Restriction Map of SOG2/YOR353C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SOG2/YOR353C on chromosome XV from coordinates 1000828 to 998453.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.16182

EMBOSS_001 BinI* MaeII EcoP15I | SetI | TaiI | | MboI | | BamHI | | XhoII | | Hin4II* | | | DpnI Hin4I | | | NlaIV Hin4I | | | |MnlI | Hin4I MnlI | | | |BstKTI | Hin4I MboII |Hin4I | | | || Hpy188I | | FokI | MmeI |Hin4I | | | || | BinI* | | | Cac8I \ \ \\ \ \ \ \\ \ \ \ \ \ \ ATGGTAGCGACATCTTCAAAGAGGACGTTGGATCCGAAGGAGGAACATTTGCCTGCTGAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCATCGCTGTAGAAGTTTCTCCTGCAACCTAGGCTTCCTCCTTGTAAACGGACGACTG / / / / / // / // / / / / / / | | | MnlI | || | || | | | Hin4I | FokI | | Hin4I | || | || | | | Hin4I Cac8I | | Hin4I | || | || | | Hin4I | MmeI | || | || | | Hin4I MboII | || | || | BinI* | || | || Hpy188I | || | || XhoII | || | || BamHI | || | || MboI | || | |NlaIV | || | |DpnI | || | |MnlI | || | BstKTI | || Hin4II* | |EcoP15I | |MaeII | BinI* TaiI SetI M V A T S S K R T L D P K E E H L P A D W * R H L Q R G R W I R R R N I C L L T G S D I F K E D V G S E G G T F A C * Q ----:----|----:----|----:----|----:----|----:----|----:----| X T A V D E F L V N S G F S S C K G A S X P L S M K L S S T P D S P P V N A Q Q H Y R C R * L P R Q I R L L F M Q R S V Hin4I Hin4I | BseMII DdeI BseGI TspEI | |BspCNI |Hpy188I \ \ \ \\ \\ AAAACATCCACTAATTCAAGCAACACTATAATATCTGAGTTGGCAACACAAGAGAAATCC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGTAGGTGATTAAGTTCGTTGTGATATTATAGACTCAACCGTTGTGTTCTCTTTAGG / / // / / / BseGI Hin4I |BspCNI | DdeI SetI Hin4I BseMII Hpy188I TspEI K T S T N S S N T I I S E L A T Q E K S K H P L I Q A T L * Y L S W Q H K R N P N I H * F K Q H Y N I * V G N T R E I Q ----:----|----:----|----:----|----:----|----:----|----:----| L V D V L E L L V I I D S N A V C S F D C F M W * N L C C * L I Q T P L V L S I F C G S I * A V S Y Y R L Q C C L L F G AluI AluI CviJI TspEI CviJI | SetI Csp6I | MseI | SetI | |MaeI |RsaI | VspI | | MseI Hpy188I \ \\ \\ \ \ \ \ \ \ AGCTCTAGTGGTACTACACTAAAATTAATAGCTCTTAATATCAAGTCCATATCAGATGAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAGATCACCATGATGTGATTTTAATTATCGAGAATTATAGTTCAGGTATAGTCTACTT / / // // / / / / | MaeI |Csp6I || | CviJI MseI Hpy188I CviJI RsaI || | AluI AluI || SetI |VspI |MseI TspEI S S S G T T L K L I A L N I K S I S D E A L V V L H * N * * L L I S S P Y Q M K L * W Y Y T K I N S S * Y Q V H I R * R ----:----|----:----|----:----|----:----|----:----|----:----| L E L P V V S F N I A R L I L D M D S S W S * H Y * V L I L L E * Y * T W I L H A R T T S C * F * Y S K I D L G Y * I F Tsp4CI* FalI | MseI FalI MboII FalI | | TstI | MseI |TspDTI FalI | | | FokI | | BseGI \\ \ \ \ \ \ \ \ \ GATGTGGGATATATCCAAAATGTTGAAAGACTGTCTTTAAGGAAAAATCACTTAACATCC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTACACCCTATATAGGTTTTACAACTTTCTGACAGAAATTCCTTTTTAGTGAATTGTAGG / / / / / // // | FalI | | MseI |FokI |MseI | FalI | TstI FalI BseGI TspDTI Tsp4CI* FalI MboII D V G Y I Q N V E R L S L R K N H L T S M W D I S K M L K D C L * G K I T * H P C G I Y P K C * K T V F K E K S L N I L ----:----|----:----|----:----|----:----|----:----|----:----| S T P Y I W F T S L S D K L F F * K V D L H P I Y G F H Q F V T K L S F D S L M I H S I D L I N F S Q R * P F I V * C G TseI MnlI CviJI |TstI |BisI || Hpy178III* ||BlsI Hpy178III* || | BbvI SetI |||CviRI* | CviRI* TspEI \\ \ \ \ \\\\ \ \ \ TTACCAGCGAGTTTCAAGAGGTTATCAAGGCTGCAATATCTGGATTTGCATAATAACAAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AATGGTCGCTCAAAGTTCTCCAATAGTTCCGACGTTATAGACCTAAACGTATTATTGTTA / / // / //// / / | MnlI || BbvI |||CviRI* | CviRI* TstI |SetI |||TseI Hpy178III* Hpy178III* ||BisI |BlsI CviJI L P A S F K R L S R L Q Y L D L H N N N Y Q R V S R G Y Q G C N I W I C I I T I T S E F Q E V I K A A I S G F A * * Q F ----:----|----:----|----:----|----:----|----:----|----:----| K G A L K L L N D L S C Y R S K C L L L R V L S N * S T I L A A I D P N A Y Y C * W R T E L P * * P Q L I Q I Q M I V I Hin4I |MboI |MnlI |BglII |XhoII || DpnI || |BstKTI || || MboI || || XhoII Hin4I || || | DpnI MseI Hin4I || || | |BstKTI |AhaIII* |TspEI || || | || BinI* \\ \\ \\ \\ \ \\ \ TTTAAAGAAATCCCATATATTTTGACACAATGCCCTCAATTAGAGATCTTGGATCTGTCC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTTCTTTAGGGTATATAAAACTGTGTTACGGGAGTTAATCTCTAGAACCTAGACAGG / // / / / / // / // / / | |MseI Hin4I | | | || | || | BinI* | AhaIII* Hin4I | | | || | || XhoII TspEI | | | || | || MboI | | | || | |DpnI | | | || | BstKTI | | | || XhoII | | | || BglII | | | || MboI | | | |DpnI | | | BstKTI | | MnlI | TspEI Hin4I F K E I P Y I L T Q C P Q L E I L D L S L K K S H I F * H N A L N * R S W I C P * R N P I Y F D T M P S I R D L G S V L ----:----|----:----|----:----|----:----|----:----|----:----| K L S I G Y I K V C H G * N S I K S R D N * L F G M Y K S V I G E I L S R P D T K F F D W I N Q C L A R L * L D Q I Q G Hin4I Hin4I |Hin4I Hin4I |Hin4I Hin4I |MnlI |BsrDI TspDTI Hin4I SspI \\ \\ \ \ \ TCCAATGAGATTGAAGCATTGCCAGATGAAATATCATCGTTTTGGCAAGATAATATTCGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTACTCTAACTTCGTAACGGTCTACTTTATAGTAGCAAAACCGTTCTATTATAAGCA / / // / / / / | | || BsrDI | Hin4I SspI | | |Hin4I | Hin4I | | |Hin4I TspDTI | | Hin4I | MnlI Hin4I Hin4I S N E I E A L P D E I S S F W Q D N I R P M R L K H C Q M K Y H R F G K I I F V Q * D * S I A R * N I I V L A R * Y S C ----:----|----:----|----:----|----:----|----:----|----:----| E L S I S A N G S S I D D N Q C S L I R R W H S Q L M A L H F I M T K A L Y Y E G I L N F C Q W I F Y * R K P L I I N T AclI MaeII |MaeIII || SetI || TaiI || | MaeI || | | BdaI || | | BdaI || | | | MaeII TaqI || | | | |BsaAI ClaI || | | | |SnaBI |MboI || | | | || SetI || DpnI || | | | || TaiI || |BstKTI || | | | || TspEI || || TspEI \\ \ \ \ \\ \ \\ \\ \ GTATTATCATTGAAAGACAACAACGTTACTAGCATACGTAATTTGAAATCGATCACAAAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CATAATAGTAACTTTCTGTTGTTGCAATGATCGTATGCATTAAACTTTAGCTAGTGTTTT / / / / / // / // / // | | | | | || TspEI || MboI |BspCNI | | | | | |MaeII |DpnI BseMII | | | | | SnaBI BstKTI | | | | | BsaAI ClaI | | | | TaiI TaqI | | | | SetI | | | MaeI | | | BdaI | | | BdaI | | MaeIII | MaeII | AclI TaiI SetI V L S L K D N N V T S I R N L K S I T K Y Y H * K T T T L L A Y V I * N R S Q N I I I E R Q Q R Y * H T * F E I D H K I ----:----|----:----|----:----|----:----|----:----|----:----| T N D N F S L L T V L M R L K F D I V F H I I M S L C C R * * C V Y N S I S * L Y * * Q F V V V N S A Y T I Q F R D C F MseI BseMII |BspCNI || BdaI || BdaI || | AluI AluI || | CviJI CviJI || | |DdeI | SetI || | |EspI* MnlI FalI SapI | | BplI || | ||SetI | SfaNI FalI Ksp632I* | | BplI \\ \ \\\ \ \ \ \ \ \ \ TTAAACAAGCTGAGCATCTTGGATTTAGAGGATAATAAAATACCCAAAGAAGAGCTTGAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTGTTCGACTCGTAGAACCTAAATCTCCTATTATTTTATGGGTTTCTTCTCGAACTG // / / / / / / / / / // / || | | | EspI* MnlI SfaNI FalI | | |BplI MboII || | | | DdeI FalI | | |BplI || | | CviJI | | CviJI || | | AluI | | AluI || | SetI | SetI || BdaI Ksp632I* || BdaI SapI |MseI TspEI L N K L S I L D L E D N K I P K E E L D * T S * A S W I * R I I K Y P K K S L T K Q A E H L G F R G * * N T Q R R A * P ----:----|----:----|----:----|----:----|----:----|----:----| N F L S L M K S K S S L L I G L S S S S I L C A S C R P N L P Y Y F V W L L A Q * V L Q A D Q I * L I I F Y G F F L K V MboII FalI | TatI FalI BplI MboII | |Csp6I | TspDTI BplI |MfeI | ||RsaI | | FokI BseGI SfaNI SspI |TspEI \ \\\ \ \ \ \ \ \ \\ CAAGTACAGAGTTATACTCCATTTCATACGGGCATCCCCAAAGAAGAATATTGGGCAATT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCATGTCTCAATATGAGGTAAAGTATGCCCGTAGGGGTTTCTTCTTATAACCCGTTAA /// / / / / / / / / ||| TspDTI | | BseGI | SspI MboII TspEI ||TatI | BplI SfaNI MfeI |Csp6I | BplI FalI FokI FalI RsaI Q V Q S Y T P F H T G I P K E E Y W A I K Y R V I L H F I R A S P K K N I G Q L S T E L Y S I S Y G H P Q R R I L G N C ----:----|----:----|----:----|----:----|----:----|----:----| W T C L * V G N * V P M G L S S Y Q A I G L V S N Y E M E Y P C G W L L I N P L L Y L T I S W K M R A D G F F F I P C N MboI | DpnI EcoRV | |BseGI SetI | Hpy178III* | |BstKTI | SetI XbaI | | FokI | || GsuI | | Hpy178III* |MaeI | | | EcoRV | || Eco57MI | | | SetI |Hpy178III* \ \ \ \ \ \\ \ \ \ \ \ \\ GCGATATCACGATATCTAAAAGATCATCCTAACCTACCTACTCCAGAACCTAAAATATCT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CGCTATAGTGCTATAGATTTTCTAGTAGGATTGGATGGATGAGGTCTTGGATTTTATAGA / / / / //// / / / / | | | FokI |||MboI | SetI | SetI | | EcoRV ||| SetI Hpy178III* | Hpy178III* ||Eco57MI EcoRV ||GsuI |DpnI BstKTI BseGI A I S R Y L K D H P N L P T P E P K I S R Y H D I * K I I L T Y L L Q N L K Y L D I T I S K R S S * P T Y S R T * N I * ----:----|----:----|----:----|----:----|----:----|----:----| A I D R Y R F S * G L R G V G S G L I D Q S I V I D L L D D * G V * E L V * F I R Y * S I * F I M R V * R S W F R F Y R TspDTI TseI | BbvI |BisI | | TfiI ||BlsI | | HinfI BsrDI \\\ \ \ \ \ AGAGCAGCGAAAAGAATGGGATTCATAAATACGAACTTGTCTAATGGAGCAATGAATGAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCGTCGCTTTTCTTACCCTAAGTATTTATGCTTGAACAGATTACCTCGTTACTTACTT // /// / / / / || ||| TspDTI | HinfI BsrDI || ||TseI | TfiI || |BisI BbvI || BlsI |XbaI Hpy178III* MaeI R A A K R M G F I N T N L S N G A M N E E Q R K E W D S * I R T C L M E Q * M K S S E K N G I H K Y E L V * W S N E * K ----:----|----:----|----:----|----:----|----:----|----:----| L A A F L I P N M F V F K D L P A I F S * L L S F F P I * L Y S S T * H L L S H S C R F S H S E Y I R V Q R I S C H I F CviRI* | MwoI TspDTI | BstAPI |TspEI MwoI | | SfaNI || TspDTI | CviRI* | | CviRI* \\ \ \ \ \ \ \ AACAATATAATTTCACTTGCCCCAAGTGCAAATACAACTATAAGTGCATCTACTGCAATG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTATATTAAAGTGAACGGGGTTCACGTTTATGTTGATATTCACGTAGATGACGTTAC / / / / / / / / // | | TspEI MwoI CviRI* | | | |BsrDI | TspDTI | | | SfaNI TspDTI | | CviRI* | BstAPI | MwoI CviRI* N N I I S L A P S A N T T I S A S T A M T I * F H L P Q V Q I Q L * V H L L Q W Q Y N F T C P K C K Y N Y K C I Y C N G ----:----|----:----|----:----|----:----|----:----|----:----| F L I I E S A G L A F V V I L A D V A I F C Y L K V Q G L H L Y L * L H M * Q L V I Y N * K G W T C I C S Y T C R S C H Csp6I |RsaI |TspRI || Tsp4CI* || | CviRI* BsrDI SetI || | | TfiI | BsmAI | CviRI* || | | HinfI | Eco31I | | MnlI || | | | Hpy188I \ \ \ \ \ \\ \ \ \ \ GTCTCATCTAATCAAACCTCTGCAACATCTTTCAGTGGTACAGTCAATGCAGAATCAGAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAGTAGATTAGTTTGGAGACGTTGTAGAAAGTCACCATGTCAGTTACGTCTTAGTCTT / / / / / /// / // | SetI | | TspRI ||Tsp4CI* | |Hpy188I Eco31I | MnlI |Csp6I | HinfI BsmAI CviRI* RsaI | TfiI CviRI* V S S N Q T S A T S F S G T V N A E S E S H L I K P L Q H L S V V Q S M Q N Q N L I * S N L C N I F Q W Y S Q C R I R T ----:----|----:----|----:----|----:----|----:----|----:----| T E D L * V E A V D K L P V T L A S D S P R M * D F R Q L M K * H Y L * H L I L D * R I L G R C C R E T T C D I C F * F BtsI TspRI | Csp6I MnlI | |RsaI TspGWI | Hpy178III* \ \\ \ \ \ CAAAGTGGGGCAGTGAATGGTACGGAACTATACAATCACACCAAATATAATGACTACTTC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCACCCCGTCACTTACCATGCCTTGATATGTTAGTGTGGTTTATATTACTGATGAAG / / // / / TspRI BtsI |Csp6I TspGWI MnlI RsaI Q S G A V N G T E L Y N H T K Y N D Y F K V G Q * M V R N Y T I T P N I M T T S K W G S E W Y G T I Q S H Q I * * L L Q ----:----|----:----|----:----|----:----|----:----|----:----| C L P A T F P V S S Y L * V L Y L S * K V F H P L S H Y P V I C D C W I Y H S S L T P C H I T R F * V I V G F I I V V E PleI |MlyI FatI SetI Ksp632I* |MboII |CviAII | TaqI | HinfI |MaeIII SfaNI ||Cac8I \ \ \ \ \\ \ \\\ AAGAGGTTGTCGATTTTACCAGAAGAGTCAATGAGTAACGGGCATCAAAAAATATCGCAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTCCAACAGCTAAAATGGTCTTCTCAGTTACTCATTGCCCGTAGTTTTTTATAGCGTA // / / / // / / / // |SetI TaqI | | |PleI MaeIII | | |CviAII Hpy178III* | | |MlyI | | Cac8I | | MboII | | MmeI | HinfI | NlaIII Ksp632I* | NspI | SphI SfaNI K R L S I L P E E S M S N G H Q K I S H R G C R F Y Q K S Q * V T G I K K Y R M E V V D F T R R V N E * R A S K N I A C ----:----|----:----|----:----|----:----|----:----|----:----| L L N D I K G S S D I L L P C * F I D C * S T T S K V L L T L S Y R A D F F I A L P Q R N * W F L * H T V P M L F Y R M MmeI SphI Hpy188I NspI | AluI AluI CviRI* | CviJI CviJI NlaIII | | SetI BsmI | SetI \ \ \ \ \ \ \ GCAGAGTTGGTTGTTTCCTGTCGGAAGCTCCTATTTAGTTTTACAGAATGCCAACAAGCT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCTCAACCAACAAAGGACAGCCTTCGAGGATAAATCAAAATGTCTTACGGTTGTTCGA / / / / / / / CviRI* | | CviJI BsmI | CviJI FatI | | AluI | AluI | SetI SetI Hpy188I A E L V V S C R K L L F S F T E C Q Q A Q S W L F P V G S S Y L V L Q N A N K L R V G C F L S E A P I * F