Restriction Map of CHL1/YPL008W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CHL1/YPL008W on chromosome XVI from coordinates 539385 to 541970.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.32219

Hin4I Hin4I |SspI PsiI |BsmAI | CviJI || FokI | | Hin4I || |Hpy188I BseGI | | Hin4I \\ \\ \ \ \ \ ATGGACAAAAAGGAATATTCGGAGACTTTCTATCATCCTTATAAGCCCTATGATATTCAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTGTTTTTCCTTATAAGCCTCTGAAAGATAGTAGGAATATTCGGGATACTATAAGTC / / / / / // / / Hin4I | | FokI BseGI || CviJI SetI Hin4I | Hpy188I |Hin4I | BsmAI |Hin4I SspI PsiI M D K K E Y S E T F Y H P Y K P Y D I Q W T K R N I R R L S I I L I S P M I F R G Q K G I F G D F L S S L * A L * Y S G ----:----|----:----|----:----|----:----|----:----|----:----| X S L F S Y E S V K * * G * L G * S I * X P C F P I N P S K R D D K Y A R H Y E H V F L F I R L S E I M R I L G I I N L AluI CviJI | SetI | MboII Csp6I | | PfoI |RsaI Tsp4CI* | | BssKI |SetI | AccI | | EcoRII || Tsp4CI* | |BssNAI Hin4II* | | | ScrFI || | MseI | |Hpy166II | Hpy188I | | | BseBI \\ \ \ \ \\ \ \ \ \ \ \ GTACAGTTAATGGAAACTGTATACAGAGTGCTATCCGAAGGGAAGAAAATAGCTATCCTG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CATGTCAATTACCTTTGACATATGTCTCACGATAGGCTTCCCTTCTTTTATCGATAGGAC /// / / // / / / // / ||| MseI | |AccI | Hpy188I | |MboII BseBI ||Tsp4CI* | Hpy166II Hin4II* | CviJI ScrFI |Csp6I | BssNAI | AluI RsaI Tsp4CI* SetI V Q L M E T V Y R V L S E G K K I A I L Y S * W K L Y T E C Y P K G R K * L S W T V N G N C I Q S A I R R E E N S Y P G ----:----|----:----|----:----|----:----|----:----|----:----| T C N I S V T Y L T S D S P F F I A I R P V T L P F Q I C L A I R L S S F L * G Y L * H F S Y V S H * G F P L F Y S D Q BslFI BsrI Tth111I TspRI | HgaI CviJI | BfiI | |MseI \ \ \ \ \\ GAAAGCCCCACTGGGACAGGCAAGACGCTGTCCTTAATCTGTGCCACGATGACTTGGTTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCGGGGTGACCCTGTCCGTTCTGCGACAGGAATTAGACACGGTGCTACTGAACCAAC / // / / / / / / | |TspRI BsrI BfiI | | | HgaI | CviJI | | MseI EcoRII | BslFI BssKI Tth111I PfoI E S P T G T G K T L S L I C A T M T W L K A P L G Q A R R C P * S V P R * L G * K P H W D R Q D A V L N L C H D D L V E ----:----|----:----|----:----|----:----|----:----|----:----| S L G V P V P L V S D K I Q A V I V Q N P F G W Q S L C S A T R L R H W S S K T F A G S P C A L R Q G * D T G R H S P Q AciI |MslI ||FatI |||CviAII HphI |||| NlaIII | TspDTI |||| |FauI \ \ \\\\ \\ AGAATGAATAAAGCAGATATTTTCACCCGCATGGAAACTAACATCAAAACGAATGAAGAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTACTTATTTCGTCTATAAAAGTGGGCGTACCTTTGATTGTAGTTTTGCTTACTTCTA / / // // / | TspDTI || || FauI HphI || |FatI || CviAII |NlaIII |AciI MslI R M N K A D I F T R M E T N I K T N E D E * I K Q I F S P A W K L T S K R M K M N E * S R Y F H P H G N * H Q N E * R * ----:----|----:----|----:----|----:----|----:----|----:----| L I F L A S I K V R M S V L M L V F S S S F S Y L L Y K * G C P F * C * F S H L S H I F C I N E G A H F S V D F R I F I MboII |TspDTI || DdeI CviJI || Bpu10I | BtgZI || |SetI | | BsrI BfiI TaqI \\ \\ \ \ \ \ \ GATAGTGAAAACCTAAGCGATGACGAGCCAGACTGGGTTATTGACACTTATCGAAAGTCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTATCACTTTTGGATTCGCTACTGCTCGGTCTGACCCAATAACTGTGAATAGCTTTCAGA / / / / // / / | SetI Bpu10I CviJI || BfiI TaqI TspDTI DdeI |BtgZI MboII BsrI D S E N L S D D E P D W V I D T Y R K S I V K T * A M T S Q T G L L T L I E S L * * K P K R * R A R L G Y * H L S K V C ----:----|----:----|----:----|----:----|----:----|----:----| S L S F R L S S S G S Q T I S V * R F D H Y H F G L R H R A L S P * Q C K D F T I T F V * A I V L W V P N N V S I S L R MseI |AhaIII* || TspEI SetI || | MseI \ \\ \ \ GTTTTACAAGAAAAGGTGGATTTGCTAAATGATTATGAGAAGCATTTAAACGAAATTAAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAATGTTCTTTTCCACCTAAACGATTTACTAATACTCTTCGTAAATTTGCTTTAATTG / // // SetI |MseI |MseI AhaIII* TspEI V L Q E K V D L L N D Y E K H L N E I N F Y K K R W I C * M I M R S I * T K L T F T R K G G F A K * L * E A F K R N * H ----:----|----:----|----:----|----:----|----:----|----:----| T K C S F T S K S F S * S F C K F S I L Q K V L F P P N A L H N H S A N L R F * N * L F L H I Q * I I I L L M * V F N V FatI |CviAII BsrI || NlaIII BsaBI \ \\ \ \ ACGACCAGTTGTAAGCAGTTGAAAACTATGTGTGATTTAGATAAAGAACATGGAAGATAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTGGTCAACATTCGTCAACTTTTGATACACACTAAATCTATTTCTTGTACCTTCTATA / / // / BsrI | |FatI BsaBI | CviAII NlaIII T T S C K Q L K T