | |||||BlsI | ||| | | || | ||||NspBII* | ||| | | || | ||||AciI | ||| | | || | |||BisI | ||| | | || | ||HgiCI* | ||| | | || | ||BlsI | ||| | | || | |TauI | ||| | | || | NlaIV | ||| | | || MwoI | ||| | | |SetI | ||| | | AciI | ||| | | BbvI | ||| | HinfI | ||| | BspMI | ||| | TfiI | ||| | AarI | ||| Hpy178III* | ||HindIII | |HphI | CviJI | AluI SetI T K N N T Q A S G I T A G A A A N A L G R K T I H K L Q E S P Q V P L Q M R * V E K Q Y T S F R N H R R C R C K C V R W ----:----|----:----|----:----|----:----|----:----|----:----| V F F L V C A E P I V A P A A A F A N P F S F C Y V L K L F * R L H R Q L H T L R F V I C L S * S D G C T G S C I R * T MseI |HpaI |HindII |Hpy166II || Tsp4CI* || | EcoP15I || | | CfrI || | | | CviJI || | | | HaeIII || | | | |AciI || | | | |BisI || | | | |SecI* || | | | |DsaI* || | | | ||BlsI || | | | |||AciI || | | | |||TauI || | | | |||FnuDII* || | | | |||NspBII* || | | | ||||BisI || | | | ||||SacII || | | | |||||BbvI || | | | |||||BlsI || | | | ||||||TseI || | | | ||||||TauI || | | | ||||||MwoI || | | | |||||||BisI || | | | ||||||||BbvI || | | | ||||||||BlsI || | | | |||||||||TseI || | | | |||||||||MwoI || | | | ||||||||||BisI || | | | |||||||||||BlsI || | | | ||||||||||||TseI || | | | ||||||||||||MwoI || | | | |||||||||||||BisI || | | | ||||||||||||||BlsI || | | | |||||||||||||||MwoI || | | | |||||||||||||||CviJI || | | | ||||||||||||||||AciI || | | | ||||||||||||||||BisI || | | | |||||||||||||||||BlsI || | | | ||||||||||||||||||TseI || | | | ||||||||||||||||||TauI || | | | ||||||||||||||||||MwoI || | | | ||||||||||||||||||BbvI || | | | ||||||||||||||||||AlwNI || | | | ||||||||||||||||||BstAPI || | | | ||||||||||||||||||NspBII* || | | | |||||||||||||||||||BisI || | | | ||||||||||||||||||||BlsI || | | | |||||||||||||||||||||TseI || | | | |||||||||||||||||||||MwoI || | | | |||||||||||||||||||||BbvI || | | | ||||||||||||||||||||||BisI || | |ApoI | |||||||||||||||||||||||BlsI || | |TspEI | ||||||||||||||||||||||||AciI CviJI || | |EcoRI | ||||||||||||||||||||||||BbvI Hpy178III* \ \\ \ \\ \ \\\\\\\\\\\\\\\\\\\\\\\\\ \ GGGCTTGGTGTTAACCGTAGAATTCTGGCCGCGGCAGCAGCAGCCGCTGCTGCGGTGTCA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CCCGAACCACAATTGGCATCTTAAGACCGGCGCCGTCGTCGTCGGCGACGACGCCACAGT / // / / / /////////////////////////// / CviJI || | | | ||||||||||||||||||||||||||| BbvI || | | | ||||||||||||||||||||||||||AciI || | | | |||||||||||||||||||||||||BbvI || | | | ||||||||||||||||||||||||TseI || | | | |||||||||||||||||||||||BisI || | | | ||||||||||||||||||||||BbvI || | | | ||||||||||||||||||||||BlsI || | | | |||||||||||||||||||||TseI || | | | ||||||||||||||||||||BisI || | | | |||||||||||||||||||BlsI || | | | ||||||||||||||||||NspBII* || | | | ||||||||||||||||||MwoI || | | | ||||||||||||||||||AciI || | | | |||||||||||||||||BisI || | | | ||||||||||||||||BlsI || | | | |||||||||||||||BstAPI || | | | |||||||||||||||AlwNI || | | | |||||||||||||||CviJI || | | | |||||||||||||||MwoI || | | | |||||||||||||||TseI || | | | |||||||||||||||TauI || | | | ||||||||||||||BisI || | | | |||||||||||||BlsI || | | | ||||||||||||MwoI || | | | ||||||||||||TseI || | | | ||||||||||||BbvI || | | | |||||||||||BisI || | | | ||||||||||BlsI || | | | |||||||||MwoI || | | | |||||||||TseI || | | | |||||||||BbvI || | | | ||||||||BisI || | | | |||||||BlsI || | | | ||||||MwoI || | | | |||||DsaI* || | | | |||||SecI* || | | | |||||BisI || | | | |||||AciI || | | | ||||BlsI || | | | |||NspBII* || | | | |||FnuDII* || | | | |||MwoI || | | | |||AciI || | | | |||TauI || | | | ||SacII || | | | ||CfrI || | | | ||BisI || | | | |BlsI || | | | HaeIII || | | | CviJI || | | | TauI || | | EcoRI || | | TspEI || | | ApoI || | EcoP15I || Tsp4CI* |MseI Hpy166II HindII HpaI G L G V N R R I L A A A A A A A A A V S G L V L T V E F W P R Q Q Q P L L R C Q A W C * P * N S G R G S S S R C C G V R ----:----|----:----|----:----|----:----|----:----|----:----| P S P T L R L I R A A