Y R M P T S Y ----:----|----:----|----:----|----:----|----:----|----:----| A S N T T E Q R F S R N L K V S H W C A H L T P Q K R D S A G I * N * L I G V L C L Q N N G T P L E * K T K C F A L L S CviJI BceAI HaeIII | MnlI | AciI Hpy188I | Hin4II* | | MseI \ \ \ \ \ \ ATCAGAAAAATCGCCTCTTTCTGTAAAGAGAAGGCCGTAGCGGTTAATGTAGTATCATTA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTCTTTTTAGCGGAGAAAGACATTTCTCTTCCGGCATCGCCAATTACATCATAGTAAT / / / / / / Hpy188I | Hin4II* HaeIII | MseI | MnlI CviJI AciI BceAI I R K I A S F C K E K A V A V N V V S L S E K S P L S V K R R P * R L M * Y H Y Q K N R L F L * R E G R S G * C S I I I ----:----|----:----|----:----|----:----|----:----|----:----| I L F I A E K Q L S F A T A T L T T D N * * F F R R K R Y L S P R L P * H L I M D S F D G R E T F L L G Y R N I Y Y * * SetI MboI | TseI Hpy188I | CviRI* | DpnI | |BisI | |BstKTI MnlI | ||BlsI BbvI \ \\ \ \ \\\ \ TTATACTCTGTCAGATCACATACTGATAATCTGGTGGAGGTCTTGCAGCAAACAGAGAAC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AATATGAGACAGTCTAGTGTATGACTATTAGACCACCTCCAGAACGTCGTTTGTCTCTTG / // / / / //// | || MboI MnlI SetI |||TseI | |DpnI ||BisI | BstKTI |BlsI Hpy188I CviRI* L Y S V R S H T D N L V E V L Q Q T E N Y T L S D H I L I I W W R S C S K Q R T I L C Q I T Y * * S G G G L A A N R E R ----:----|----:----|----:----|----:----|----:----|----:----| N Y E T L D C V S L R T S T K C C V S F I I S Q * I V Y Q Y D P P P R A A F L S * V R D S * M S I I Q H L D Q L L C L V TfiI HinfI |BbvII* || FatI || |MboII || |CviAII || || MboI || || BclI ApoI || || |NlaIII AluI TspEI || || ||DpnI CviJI | MseI || || |||BstKTI MseI | SetI MnlI | |AhaIII* \\ \\ \\\\ \ \ \ \ \ \\ GAAGACGAATCGCATGATCAGGCGTTAATCAAGCTGTGCCTCACTATCATCACAAATTTT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTGCTTAGCGTACTAGTCCGCAATTAGTTCGACACGGAGTGATAGTAGTGTTTAAAA / / / /// / / / / / / / BbvI | | ||| BclI | | CviJI MnlI | AhaIII* | | ||| MboI | | AluI TspEI | | ||DpnI | SetI ApoI | | |BstKTI MseI | | |FatI | | CviAII | BbvII* | NlaIII | MboII HinfI TfiI E D E S H D Q A L I K L C L T I I T N F K T N R M I R R * S S C A S L S S Q I L R R I A * S G V N Q A V P H Y H H K F * ----:----|----:----|----:----|----:----|----:----|----:----| S S S D C S * A N I L S H R V I M V F K R L R I A H D P T L * A T G * * * * L N F V F R M I L R * D L Q A E S D D C I K MboI TspDTI | DpnI TspEI ApoI | BbvII* | PsiI TspEI | |BstKTI \ \ \ \ \\ AAACAAATTATAACATTGTTGAGAAAAAATTTTGAGATTTTTTTCAAAGAAGACGATCTA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGTTTAATATTGTAACAACTCTTTTTTAAAACTCTAAAAAAAGTTTCTTCTGCTAGAT / // / / // / / MseI |PsiI TspEI | || | BbvII* TspEI ApoI | || | MboII | || MboI | |DpnI | BstKTI TspDTI K Q I I T L L R K N F E I F F K E D D L N K L * H C * E K I L R F F S K K T I Y T N Y N I V E K K F * D F F Q R R R S M ----:----|----:----|----:----|----:----|----:----|----:----| L C I I V N N L F F K S I K K L S S S R * V F * L M T S F F N Q S K K * L L R D F L N Y C Q Q S F I K L N K E F F V I * FokI FatI | MseI CviRI* | VspI |CviAII MboII MslI BseGI | | MslI ||EcoT22I \ \ \ \ \ \ \\\ TGCTTCATAAGGATGTTTTATATGACATTAATGTGTGCTTATATGGAAATGTATAATGCA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| ACGAAGTATTCCTACAAAATATACTGTAATTACACACGAATATACCTTTACATATTACGT / / / / / / MslI BseGI | MslI | CviRI* | VspI | NlaIII | MseI EcoT22I FokI C F I R M F Y M T L M C A Y M E M Y N A A S * G C F I * H * C V L I W K C I M H L H K D V L Y D I N V C L Y G N V * C M ----:----|----:----|----:----|----:----|----:----|----:----| H K M L I N * I V N I H A * I S I Y L A I S * L S T K Y S M L T H K Y P F T Y H A E Y P H K I H C * H T S I H F H I I C MboI BclI CviRI* | DpnI | Hin4I | |BstKTI | Hin4I | || MboII | |MwoI Hin4I | || | BetI* | || HgiCI* NlaIII Hin4I | || | |HpaII | || | NlaIV \ \ \ \\ \ \\ \ \\ \ \ TGGTCTTTTATCAAAGAAGATGATCAAGTGTCCGGTTCTGCAAGTAAGGCACCCAAGAAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| ACCAGAAAATAGTTTCTTCTACTAGTTCACAGGCCAAGACGTTCATTCCGTGGGTTCTTT // / // / / // / / / / |FatI Hin4I || | MboII || | MwoI | HgiCI* CviAII Hin4I || BclI || CviRI* NlaIV || MboI || Hin4I |DpnI || Hin4I BstKTI |BetI* HpaII W S F I K E D D Q V S G S A S K A P K K G L L S K K M I K C P V L Q V R H P R N V F Y Q R R * S S V R F C K * G T Q E T ----:----|----:----|----:----|----:----|----:----|----:----| H D K I L S S S * T D P E A L L A G L F M T K * * L L H D L T R N Q L Y P V W S P R K D F F I I L H G T R C T L C G L F AsuI* AvaII DraII PpuMI MnlI |BmgT120I |TaqII ||NlaIV || TaqI ||| AciI || Hin4I Hin4I ||| | TseI || | BsmAI Tth111I |MnlI ||| | |BisI || | | BsiI* | BsrI ||AciI ||| | ||BlsI \\ \ \ \ \ \ \\\ \\\ \ \\\ CATTCTTTTTCGAGGCACGAGACATCGTCCAGTAGTATCACAAGCGGTGGAGGACCCGCA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAGAAAAAGCTCCGTGCTCTGTAGCAGGTCATCATAGTGTTCGCCACCTCCTGGGCGT // / / / / / / / / // /// |Hin4I TaqI | | | BsrI | | AciI || ||BisI TaqII | | Tth111I | MnlI || |BlsI MnlI | BsiI* Hin4I || AciI BsmAI |PpuMI |DraII |AvaII |AsuI* BmgT120I NlaIV H S F S R H E T S S S S I T S G G G P A I L F R G T R H R P V V S Q A V E D P Q F F F E A R D I V Q * Y H K R W R T R S ----:----|----:----|----:----|----:----|----:----|----:----| C E K E L C S V D D L L I V L P P P G A V N K K S A R S M T W Y Y * L R H L V R M R K R P V L C R G T T D C A T S S G C FauI | Csp6I | |RsaI | || BbvI | || |BsrI | || || TatI | || || |Csp6I | || || ||RsaI | || || |||Hpy166II AciI TspEI \ \\ \\ \\\\ \ \ GCAAGTACGACCAGTACACATTGTAGCGGAAACATAAAATTACTGCCGAAAACAAGGAGC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTCATGCTGGTCATGTGTAACATCGCCTTTGTATTTTAATGACGGCTTTTGTTCCTCG / /// / //// / / / | ||| BsrI |||TatI AciI TspEI HgiAI* | ||Csp6I ||Hpy166II SduI | |RsaI ||Csp6I | FauI |RsaI TseI BbvI A S T T S T H C S G N I K L L P K T R S Q V R P V H I V A E T * N Y C R K Q G A K Y D Q Y T L * R K H K I T A E N K E H ----:----|----:----|----:----|----:----|----:----|----:----| A L V V L V C Q L P F M F N S G F V L L L L Y S W Y V N Y R F C L I V A S F L S C T R G T C M T A S V Y F * Q R F C P A CviRI* | BccI | | BsrDI SduI | | CviRI* Hpy188I HgiAI* | | | SfaNI EcoP15I SspI | TstI BtsI \ \ \ \ \ \ \ \ \ \ ACAAGAACACCATCTGCATCTGCATTGCTTTCAAATAGTAATATTCTGACGGGTGATACC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTCTTGTGGTAGACGTAGACGTAACGAAAGTTTATCATTATAAGACTGCCCACTATGG / // / / / / / / | || CviRI* SfaNI | | Hpy188I TspRI | |BsrDI | | TstI BtsI | BccI | SspI CviRI* EcoP15I T R T P S A S A L L S N S N I L T G D T Q E H H L H L H C F Q I V I F * R V I P K N T I C I C I A F K * * Y S D G * Y H ----:----|----:----|----:----|----:----|----:----|----:----| V L V G D A D A N S E F L L I R V P S V C L F V M Q M Q M A K L Y Y Y E S P H Y C S C W R C R C Q K * I T I N Q R T I G TstI | ApaLI | | CviRI* | | Hpy166II | | | SduI | | | BseSI | | | HgiAI* | | | | MslI | | | | |FatI | | | | |NcoI | | | | |StyI | | | | |SecI* | | | | |DsaI* | | | | ||CviAII | | | | ||| AsuI* | | | | ||| AvaII | | | | ||| NlaIII | | | | ||| |BmgT120I HphI | | | | ||| || TspEI | TspRI MnlI | | | | ||| || | TaqII | | HphI | TstI | | | | ||| || | BsiYI* \ \ \ \ \ \ \ \ \ \\\ \\ \ \ ACTGCTGTTCCTCTTTTATCACCAAATCTAAATGGTGCACACACCCATGGTCCAATTTTG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TGACGACAAGGAGAAAATAGTGGTTTAGATTTACCACGTGTGTGGGTACCAGGTTAAAAC / / // / / / / // // // /// / HphI HphI |MnlI TstI | | | || || || ||| TstI TstI | | | || || || ||TspEI | | | || || || |TaqII | | | || || || BsiYI* | | | || || |AvaII | | | || || |AsuI* | | | || || BmgT120I | | | || |DsaI* | | | || |SecI* | | | || |StyI | | | || |NcoI | | | || |FatI | | | || CviAII | | | |NlaIII | | | MslI | | ApaLI | Hpy166II | CviRI* HgiAI* BseSI SduI T A V P L L S P N L N G A H T H G P I L L L F L F Y H Q I * M V H T P M V Q F W C C S S F I T K S K W C T H P W S N F G ----:----|----:----|----:----|----:----|----:----|----:----| V A T G R K D G F R F P A C V W P G I K W Q Q E E K I V L D L H H V C G H D L K S S N R K * * W I * I T C V G M T W N Q FatI TstI CviRI* |CviAII | MslI |BslFI BsrDI || NlaIII TspDTI \ \ \\ \ \\ \ \ GGACACCAAAATGCAATAAGCAATGGAAGTTCTCAAACGAACATGAATGAAGTAAAAACT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CCTGTGGTTTTACGTTATTCGTTACCTTCAAGAGTTTGCTTGTACTTACTTCATTTTTGA / / / / / // / / MslI | BslFI BsrDI | |FatI | TspDTI CviRI* | CviAII TspDTI NlaIII G H Q N A I S N G S S Q T N M N E V K T D T K M Q * A M E V L K R T * M K * K L T P K C N K Q W K F S N E H E * S K N Y ----:----|----:----|----:----|----:----|----:----|----:----| P C W F A I L L P L E * V F M F S T F V P V G F H