M C D L D K E H G R Y R P V V S S * K L C V I * I K N M E D I D Q L * A V E N Y V * F R * R T W K I * ----:----|----:----|----:----|----:----|----:----|----:----| V V L Q L C N F V I H S K S L S C P L Y C S W N Y A T S F * T H N L Y L V H F I R G T T L L Q F S H T I * I F F M S S I Hin6I |GlaI ||HhaI BinI* |||MaeI |MboII |||HaeII || MboI |||| HgiCI* || | DpnI |||| | NlaIV || | |BstKTI |||| | | SetI || | || MseI |||| | | MslI \\ \ \\ \ \\\\ \ \ \ AAATCAGTTGATCCATTAAGAAAGAAACGCAAAGGCGCTAGGCACCTTGATGTATCACTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGTCAACTAGGTAATTCTTTCTTTGCGTTTCCGCGATCCGTGGAACTACATAGTGAA // // / / //// / / / / || || MboI MseI |||| | | | MslI || |DpnI |||| | | HgiCI* || BstKTI |||| | NlaIV |BinI* |||| | SetI MboII |||| MaeI |||Hin6I ||GlaI |HhaI HaeII K S V D P L R K K R K G A R H L D V S L N Q L I H * E R N A K A L G T L M Y H L I S * S I K K E T Q R R * A P * C I T * ----:----|----:----|----:----|----:----|----:----|----:----| L D T S G N L F F R L P A L C R S T D S Y I L Q D M L F S V C L R * A G Q H I V F * N I W * S L F A F A S P V K I Y * K AciI | Hin6I | FnuDII* | |GlaI | ||HhaI | ||| SplI* | ||| |Csp6I | ||| ||RsaI | ||| ||| TfiI | ||| ||| HinfI | ||| ||| | Hpy188I | ||| ||| | |TfiI | ||| ||| | |HinfI | ||| ||| | || AlwNI MboII | ||| ||| | || | Hpy188I SetI \ \ \\\ \\\ \ \\ \ \ \ GAAGAACAAGATTTTATTCCGCGCCCGTACGAATCAGATTCTGAAAACAATGATACCTCC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTGTTCTAAAATAAGGCGCGGGCATGCTTAGTCTAAGACTTTTGTTACTATGGAGG / /// /// // / // / MboII ||| ||| || | |Hpy188I SetI ||| ||| || | HinfI ||| ||| || | TfiI ||| ||| || AlwNI ||| ||| |Hpy188I ||| ||| HinfI ||| ||| TfiI ||| ||SplI* ||| |Csp6I ||| RsaI ||Hin6I |GlaI FnuDII* AciI HhaI E E Q D F I P R P Y E S D S E N N D T S K N K I L F R A R T N Q I L K T M I P P R T R F Y S A P V R I R F * K Q * Y L Q ----:----|----:----|----:----|----:----|----:----|----:----| S S C S K I G R G Y S D S E S F L S V E Q L V L N * E A G T R I L N Q F C H Y R F F L I K N R A R V F * I R F V I I G G MnlI BseRI Hpy166II | MnlI |Hpy188I | ApoI | |MnlI || MboII TspEI | TspEI \ \\ \\ \ \ \ \ AAAAGCACAAGAGGAGGAAGAATATCTGATAAAGATTACAAATTGAGTGAACTAAATTCA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCGTGTTCTCCTCCTTCTTATAGACTATTTCTAATGTTTAACTCACTTGATTTAAGT / // / / / / / / | |MnlI | | MboII | Hpy166II TspEI | MnlI | Hpy188I TspEI ApoI MnlI BseRI K S T R G G R I S D K D Y K L S E L N S K A Q E E E E Y L I K I T N * V N * I H K H K R R K N I * * R L Q I E * T K F T ----:----|----:----|----:----|----:----|----:----|----:----| L L V L P P L I D S L S * L N L S S F E W F C L L L F F I Q Y L N C I S H V L N F A C S S S S Y R I F I V F Q T F * I * SetI | TaqI | BinI* | |Hpy178III* | || MboI BccI | || XhoII PflMI |TspEI | || | DpnI BsiYI* || Hin4II* | || | |BstKTI | MboI \\ \ \ \\ \ \\ \ \ CAAATAATAACACTTTTAGACAAAATTGATGGGAAGGTTTCGAGAGATCCAAACAATGGC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTATTATTGTGAAAATCTGTTTTAACTACCCTTCCAAAGCTCTCTAGGTTTGTTACCG / // / /// // / / | |TspEI SetI ||| || | BsiYI* | Hin4II* ||| || | PflMI BccI ||| || XhoII ||| || MboI ||| |DpnI ||| BstKTI ||Hpy178III* |TaqI BinI* Q I I T L L D K I D G K V S R D P N N G K * * H F * T K L M G R F R E I Q T M A N N N T F R Q N * W E G F E R S K Q W R ----:----|----:----|----:----|----:----|----:----|----:----| C I I V S K S L I S P F T E L S G F L P V F L L V K L C F Q H S P K S L D L C H L Y Y C K * V F N I P L N R S I W V I A BseGI DpnI CviRI* |PvuI MaeII | EcoT22I |SgfI |MaeIII | | Hpy178III* |McrI* || SetI FokI | | | SfaNI |BstKTI || TaiI BsrI | TspRI | | | | XmnI \\ \\ \ \ \ \ \ \ \ \ \ GATCGCTTTGACGTTACAAATCAAAATCCAGTGAAAATATATTATGCATCCAGAACTTAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGCGAAACTGCAATGTTTAGTTTTAGGTCACTTTTATATAATACGTAGGTCTTGAATA // / / / / / / / / / / / || MboI | | MaeIII TspRI FokI | | | | SfaNI |DpnI | MaeII BsrI | | | XmnI BstKTI TaiI | | Hpy178III* McrI* SetI | CviRI* SgfI EcoT22I PvuI BseGI D R F D V T N Q N P V K I Y Y A S R T Y I A L T L Q I K I Q * K Y I M H P E L I S L * R Y K S K S S E N I L C I Q N L F ----:----|----:----|----:----|----:----|----:----|----:----| S R K S T V F * F G T F I Y * A D L V * R D S Q R * L D F D L S F I N H M W F K I A K V N C I L I W H F Y I I C G S S I MnlI FokI |BseGI SetI BspCNI || BslFI TspEI |TspEI DdeI MseI |BseMII || | BccI \ \\ \ \ \\ \\ \ \ TCACAATTAGGTCAATTTACTTCTCAGTTAAGATTACCCTCGTTCCCATCATCCTTTAGG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGTTAATCCAGTTAAATGAAGAGTCAATTCTAATGGGAGCAAGGGTAGTAGGAAATCC / / / / // / / // TspEI TspEI | | || FokI BseGI |BslFI SetI | | |BseMII MnlI BccI | | BspCNI | MseI DdeI S Q L G Q F T S Q L R L P S F P S S F R H N * V N L L L S * D Y P R S H H P L G T I R S I Y F S V K I T L V P I I L * G ----:----|----:----|----:----|----:----|----:----|----:----| E C N P * N V E * N L N G E N G D D K L N V I L D I * K E T L I V R T G M M R * * L * T L K S R L * S * G R E W * G K P AsuI* SetI AvaII | TatI TseI DraII | |Csp6I |BisI PpuMI | ||RsaI ||BlsI |BmgT120I | ||ScaI |||AluI ||SetI | |||TspDTI TaqI |||CviJI ||NlaIV | |||| HphI AsuII |||| SetI \\\ \ \\\\ \ \ \\\\ \ GATAAGGTCCCAGATGAAAAGGTGAAGTACTTACCACTTGCTTCGAAAAAGCAGCTTTGT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTCCAGGGTCTACTTTTCCACTTCATGAATGGTGAACGAAGCTTTTTCGTCGAAACA / // / //// / / /// | |PpuMI SetI |||| HphI AsuII ||CviJI | |DraII |||TatI TaqI ||TseI | |AvaII ||Csp6I ||AluI | |AsuI* |ScaI |BisI | BmgT120I |RsaI BlsI | NlaIV TspDTI SetI SetI D K V P D E K V K Y L P L A S K K Q L C I R S Q M K R * S T Y H L L R K S S F V * G P R * K G E V L T T C F E K A A L Y ----:----|----:----|----:----|----:----|----:----|----:----| S L T G S S F T F Y K G S A E F F C S Q P Y P G L H F P S T S V V Q K S F A A K I L D W I F L H L V * W K S R F L L K T FatI |CviAII || NspI TspDTI || NlaIII | AluI || | AciI | CviJI || | HgaI MseI | | SetI || | | AsuI* VspI | | | MseI || | | AvaII |BbvI | | | VspI || | | |BmgT120I \\ \ \ \ \ \\ \ \ \\ ATTAATCCAAAAGTGATGAAGTGGAAAACATTGGAAGCTATTAATGACGCATGTGCGGAC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTAGGTTTTCACTACTTCACCTTTTGTAACCTTCGATAATTACTGCGTACACGCCTG / / / / / / / // //// | BbvI | | CviJI VspI | || |||AvaII VspI | | AluI MseI | || |||AsuI* MseI | SetI | || |||HgaI TspDTI | || ||BmgT120I | || |SetI | || AciI | |FatI | CviAII NlaIII NspI I N P K V M K W K T L E A I N D A C A D L I Q K * * S G K H W K L L M T H V R T * S K S D E V E N I G S Y * * R M C G P ----:----|----:----|----:----|----:----|----:----|----:----| I L G F T I F H F V N S A I L S A H A S Y * D L L S S T S F M P L * * H R M H P N I W F H H L P F C Q F S N I V C T R V DdeI |SetI MnlI BseGI FokI HgaI AcyI \\ \ \ \ \ \ CTTAGACATAGTAAAGAGGGATGTATCTTTTATCAAAATACAAACGAATGGCGTCATTGT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GAATCTGTATCATTTCTCCCTACATAGAAAATAGTTTTATGTTTGCTTACCGCAGTAACA / / / / / / | MnlI BseGI FokI HgaI AcyI DdeI L R H S K E G C I F Y Q N T N E W R H C L D I V K R D V S F I K I Q T N G V I V * T * * R G M Y L L S K Y K R M A S L S ----:----|----:----|----:----|----:----|----:----|----:----| R L C L L S P H I K * * F V F S H R * Q G * V Y Y L P I Y R K D F Y L R I A D N K S M T F L S T D K I L I C V F P T M T Hpy178III* | MaeII | | SetI | | TaiI BspCNI | | | AluI |BseMII | | | CviJI || Hpy188I | | | | SetI || | ApoI | | | | |DdeI || | TspEI | | | | || Hpy188I || | | Hpy178III* \ \ \ \ \\ \ \\ \ \ \ CCTGATACGTTAGCTCTCAGAGATATGATTTTTTCAGAAATTCAAGATATTGAAGATTTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTATGCAATCGAGAGTCTCTATACTAAAAAAGTCTTTAAGTTCTATAACTTCTAAAT / / / / / // // / / / | | | | | |DdeI |BseMII | | Hpy178III* | | | | | Hpy188I BspCNI | TspEI | | | | CviJI | ApoI | | | | AluI Hpy188I | | | SetI | | MaeII | TaiI | SetI Hpy178III* P D T L A L R D M I F S E I Q D I E D L L I R * L S E I * F F Q K F K I L K I * * Y V S S Q R Y D F F R N S R Y * R F S ----:----|----:----|----:----|----:----|----:----|----:----| G S V N A R L S I I K E S I * S I S S K D Q Y T L E * L Y S K K L F E L Y Q L N R I R * S E S I H N K * F N L I N F I * MnlI | MnlI MboII | AvaI |BssKI | XhoI |SecI* | SmlI |EcoRII | AbsI ||PasI | PspXI ||SecI* | |TaqI |||ScrFI ApoI | |BmeT110I |||BseBI BslFI TspEI | || MnlI MnlI \\\\ \ \ \ \\ \ \ GTTCCCCTGGGAAAATCTTTGGGAATTTGTCCCTATTACGCCTCGAGGGAGGCACTTCCT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGGGGACCCTTTTAGAAACCCTTAAACAGGGATAATGCGGAGCTCCCTCCGTGAAGGA / /// / / / / // / / | ||EcoRII BslFI TspEI | | || MnlI MnlI | ||BssKI ApoI | | |PspXI | ||SecI* | | |AbsI | |SecI* | | |SmlI | |PasI | | |XhoI | BseBI | | |AvaI | ScrFI | | BmeT110I MboII | | TaqI | MnlI MnlI V P L G K S L G I C P Y Y A S R E A L P F P W E N L W E F V P I T P R G R H F L S P G K I F G N L S L L R L E G G T S Y ----:----|----:----|----:----|----:----|----:----|----:----| T G R P F D K P I Q G * * A E L S A S G L E G P F I K P F K D R N R R S P P V E N G Q S F R Q S N T