A A A A A A A T D H A Q H * G Y F E P R P L L L R Q Q P T P K T N V T S N Q G R C C C G S S R H * EcoP15I | Hin4I | Hin4I | |EcoP15I | || CviRI* | || | EcoT22I | || | | Hpy188I | || | | | SfaNI | || | | | | CviJI | || | | | | | Hpy178III* | || | | | | | |TaqI Hin4I | || | | | | | || BccI Hin4I \ \\ \ \ \ \ \ \\ \ \ GGAAACAATGCATCAGATGAGCCATCTCGAAAGAAAAACAGAAGATAG 1630 1640 1650 1660 ----:----|----:----|----:----|----:----|----:--- CCTTTGTTACGTAGTCTACTCGGTAGAGCTTTCTTTTTGTCTTCTATC // // / / / / // / / || || | | | | || | Hin4I || || | | | | || | Hin4I || || | | | | || BccI || || | | | | |TaqI || || | | | | Hpy178III* || || | | | SfaNI || || | | CviJI || || | Hpy188I || || EcoP15I || || CviRI* || |EcoT22I || EcoP15I |Hin4I |Hin4I Hpy178III* G N N A S D E P S R K K N R R * E T M H Q M S H L E R K T E D X K Q C I R * A I S K E K Q K I X ----:----|----:----|----:----|----:----|----:--- P F L A D S S G D R F F F L L Y L F C H M L H A M E F S F C F I S V I C * I L W R S L F V S S L # Enzymes that cut Frequency Isoschizomers AarI 1 Acc65I 3 Asp718I AccI 1 FblI,XmiI AciI 17 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 1 DraI AluI 6 AluBI AlwNI 1 CaiI ApaLI 1 Alw44I,VneI ApoI 7 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 2 MlsI,MluNI,MscI,Msp20I BarI 1 BbvI 10 BseXI,BstV1I,Lsp1109I BccI 4 BceAI 2 BciVI 2 BfuI BclI 1 FbaI,Ksp22I BetI* 1 BsaWI BfiI 1 BmrI,BmuI BinI* 2 AlwI,BspPI,AclWI BisI 14 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 14 BmgT120I 2 BseGI 5 BstF5I,BtsCI BseMII 2 BseSI 2 BaeGI,BstSLI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 2 BspHI 1 CciI,PagI,RcaI BspMI 2 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 3 BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 5 BstXI 1 Cac8I 5 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I CfrI 3 AcoI,EaeI Csp6I 7 CviQI,RsaNI CviAII 6 CviJI 19 CviKI-1 CviRI* 12 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 5 MalI DsaI* 2 BtgI,BstDSI Eco57I 1 AcuI Eco57MI 1 EcoP15I 3 EcoRI 2 EcoT22I 2 Mph1103I,NsiI,Zsp2I FatI 6 FauI 5 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 5 HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 3 Bbv12I,BsiHKAI,Alw21I HgiCI* 4 BanI,BshNI,BspT107I,AccB1I Hin4I 6 Hin4II* 4 HpyAV HindII 1 HincII HindIII 2 HinfI 4 HpaI 1 KspAI HpaII 3 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 11 Hpy188III Hpy188I 4 Hpy99I 1 KpnI 3 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeIII 3 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 MfeI 1 MunI MlyI 1 SchI MmeI 2 MnlI 4 MseI 12 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 11 HpyF10VI,BstMWI NdeI 2 FauNDI NlaIII 6 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspBII* 5 MspA1I NspI 2 BstNSI,XceI OliI 1 AleI PleI 1 PpsI RsaI 7 AfaI SacII 2 KspI,Cfr42I,Sfr303I,SgrBI,SstII SapI 1 LguI,PciSI,BspQI ScaI 1 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 15 SfaNI 3 LweI SfeI* 2 BstSFI,SfcI,BfmI SphI 1 PaeI,BbuI StuI 1 Eco147I,PceI,SseBI,AatI TaqI 4 TaqII 2 TatI 1 TauI 4 TfiI 3 PfeI TseI 10 ApeKI TsoI 2 Tsp45I 3 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 17 TasI,Tsp509I,Sse9I TspGWI 1 TstI 2 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI AclI AflII AflIII AgeI AjuI AlfI AloI ApaI AscI AsuII AvaI AvrII BamHI BbvCI BbvII* Bce83I* BcgI BdaI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BsePI BseRI BseYI BsgI BsiI* BsmAI Bsp120I Bsp1407I BspLU11I* BspMII* BspOI BsrBI Bst2UI BstNI BstOI BtgZI BtrI BtsI Cfr10I Cfr9I ClaI CspCI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRII EcoRV EgeI EheI Esp3I EspI* FalI FseI FspAI GlaI GsaI GsuI HaeII HgiJII* HhaI Hin6I HinP1I HspAI KasI MaeII MauBI McrI* MluI MroNI MstI* MvaI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SalI SanDI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I SspI StyI SwaI TaiI TspMI TspRI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769