L L C H F N E F S C S H L L F S V L I C Y A I S T R L R V H I F Y F S TseI AluI MwoI CviJI PvuII BstAPI NspBII* TfiI BbvI |TstI BccI | StyI |BisI HinfI | SecI* ||BlsI | TaqI MaeI | Eco57I ||SetI | AsuII TspDTI | Eco57MI ||| MwoI | | TstI \ \ \ \\\ \ \ \ \ ACTAGCGATACTATTCCAAGGCAACAGCTGCTTCAGCACAATAAATCCATCAGCGATTCG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TGATCGCTATGATAAGGTTCCGTTGTCGACGAAGTCGTGTTATTTAGGTAGTCGCTAAGC / / / / /// //// // / / MaeI | | | ||| |||MwoI || | AsuII | | | ||| |||TseI || | TaqI | | | ||| ||BisI || HinfI | | | ||| |BlsI || TfiI | | | ||| NspBII* |BccI | | | ||| PvuII TstI | | | ||| CviJI | | | ||| AluI | | | ||SetI | | | |BstAPI | | | |MwoI | | | TstI | | SecI* | | StyI | BbvI Eco57MI Eco57I T S D T I P R Q Q L L Q H N K S I S D S L A I L F Q G N S C F S T I N P S A I R * R Y Y S K A T A A S A Q * I H Q R F E ----:----|----:----|----:----|----:----|----:----|----:----| V L S V I G L C C S S * C L L D M L S E * * R Y * E L A V A A E A C Y I W * R N S A I S N W P L L Q K L V I F G D A I R PleI |MlyI |Hin6I ||GlaI |||FatI BseGI |||HhaI | TspDTI ||||CviAII | |BetI* HinfI |||||FokI | ||HpaII |MaeIII |||||| NlaIII | ||| MboII TspEI |Tsp45I |||||| | SetI | ||| |SfaNI | MseI \\ \\\\\\ \ \ \ \\\ \\ \ \ AAAAAAGAGTCACAGGCGCATGAACCTAAACAGCATCCGGTTATGACTTCTTCAATAATT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTCTCAGTGTCCGCGTACTTGGATTTGTCGTAGGCCAATACTGAAGAAGTTATTAA / / /// //// / / // / / | | ||| |||FokI | | |BetI* SfaNI TspEI | | ||| ||SetI | | |MboII | | ||| |FatI | | HpaII | | ||| CviAII | TspDTI | | ||NlaIII BseGI | | ||Hin6I | | |GlaI | | PleI | | MlyI | | HhaI | Tsp45I | MaeIII HinfI K K E S Q A H E P K Q H P V M T S S I I K K S H R R M N L N S I R L * L L Q * L K R V T G A * T * T A S G Y D F F N N * ----:----|----:----|----:----|----:----|----:----|----:----| F F S D C A C S G L C C G T I V E E I I S F L T V P A H V * V A D P * S K K L L F F L * L R M F R F L M R N H S R * Y N MaeII | SetI | TaiI | |Hpy178III* | ||TaqI | ||| BsmAI | ||| Esp3I SfaNI | ||| | MseI BsiYI* \ \ \\\ \ \ \ AACGCATCAAATAGTAATAACGTCTCGAATGTTAATATAACCCCACCACCGATGAATGGT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCGTAGTTTATCATTATTGCAGAGCTTACAATTATATTGGGGTGGTGGCTACTTACCA / / / / // / / / MseI | | | || | MseI BsiYI* | | | || Esp3I | | | || BsmAI | | | |TaqI | | | Hpy178III* | | MaeII | TaiI | SetI SfaNI N A S N S N N V S N V N I T P P P M N G T H Q I V I T S R M L I * P H H R * M V R I K * * * R L E C * Y N P T T D E W W ----:----|----:----|----:----|----:----|----:----|----:----| L A D F L L L T E F T L I V G G G I F P * R M L Y Y Y R R S H * Y L G V V S S H V C * I T I V D R I N I Y G W W R H I T HgiCI* | NlaIV | |TspDTI | ||AciI | ||BisI | |||BlsI | ||||TauI | ||||FnuDII* | ||||| Tsp4CI* BsmAI SspI Tsp4CI* \ \\\\\ \ \ \ \ GGTGGTGCCGCGAACAGTAGTGCTAATGTAGTGGAGACAAATATTGACATTCAACTGTAT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCACGGCGCTTGTCATCACGATTACATCACCTCTGTTTATAACTGTAAGTTGACATA ////// / / / / |||||| Tsp4CI* BsmAI SspI Tsp4CI* |||||FnuDII* |||||AciI ||||BisI |||HgiCI* |||BlsI ||TauI |NlaIV TspDTI G G A A N S S A N V V E T N I D I Q L Y V V P R T V V L M * W R Q I L T F N C I W C R E Q * C * C S G D K Y * H S T V S ----:----|----:----|----:----|----:----|----:----|----:----| P P A A F L L A L T T S V F I S M * S Y H H H R S C Y H * H L P S L Y Q C E V T T T G R V T T S I Y H L C I N V N L Q I Eco57I Eco57MI AclI | BsrI MaeII | | MseI | SetI | | |HpaI | TaiI | | |HindII | | Hpy166II | | |Hpy166II | | | Tsp4CI* | | || Hpy188I | | | | MseI |HphI | || |TsoI \ \ \ \ \ \\ \ \\ \\ CAAACGTTGTCCACAGTAGTTAAAATGGTGAGCGTTGTATATAACCAGTTAACTTCAGAG 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTGCAACAGGTGTCATCAATTTTACCACTCGCAACATATATTGGTCAATTGAAGTCTC / / / / / / / / // / | | | Tsp4CI* MseI | HphI BsrI |MseI Hpy188I | | Hpy166II Eco57MI | TsoI | MaeII Eco57I Hpy166II | AclI HindII TaiI HpaI SetI Q T L S T V V K M V S V V Y N Q L T S E K R C P Q * L K W * A L Y I T S * L Q R N V V H S S * N G E R C I * P V N F R D ----:----|----:----|----:----|----:----|----:----|----:----| * V N D V T T L I T L T T Y L W N V E S D F T T W L L * F P S R Q I Y G T L K L L R Q G C Y N F H H A N Y I V L * S * L CviJI |BsrDI || NheI || |MaeI || ||Cac8I || ||| BmtI || ||| | FatI || ||| | NcoI || ||| | StyI || ||| | SecI* HinfI || ||| | DsaI* ApoI | NheI || ||| | |TsoI TspEI | |MaeI || ||| | |CviAII | MlyI | ||Cac8I EcoRV || ||| | || NlaIII | PleI | ||| BmtI \ \\ \\\ \ \\ \ \ \ \ \\\ \ ATATCCAAGATAGCCATTGCTAGCACCATGGGAAAGCAAATTTTGACGGACTCGCTAGCA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TATAGGTTCTATCGGTAACGATCGTGGTACCCTTTCGTTTAAAACTGCCTGAGCGATCGT / // / /// // // /// / / //// EcoRV |CviJI | ||| || |DsaI* ||PleI | | |||TspGWI BsrDI | ||| || |SecI* |MlyI | | |||SetI | ||| || |StyI TspEI | | ||NheI | ||| || |NcoI ApoI | | |MaeI | ||| || |FatI | | Cac8I | ||| || CviAII | BmtI | ||| |NlaIII HinfI | ||| TsoI | ||NheI | |MaeI | Cac8I BmtI I S K I A I A S T M G K Q I L T D S L A Y P R * P L L A P W E S K F * R T R * H I Q D S H C * H H G K A N F D G L A S T ----:----|----:----|----:----|----:----|----:----|----:----| I D L I A M A L V M P F C I K V S E S A S I W S L W Q * C W P F A F K S P S A L Y G L Y G N S A G H S L L N Q R V R * C FatI AflIII BspLU11I* TspGWI |CviAII | SetI || NspI | | ApoI || NlaIII BtgZI | | TspEI || | BccI | MfeI | | | Hpy178III* || | |TspGWI | TspEI \ \ \ \ \\ \ \\ \ \ CCTAAAATTCGTGATTTGACGGAAACATGTCGTCAAGCGATGGATTTATCCAAACAATTG 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GGATTTTAAGCACTAAACTGCCTTTGTACAGCAGTTCGCTACCTAAATAGGTTTGTTAAC / / / // / / / / | Hpy178III* | || | BccI | TspEI TspEI | || TspGWI | MfeI ApoI | |BspLU11I* BtgZI | |AflIII | |FatI | CviAII NlaIII NspI P K I R D L T E T C R Q A M D L S K Q L L K F V I * R K H V V K R W I Y P N N * * N S * F D G N M S S S D G F I Q T I E ----:----|----:----|----:----|----:----|----:----|----:----| G L I R S K V S V H R * A I S K D L C N V * F E H N S P F M D D L S P N I W V I R F N T I Q R F C T T L R H I * G F L Q TfiI TspDTI HinfI MseI | MseI | ApoI SetI | VspI | TspEI Hpy188I Hpy188I \ \ \ \ \ \ \ AATGAAAGGTTAAATGTATTAATACCGAACGATTCAAATTCAGAGAAGTATCTGACATCT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTTCCAATTTACATAATTATGGCTTGCTAAGTTTAAGTCTCTTCATAGACTGTAGA / / / / / // / SetI | | VspI HinfI |Hpy188I Hpy188I | | MseI TfiI TspEI | TspDTI ApoI MseI N E R L N V L I P N D S N S E K Y L T S M K G * M Y * Y R T I Q I Q R S I * H L * K V K C I N T E R F K F R E V S D I F ----:----|----:----|----:----|----:----|----:----|----:----| F S L N F T N I G F S E F E S F Y R V D S H F T L H I L V S R N L N L S T D S M I F P * I Y * Y R V I * I * L L I Q C R ApoI AluI MaeII TspEI CviJI | SetI EcoRI MseI TsoI | SetI | TaiI | XmnI | TspDTI | TspEI \ \ \ \ \ \ \ \ \ \ TTGGAGAAGCTGAAAACGTGGGAGATAATGAATTCGTTCTTAAAAGTAATAATATCAATT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTCTTCGACTTTTGCACCCTCTATTACTTAAGCAAGAATTTTCATTATTATAGTTAA / / / / / // / / | CviJI | MaeII EcoRI |MseI TsoI TspEI | AluI TaiI TspEI TspDTI SetI SetI XmnI ApoI L E K L K T W E I M N S F L K V I I S I W R S * K R G R * * I R S * K * * Y Q F G E A E N V G D N E F V L K S N N I N S ----:----|----:----|----:----|----:----|----:----|----:----| K S F S F V H S I I F E N K F T I I D I K P S A S F T P S L S N T R L L L L I L Q L L Q F R P L Y H I R E * F Y Y Y * N MaeII |BtrI ||Hpy99I |||SetI |||TaiI |||| TspEI |||| | BseMII |||| | |BspCNI |||| | || BsmAI |||| | || Eco31I |||| | || | AluI |||| | || | CviJI |||| | || | |DdeI CviJI |||| | || | ||SetI SetI \ \\\\ \ \\ \ \\\ \ CTGGCTAATACTAAAATCGTAATGAGCGACGTGCCTAATTTGAATGAGCTGAGACCTAAC 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| GACCGATTATGATTTTAGCATTACTCGCTGCACGGATTAAACTTACTCGACTCTGGATTG / / / // /// / // // / CviJI | | |MaeII ||TspEI | || |SetI SetI | | BtrI |BspCNI | || DdeI | TaiI BseMII | |Eco31I | SetI | |BsmAI Hpy99I | CviJI | AluI SetI L A N T K I V M S D V P N L N E L R P N W L I L K S * * A T C L I * M S * D L T G * Y * N R N E R R A * F E * A E T * P ----:----|----:----|----:----|----:----|----:----|----:----| R A L V L I T I L S T G L K F S S L G L E P * Y * F R L S R R A * N S H A S V * Q S I S F D Y H A V H R I Q I L Q S R V StyI SecI* | MboII | | MaeIII | | Tsp45I | | | BseGI | | | | Tsp4CI* | | | | | TspRI MaeI | | | | | |FokI |SetI BglI | | | | | || TspDTI || CviJI MwoI TsoI | | | | | || | SmlI \\ \ \ \ \ \ \ \ \ \\ \ \ CTAGCCAACTTGGCGAAGATTACCAAGGATGTCACTGTGATATTGGACTTGAGTTCATAC 