G I V G R P L C K R DdeI |Hpy188I ||HinfI ||| Hpy166II ||| | PleI SetI ||| | |MlyI |MaeIII BseMII ||| | |MboII AciI |Tsp45I |BspCNI ||| | |BbvII* \ \\ \\ \\\ \ \\ ATTGCGGAGGTAGTGACTTTGCCATATCAATACTTACTTTCTGAGTCCACCCGTTCAAGT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGCCTCCATCACTGAAACGGTATAGTTATGAATGAAAGACTCAGGTGGGCAAGTTCA // / // / / // // / |SetI Tsp45I |BspCNI | | || || BbvII* AciI MaeIII BseMII | | || |PleI | | || |MlyI | | || MboII | | |Hpy166II | | HinfI | DdeI Hpy188I I A E V V T L P Y Q Y L L S E S T R S S L R R * * L C H I N T Y F L S P P V Q V C G G S D F A I S I L T F * V H P F K S ----:----|----:----|----:----|----:----|----:----|----:----| I A S T T V K G Y * Y K S E S D V R E L * Q P P L S K A M D I S V K Q T W G N L N R L Y H S Q W I L V * K R L G G T * T SetI | ApoI | TspEI | | SfeI* | | | BdaI | | | BdaI | | | | TspEI CviJI BdaI | | | | | MnlI | TspEI BdaI \ \ \ \ \ \ \ \ \ CTTCAAATAAACCTTGAAAATTCTATAGTAATTATTGATGAGGCTCATAATTTGATAGAA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGTTTATTTGGAACTTTTAAGATATCATTAATAACTACTCCGAGTATTAAACTATCTT / // / // / / / SetI || | |TspEI CviJI | BdaI || | MnlI | BdaI || SfeI* TspEI |BdaI |BdaI TspEI ApoI L Q I N L E N S I V I I D E A H N L I E F K * T L K I L * * L L M R L I I * * K S N K P * K F Y S N Y * * G S * F D R N ----:----|----:----|----:----|----:----|----:----|----:----| R * I F R S F E I T I I S S A * L K I S D E F L G Q F N * L L * Q H P E Y N S L K L Y V K F I R Y Y N N I L S M I Q Y F DdeI | MboI | BglII | XhoII | Hpy188I | | DpnI BspCNI ApoI | | |BstKTI |BseMII TspEI MmeI | | ||MnlI || MseI TspEI \ \ \ \ \\\ \\ \ \ ACAATAAATTCTATATATTCCTCTCAGATCTCGTTGGAGGACTTAAAGAATTGCCATAAG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTATTTAAGATATATAAGGAGAGTCTAGAGCAACCTCCTGAATTTCTTAACGGTATTC / / ////// // / / | MmeI |||||| |BseMII MseI TspEI TspEI |||||| BspCNI ApoI |||||XhoII |||||BglII |||||MboI ||||MnlI |||DpnI ||BstKTI |DdeI Hpy188I T I N S I Y S S Q I S L E D L K N C H K Q * I L Y I P L R S R W R T * R I A I R N K F Y I F L S D L V G G L K E L P * G ----:----|----:----|----:----|----:----|----:----|----:----| V I F E I Y E E * I E N S S K F F Q W L F L L N * I N R E S R T P P S L S N G Y C Y I R Y I G R L D R Q L V * L I A M L BssKI BssKI EcoRII | HpaII ApoI | ScrFI | ScrFI TspEI | BseBI | CauII* MaeIII | MseI | | CviJI | | MaeIII \ \ \ \ \ \ \ \ \ GGGATAGTAACTTATTTCAACAAATTTAAGTCCAGGCTCAATCCCGGTAACAGAGTAAAT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CCCTATCATTGAATAAAGTTGTTTAAATTCAGGTCCGAGTTAGGGCCATTGTCTCATTTA / / / / / /// / MaeIII | MseI | EcoRII ||| MaeIII TspEI | BssKI ||BssKI ApoI | CviJI |HpaII BseBI CauII* ScrFI ScrFI G I V T Y F N K F K S R L N P G N R V N G * * L I S T N L S P G S I P V T E * I D S N L F Q Q I * V Q A Q S R * Q S K S ----:----|----:----|----:----|----:----|----:----|----:----| P I T V * K L L N L D L S L G P L L T F P S L L K N * C I * T W A * D R Y C L L P Y Y S I E V F K L G P E I G T V S Y I HinfI AluI | Hpy188I CviJI | |TfiI MseI | SetI MlyI | |HinfI | ApoI MseI | |TspEI PleI | || TspEI | TspEI Hpy178III* \ \ \\ \ \ \\ \ \ \ \ CTATTAAAGCTCAATTCACTTTTGATGACTCTGATTCAATTTATAGTTAAAAATTTCAAG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GATAATTTCGAGTTAAGTGAAAACTACTGAGACTAAGTTAAATATCAATTTTTAAAGTTC // / / // // / / / / / || CviJI | |PleI || | TspEI MseI | Hpy178III* || AluI | MlyI || HinfI TspEI |SetI TspEI || TfiI ApoI MseI |Hpy188I HinfI L L K L N S L L M T L I Q F I V K N F K Y * S S I H F * * L * F N L * L K I S R I K A Q F T F D D S D S I Y S * K F Q E ----:----|----:----|----:----|----:----|----:----|----:----| R N F S L E S K I V R I * N I T L F K L D I L A * N V K S S E S E I * L * F N * * * L E I * K Q H S Q N L K Y N F I E L MboII |BinI* || MboI || XhoII || | DpnI Hpy166II TaqI || | |BstKTI | MaeIII ClaI TspDTI \\ \ \\ \ \ \ \ AAGATAGGACAAGAAATAGATCCTAACGATATGTTCACAGGAAGTAACATCGATACCCTA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTATCCTGTTCTTTATCTAGGATTGCTATACAAGTGTCCTTCATTGTAGCTATGGGAT / / // / / / // | | || XhoII Hpy166II | |TspDTI | | || MboI | ClaI | | |DpnI | TaqI | | BstKTI MaeIII | BinI* MboII K I G Q E I D P N D M F T G S N I D T L R * D K K * I L T I C S Q E V T S I P * D R T R N R S * R Y V H R K * H R Y P K ----:----|----:----|----:----|----:----|----:----|----:----| F I P C S I S G L S I N V P L L M S V R S S L V L F L D * R Y T * L F Y C R Y G L Y S L F Y I R V I H E C S T V D I G * AflIII BsmAI | MaeII | TspEI TspEI | |BsaAI \ \ \ \ \\ AACATTCATAAACTATTGAGATATATAAAAGTCTCCAAAATTGCTTACAAAATTGACACG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTAAGTATTTGATAACTCTATATATTTTCAGAGGTTTTAACGAATGTTTTAACTGTGC / / / / // | TspEI | | |AflIII BsmAI | | |MaeII | | BsaAI | TaiI | SetI TspEI N I H K L L R Y I K V S K I A Y K I D T T F I N Y * D I * K S P K L L T K L T R H S * T I E I Y K S L Q N C L Q N * H V ----:----|----:----|----:----|----:----|----:----|----:----| F M * L S N L Y I F T E L I A * L I S V L C E Y V I S I Y L L R W F Q K C F Q C V N M F * Q S I Y F D G F N S V F N V R SetI TaiI | BssKI | EcoRII | | ScrFI | | BseBI | | | Hin4I TfiI | | | | MnlI TsoI HinfI MboII Hin4I TspDTI \ \ \ \ \ \ \ \ \ \ TATAACCAGGCACTAAAAGAGGAAGAATCGTCAAAAAATGAAAATCCAATAAAAGAAACG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTGGTCCGTGATTTTCTCCTTCTTAGCAGTTTTTTACTTTTAGGTTATTTTCTTTGC / / // / / / / / | | |MnlI TsoI | | Hin4I TspDTI | | EcoRII | MboII | | BssKI HinfI | BseBI TfiI | ScrFI Hin4I Y N Q A L K E E E S S K N E N P I K E T I T R H * K R K N R Q K M K I Q * K K R * P G T K R G R I V K K * K S N K R N A ----:----|----:----|----:----|----:----|----:----|----:----| Y L W A S F S S S D D F F S F G I F S V T Y G P V L L P L I T L F H F D L L L F I V L C * F L F F R * F I F I W Y F F R DdeI BspCNI MboII | CviJI |BseMII SetI TspEI \ \ \ \\ \ \ CATAAAAAATCAGTTTCTTCTCAGCCATTACTTTTCAAGGTTTCTCAATTCCTATATTGT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GTATTTTTTAGTCAAAGAAGAGTCGGTAATGAAAAGTTCCAAAGAGTTAAGGATATAACA / // // / / MboII |CviJI || SetI TspEI DdeI |BseMII BspCNI H K K S V S S Q P L L F K V S Q F L Y C I K N Q F L L S H Y F S R F L N S Y I V * K I S F F S A I T F Q G F S I P I L F ----:----|----:----|----:----|----:----|----:----|----:----| C L F D T E E * G N S K L T E * N R Y Q A Y F I L K K E A M V K * P K E I G I N M F F * N R R L W * K E L N R L E * I T AcyI MaeII Hin4II* |ZraI || SetI TatI || TaiI |Csp6I || AatII ||RsaI ApoI || | Hpy188I |||FatI TspEI || | | TspEI TspEI ||||CviAII \ \\ \ \ \ \ \\\\\ TTGACAAATTTGACGTCAGAAGGACAATTTTTTTTTGAGAAAAATTATTCAATAAAGTAC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AACTGTTTAAACTGCAGTCTTCCTGTTAAAAAAAAACTCTTTTTAATAAGTTATTTCATG / / // / / / /// | | || Hpy188I TspEI TspEI ||TatI | | |MaeII |NlaIII | | |AcyI |Csp6I | | ZraI |NspI | Hin4II* RsaI | AatII | TaiI | SetI TspEI ApoI L T N L T S E G Q F F F E K N Y S I K Y * Q I * R Q K D N F F L R K I I Q * S T D K F D V R R T I F F * E K L F N K V H ----:----|----:----|----:----|----:----|----:----|----:----| K V F K V D S P C N K K S F F * E I F Y N S L N S T L L V I K K Q S F N N L L T Q C I Q R * F S L K K K L F I I * Y L V NspI NlaIII | FalI | FalI PleI | XbaI Hpy166II |MlyI | |MaeI | SetI ||FalI AarI | |Hpy178III* | | HinfI ||FalI BspMI \ \\ \ \ \ \\\ \ ATGCTTCTAGAACCAAGTAAACCTTTTGAGTCAATACTAAATCAAGCAAAATGTGTAGTC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TACGAAGATCTTGGTTCATTTGGAAAACTCAGTTATGATTTAGTTCGTTTTACACATCAG /// // // / / / / ||FatI |XbaI |SetI | | PleI BspMI |CviAII | Hpy166II | | MlyI AarI FalI Hpy178III* | FalI FalI MaeI | FalI HinfI M L L E P S K P F E S I L N Q A K C V V C F * N Q V N L L S Q Y * I K Q N V * S A S R T K * T F * V N T K S S K M C S P ----:----|----:----|----:----|----:----|----:----|----:----| M S R S G L L G K S D I S F * A F H T T C A E L V L Y V K Q T L V L D L L I H L H K * F W T F R K L * Y * I L C F T Y D NlaIV | Hin4I | |FatI | ||BslFI | ||CviAII TaqI CviRI* | ||| NlaIII | ApoI SetI | SetI | ||| | Hpy188I | TspEI Hin4I \ \ \ \\\ \ \ \ \ \ CTTGCAGGTGGGACAATGGAACCCATGTCAGAGTTTTTGTCGAATTTGCTACCTGAAGTT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GAACGTCCACCCTGTTACCTTGGGTACAGTCTCAAAAACAGCTTAAACGATGGACTTCAA // / / / //// / / // |SetI | | | |||Hpy188I | | |SetI CviRI* | | | ||BslFI | | Hin4I | | | |FatI | TspEI | | | CviAII | ApoI | | NlaIII TaqI | NlaIV Hin4I L A G G T M E P M S E F L S N L L P E V L Q V G Q W N P C Q S F C R I C Y L K F C R W D N G T H V R V F V E F A T * S S ----:----|----:----|----:----|----:----|----:----|----:----| R A P P V I S G M D S N K D F K S G S T G Q L H S L P V W T L T K T S N A V Q L K C T P C H F G H * L K Q R I Q * R F N Hpy188I | Hin4II* | | BbvII* | | Eco57I | | Eco57MI | | | MboII | | | | Tth111I | | | | |SetI | | | | || Eco57I | | | | || Eco57MI | | | | || | CviRI* | | | | || | | FatI | | | | || | | |CviAII ApoI | | | | || | | || NlaIII TspEI CviRI* \ \ \ \ \\ \ \ \\ \ \ \ CCTTCTGAAGACATTACGACCTTGTCGTGCAATCATGTTATACCGAAAGAGAATTTGCAA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAGACTTCTGTAATGCTGGAACAGCACGTTAGTACAATATGGCTTTCTCTTAAACGTT / / / / / / / / // / / | | | | | | | | |FatI | CviRI* | | | | | | | | CviAII TspEI | | | | | | | NlaIII ApoI | | | | | | CviRI* | | | | | Eco57MI | | | | | Eco57I | | | | Tth111I | | | BbvII* | | | MboII | | | SetI | | Eco57MI | | Eco57I | Hin4II* Hpy188I P S E D I T T L S C N H V I P K E N L Q L L K T L R P C R A I M L Y R K R I C K F * R H Y D L V V Q S C Y T E R E F A N ----:----|----:----|----:----|----:----|----:----|----:----| G E S S M V V K D H L * T I G F S F K C E K Q L C * S R T T C D H * V S L S N A R R F V N R G Q R A I M N Y R F L I Q L BseMII |BspCNI || CviJI || | DdeI || | Bpu10I || | | AluI || | | CviJI Hpy166II || | | |SmlI | TaqI PpiI ||PpiI | | ||SetI | AsuII |Bce83I* BsmAI \\\ \ \ \\\ \ \ \\ \ ACTTATATCACAAACCAGCCTGAGCTTGAGTTCACATTCGAAAAAAGAATGTCTCCCTCC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TGAATATAGTGTTTGGTCGGACTCGAACTCAAGTGTAAGCTTTTTTCTTACAGAGGGAGG /// / /// / / / / / ||BspCNI | ||| | | | Bce83I* BsmAI |BseMII | ||| | | AsuII PpiI | ||| | | PpiI | ||| | | TaqI | ||| | Hpy166II | ||| SmlI | ||CviJI | ||AluI | |Bpu10I | |DdeI | SetI CviJI T Y I T N Q P E L E F T F E K R M S P S L I S Q T S L S L S S H S K K E C L P P L Y H K P A * A * V H I R K K N V S L P ----:----|----:----|----:----|----:----|----:----|----:----| V * I V F W G S S S N V N S F L I D G E F K Y * L G A Q A Q T * M R F F F T E R S I D C V L R L K L E C E F F S H R G G BseMII |BspCNI || MboI || | DpnI || | |BstKTI || | ||DdeI MnlI TspEI || | |||Hpy188I BsiYI* \ \ \\ \ \\\\ \ CTTGTAAATAATCATCTTTTTCAATTTTTTGTTGATCTGAGCAAAGCAGTTCCTAAAAAG 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| GAACATTTATTAGTAGAAAAAGTTAAAAAACAACTAGACTCGTTTCGTCAAGGATTTTTC / // // / / / MnlI |BspCNI || | DdeI BsiYI* BseMII || Hpy188I TspEI || MboI |DpnI BstKTI L V N N H L F Q F F V D L S K A V P K K L * I I I F F N F L L I * A K Q F L K R C K * S S F S I F C * S E Q S S S * K G ----:----|----:----|----:----|----:----|----:----|----:----| R T F L * R K * N K T S R L L A T G L F G Q L Y D D K E I K Q Q D S C L L E * F K Y I I M K K L K K N I Q A F C N R F L Hin6I |GlaI ||FatI ||HhaI |||CviAII AluI AluI |||| NspI CviJI CviJI |||| NlaIII | SetI | SetI |||| |TspEI TspRI \ \ \ \ \\\\ \\ \ GGTGGTATTGTAGCTTTTTTTCCAAGCTATCAGTATTTGGCGCATGTAATTCAGTGCTGG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCATAACATCGAAAAAAAGGTTCGATAGTCATAAACCGCGTACATTAAGTCACGACC / / / / /// // / / | CviJI | CviJI ||| || | TspEI | AluI | AluI ||| || TspRI SetI SetI ||| |FatI ||| CviAII ||NlaIII ||Hin6I ||NspI |GlaI HhaI G G I V A F F P S Y Q Y L A H V I Q C W V V L * L F F Q A I S I W R M * F S A G W Y C S F F S K L S V F G A C N S V L E ----:----|----:----|----:----|----:----|----:----|----:----| P P I T A K K G L * * Y K A C T I * H Q P H Y Q L K K E L S D T N P A H L E T S T T N Y S K K W A I L I Q R M Y N L A P MseI | MnlI | | MaeII | | | SetI XmnI SetI | | | TaiI |SspI \ \ \ \ \ \\ AAACAGAATGACAGGTTTGCTACATTAAATAACGTGAGGAAAATATTCTATGAAGCAAAA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGTCTTACTGTCCAAACGATGTAATTTATTGCACTCCTTTTATAAGATACTTCGTTTT / // / / // / SetI || | MaeII |SspI Hin4I || TaiI XmnI Hin4I || SetI |MnlI MseI K Q N D R F A T L N N V R K I F Y E A K N R M T G L L H * I T * G K Y S M K Q K T E * Q V C Y I K * R E E N I L * S K R ----:----|----:----|----:----|----:----|----:----|----:----| F C F S L N A V N F L T L F I N * S A F S V S H C T Q * M L Y R S S F I R H L L F L I V P K S C * I V H P F Y E I F C F BceAI | BtgZI | Hpy178III* | | Hpy188I | | |TfiI | | |HinfI Hin4I | | || Hin4I TsoI Hin4I | | || Hin4I | BsmAI | TspDTI | | || | MnlI Hin4II* | Eco31I \ \ \ \ \\ \ \ \ \ \ GACGGCGATGATATTCTATCTGGATATTCTGATTCGGTAGCAGAGGGAAGGGGGTCTCTT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCCGCTACTATAAGATAGACCTATAAGACTAAGCCATCGTCTCCCTTCCCCCAGAGAA / / / / // // / / TspDTI | | | || |MnlI Hin4II* TsoI | | | || HinfI | | | || TfiI | | | |Hpy188I | | | Hin4I | | | Hin4I | | BtgZI | Hpy178III* BceAI D G D D I L S G Y S D S V A E G R G S L T A M I F Y L D I L I R * Q R E G G L F R R * Y S I W I F * F G S R G K G V S F ----:----|----:----|----:----|----:----|----:----|----:----| S P S S I R D P Y E S E T A S P L P D R L R R H Y E I Q I N Q N P L L P F P T E V A I I N * R S I R I R Y C L S P P R K Cac8I TspEI ApoI | CviJI | MnlI