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| GATCGGTTGAACCGCTTCTAATGGTTCCTACAGTGACACTATAACCTGAACTCAAGTATG // / / // // / / / / || MwoI TsoI || || | | FokI SmlI || BglI || || | TspDTI |CviJI || || Tsp4CI* MaeI || || Tsp45I || || MaeIII || |BseGI || TspRI |SecI* |StyI MboII L A N L A K I T K D V T V I L D L S S Y * P T W R R L P R M S L * Y W T * V H T S Q L G E D Y Q G C H C D I G L E F I Q ----:----|----:----|----:----|----:----|----:----|----:----| R A L K A F I V L S T V T I N S K L E Y G L W S P S S * W P H * Q S I P S S N M * G V Q R L N G L I D S H Y Q V Q T * V Hin6I BetI* |GlaI BspMII* CviJI ||HhaI |HpaII | Bce83I* |||HaeII |Hpy178III* \ \ \\\\ \\ AAGGCTGTATCAGTAAGCGCCAACTCTCCGGAGTAA 2350 2360 2370 ----:----|----:----|----:----|----:- TTCCGACATAGTCATTCGCGGTTGAGAGGCCTCATT / / //// // | Bce83I* |||Hin6I |BspMII* CviJI ||GlaI |BetI* |HhaI Hpy178III* HaeII HpaII K A V S V S A N S P E * R L Y Q * A P T L R S X G C I S K R Q L S G V X ----:----|----:----|----:----|----:- L A T D T L A L E G S Y C P Q I L L R W S E P T L S Y * Y A G V R R L L # Enzymes that cut Frequency Isoschizomers AciI 5 BspACI,SsiI AclI 2 Psp1406I AflIII 1 AhaIII* 2 DraI AluI 10 AluBI ApaLI 1 Alw44I,VneI ApoI 6 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BamHI 1 BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 1 BpuEI BceAI 1 BclI 2 FbaI,Ksp22I BdaI 2 BetI* 3 BsaWI BglI 1 BglII 1 BinI* 3 AlwI,BspPI,AclWI BisI 6 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 6 BmgT120I 2 BmtI 2 BspOI BplI 2 BsaAI 1 BstBAI,Ppu21I BseGI 7 BstF5I,BtsCI BseMII 3 BseSI 1 BaeGI,BstSLI BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 5 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 3 BspLU11I* 1 PscI,PciI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 6 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BstAPI 2 BstKTI 9 BtgZI 1 BtrI 1 BmgBI,AjiI BtsI 2 Cac8I 4 BstC8I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 6 CviQI,RsaNI CviAII 8 CviJI 16 CviKI-1 CviRI* 15 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 9 MalI DraII 1 EcoO109I DsaI* 2 BtgI,BstDSI Eco31I 2 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 3 EcoP15I 2 EcoRI 1 EcoRV 3 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 4 FatI 8 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 7 GlaI 2 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 12 Hin4II* 2 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HinfI 8 HpaI 1 KspAI HpaII 3 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 11 Hpy99I 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 7 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 4 MboI 9 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 10 MfeI 2 MunI MlyI 3 SchI MmeI 2 MnlI 14 MseI 17 Tru1I,Tru9I MslI 4 RseI,SmiMI MwoI 6 HpyF10VI,BstMWI NcoI 2 Bsp19I NheI 2 AsuNHI NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 2 BstNSI,XceI PleI 3 PpsI PpuMI 1 Psp5II,PspPPI PsiI 1 AanI PvuII 1 RsaI 6 AfaI SapI 1 LguI,PciSI,BspQI SduI 2 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 29 SfaNI 7 LweI SmlI 1 SmoI SnaBI 1 Eco105I,BstSNI SphI 1 PaeI,BbuI SspI 4 StyI 4 Eco130I,EcoT14I,ErhI,BssT1I TaiI 7 TaqI 5 TaqII 2 TatI 2 TauI 1 TfiI 5 PfeI TseI 5 ApeKI TsoI 4 Tsp45I 2 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 14 TspEI 21 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 4 TscAI TstI 4 Tth111I 1 PflFI,PsyI,AspI VspI 3 PshBI,AseI XbaI 1 XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AgeI AjuI AlfI AloI AlwNI ApaI AscI Asp718I AvaI AvrII BaeI BalI BarI BbvCI BcgI BciVI BfiI BmeT110I Bpu10I BsaBI BsaXI BseBI BsePI BseRI BseYI BsgI Bsp120I Bsp1407I BspHI BspMI BsrBI BssKI BssNAI Bst1107I Bst2UI BstEII BstNI BstOI BstSCI BstXI BstZ17I CauII* Cfr10I Cfr9I CfrI CspCI DinI DraIII DrdI Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoRII EgeI EheI FseI FspAI GsaI HgaI HgiJII* HindIII KasI KpnI MauBI McrI* MluI MroNI MstI* MvaI NaeI NarI NdeI NgoMIV NmeAIII NotI NruI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PshAI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SauI* ScaI ScrFI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SplI* SrfI Sse232I* Sse8387I StuI StyD4I SwaI TspMI XcmI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769