Hpy188I TspEI Hpy178III* \ \ \ \ \ \ \ TTGCTGGCTATTGTTGGGGGAAAATTATCAGAGGGAATAAATTTTCAAGATGATTTATGT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AACGACCGATAACAACCCCCTTTTAATAGTCTCCCTTATTTAAAAGTTCTACTAAATACA / / / / / / / / | | CviJI | | Hpy188I | Hpy178III* | Cac8I | TspEI TspEI Eco31I MnlI ApoI BsmAI L L A I V G G K L S E G I N F Q D D L C C W L L L G E N Y Q R E * I F K M I Y V A G Y C W G K I I R G N K F S R * F M * ----:----|----:----|----:----|----:----|----:----|----:----| K S A I T P P F N D S P I F K * S S K H K A P * Q Q P F I I L P F L N E L H N I Q Q S N N P S F * * L S Y I K L I I * T AsuI* |BmgT120I ||CviJI CviJI ||HaeIII | BccI |||HphI | | BceAI ||||Cac8I SspI MseI \ \ \ \\\\\ \ \ AGGGCTGTGGTGATGGTGGGCCTGCCGTTCCCAAATATTTTTAGTGGAGAACTAATAGTT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCGACACCACTACCACCCGGACGGCAAGGGTTTATAAAAATCACCTCTTGATTATCAA / / / /// / | | BceAI ||Cac8I SspI | BccI |AsuI* CviJI BmgT120I HaeIII CviJI HphI R A V V M V G L P F P N I F S G E L I V G L W * W W A C R S Q I F L V E N * * L G C G D G G P A V P K Y F * W R T N S * ----:----|----:----|----:----|----:----|----:----|----:----| L A T T I T P R G N G F I K L P S S I T Y P Q P S P P G A T G L Y K * H L V L L P S H H H H A Q R E W I N K T S F * Y N EciI HindIII CfrI | AluI | CviJI | CviJI | HaeIII | | SetI | |AciI AciI | | |MboII | |BisI | Ksp632I* | | |TspGWI | ||BlsI | |MnlI | | ||BsiI* | |||TauI | ||TspDTI | | ||Hpy178III* \ \\\\ \ \\\ \ \ \\\ AAAAGGAAGCATTTGGCCGCTAAAATAATGAAGTCAGGCGGAACGGAAGAGGAAGCTTCA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCCTTCGTAAACCGGCGATTTTATTACTTCAGTCCGCCTTGCCTTCTCCTTCGAAGT / //// // / / / //// MseI |||AciI || | | | |||MwoI ||CfrI || | | | ||HindIII ||BisI || | | | ||MboII |BlsI || | | | |TspGWI HaeIII || | | | CviJI CviJI || | | | AluI TauI || | | SetI || | EciI || Ksp632I* |TspDTI |MnlI AciI K R K H L A A K I M K S G G T E E E A S K G S I W P L K * * S Q A E R K R K L H K E A F G R * N N E V R R N G R G S F T ----:----|----:----|----:----|----:----|----:----|----:----| L L F C K A A L I I F D P P V S S S A E * F S A N P R * F L S T L R F P L P L K F P L M Q G S F Y H L * A S R F L F S * MmeI | AluI | CviJI | | SetI | | | HindII | | | Hpy166II | | | | TspDTI | | | | | BstXI BdaI | | | | | | BdaI BdaI | | | | | | BdaI MwoI | SspI | | | | | | | MaeII \ \ \ \ \ \ \ \ \ \ \ CGAGCAACAAAGGAGTTTATGGAGAATATTTGTATGAAAGCTGTCAACCAAAGTGTTGGA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| GCTCGTTGTTTCCTCAAATACCTCTTATAAACATACTTTCGACAGTTGGTTTCACAACCT / / / / / / / / / / / / | BsiI* BdaI SspI | | | | | | | TaiI Hpy178III* BdaI | | | | | | | SetI | | | | | | BdaI | | | | | | BdaI | | | | | BstXI | | | | TspDTI | | | Hpy166II | | | HindII | | CviJI | | AluI | SetI MmeI R A T K E F M E N I C M K A V N Q S V G E Q Q R S L W R I F V * K L S T K V L D S N K G V Y G E Y L Y E S C Q P K C W T ----:----|----:----|----:----|----:----|----:----|----:----| R A V F S N I S F I Q I F A T L W L T P V L L L P T * P S Y K Y S L Q * G F H Q S C C L L K H L I N T H F S D V L T N S FatI |CviAII ||Cac8I ||| SphI ||| NspI BtrI ||| CviRI* | SetI ||| NlaIII TaqI | TaiI ||| |MslI BceAI | MwoI \ \ \\\ \\ \ \ \ CGTGCTATACGGCATGCAAATGATTACGCAAACATTTACTTGCTCGATGTGCGATATAAT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| GCACGATATGCCGTACGTTTACTAATGCGTTTGTAAATGAACGAGCTACACGCTATATTA // / //// / // |MaeII | |||MslI BceAI |TaqI BtrI | ||CviRI* MwoI | ||FatI | |CviAII | Cac8I NlaIII NspI SphI R A I R H A N D Y A N I Y L L D V R Y N V L Y G M Q M I T Q T F T C S M C D I I C Y T A C K * L R K H L L A R C A I * * ----:----|----:----|----:----|----:----|----:----|----:----| R A I R C A F S * A F M * K S S T R Y L V H * V A H L H N R L C K S A R H A I Y T S Y P M C I I V C V N V Q E I H S I I AsuI* |CviJI |HaeIII |BmgT120I || TspEI || | BetI* || | BsiYI* || | BspMII* || | |HpaII || | |Hpy178III* || | || TspEI || | || | TaqII || | || | | MaeIII || | || | | Tsp45I || | || | | | MaeII CviRI* || | || | | | | SetI | TfiI || | || | | | | TaiI | HinfI TspEI Hpy188I \\ \ \\ \ \ \ \ \ \ \ \ \ AGGCCCAATTTCCGGAAAAAATTGTCACGTTGGGTGCAAGATTCTATCAATTCCGAACAT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TCCGGGTTAAAGGCCTTTTTTAACAGTGCAACCCACGTTCTAAGATAGTTAAGGCTTGTA /// / / // / / / // / / // ||| | | || | | | |MaeII CviRI* HinfI |Hpy188I ||| | | || | | | Tsp45I TfiI TspEI ||| | | || | | | MaeIII ||| | | || | | TaiI ||| | | || | | SetI ||| | | || | TspEI ||| | | || TaqII ||| | | |BspMII* ||| | | |BetI* ||| | | Hpy178III* ||| | | HpaII ||| | TspEI ||| BsiYI* ||AsuI* |BmgT120I HaeIII CviJI R P N F R K K L S R W V Q D S I N S E H G P I S G K N C H V G C K I L S I P N I A Q F P E K I V T L G A R F Y Q F R T Y ----:----|----:----|----:----|----:----|----:----|----:----| L G L K R F F N D R Q T C S E I L E S C Y A W N G S F I T V N P A L N * * N R V P G I E P F F Q * T P H L I R D I G F M TspGWI | Hin6I | |GlaI | |MstI* | ||TseI | ||HhaI | |||BisI | ||||BlsI | |||||CviJI | |||||| ApoI | |||||| TspEI MboII | |||||| EcoRI | SetI | |||||| | BbvI \ \ \ \\\\\\ \ \ ACAACACATCAGGTCATTTCTTCAACACGGAAGTTTTTTTCAATGCGCAGCCTGAATTCA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTGTGTAGTCCAGTAAAGAAGTTGTGCCTTCAAAAAAAGTTACGCGTCGGACTTAAGT / / ////// / MboII | |||||CviJI EcoRI SetI | |||||TseI TspEI | ||||BisI ApoI | |||BlsI | ||Hin6I | |MstI* | |GlaI | HhaI TspGWI T T H Q V I S S T R K F F S M R S L N S Q H I R S F L Q H G S F F Q C A A * I H N T S G H F F N T E V F F N A Q P E F T ----:----|----:----|----:----|----:----|----:----|----:----| V V C * T M E E V R F N K E I R L R F E Y L V D P * K K L V S T K K L A C G S N C C M L D N R * C P L K K * H A A Q I * CGCTAA ----:- GCGATT / BbvI R * A X L X ----:- R * V S A L # Enzymes that cut Frequency Isoschizomers AarI 1 AatII 1 AbsI 1 AccI 1 FblI,XmiI AciI 6 BspACI,SsiI AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AhaIII* 1 DraI AluI 10 AluBI AlwNI 1 CaiI ApoI 12 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 1 BpuEI BceAI 3 BdaI 4 BetI* 1 BsaWI BfiI 2 BmrI,BmuI BglII 1 BinI* 3 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 1 BmgT120I 4 Bpu10I 2 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 7 BseRI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 4 BsmFI,FaqI BsmAI 4 Alw26I,BstMAI BspCNI 7 BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 4 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 6 BstXI 1 BtgZI 2 BtrI 1 BmgBI,AjiI Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CviAII 8 CviJI 23 CviKI-1 CviRI* 6 HpyCH4V DdeI 9 BstDEI,HpyF3I DpnI 6 MalI DraII 1 EcoO109I EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 2 EcoRI 1 EcoRII 4 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 2 FatI 8 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 GlaI 4 HaeII 1 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 4 BstHHI,CfoI,AspLEI Hin4I 6 Hin4II* 5 HpyAV Hin6I 4 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 9 HpaII 2 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 7 Hpy8I Hpy178III* 10 Hpy188III Hpy188I 17 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 6 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 13 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 3 SchI MmeI 2 MnlI 17 MseI 14 Tru1I,Tru9I MslI 3 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 2 HpyF10VI,BstMWI NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspI 4 BstNSI,XceI PasI 1 PflMI 1 BasI,AccB7I,Van91I PfoI 1 PleI 3 PpsI PpiI 1 PpuMI 1 Psp5II,PspPPI PsiI 1 AanI PspXI 1 PvuI 1 MvrI,Ple19I,BpvUI RsaI 4 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 5 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 36 SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SgfI 1 RgaI,SfaAI,AsiSI SmlI 2 SmoI SphI 1 PaeI,BbuI SplI* 1 Pfl23II,PspLI,BsiWI SspI 4 TaiI 7 TaqI 8 TaqII 1 TatI 2 TauI 1 TfiI 6 PfeI TseI 2 ApeKI TsoI 2 Tsp45I 2 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 9 TspEI 33 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 3 TscAI Tth111I 2 PflFI,PsyI,AspI VspI 2 PshBI,AseI XbaI 1 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut Acc65I AclI AflII AgeI AjuI AlfI AloI ApaI ApaLI AscI Asp718I AvrII BaeI BalI BamHI BarI BbvCI BcgI BciVI BclI BglI BmtI BplI BsaXI BsePI BseSI BseYI BsgI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspOI BsrBI BsrDI BstAPI BstEII BtsI Cfr10I Cfr9I CspCI DinI DraIII DrdI DsaI* Eam1105I Ecl136II Eco47III EcoICRI EcoNI EcoP15I EcoRV EgeI EheI Esp3I EspI* FseI FspAI GsaI GsuI HgiAI* HgiJII* HpaI Hpy99I KasI KpnI MauBI MfeI MluI MroNI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NspBII* OliI PacI PmaCI PmeI PshAI PspOMI PsrI PstI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SduI SexAI SfiI SfoI SgrAI SgrDI SmaI SnaBI SpeI SrfI Sse232I* Sse8387I StuI StyI SwaI TspMI TstI XcmI XmaCI XmaI XmaIII* # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769