Restriction Map of YOR335W-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YOR335W-A on chromosome XV from coordinates 946568 to 946648.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.13550

TaqI AsuII | MboII | BbvII* BsmI | | TspDTI Hpy178III* \ \ \ \ \ ATGGAGCATTCTCATTGGTTTCGAAAAATGTCTTCACTTCATCAAGAGTTTGTTTGTTTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTCGTAAGAGTAACCAAAGCTTTTTACAGAAGTGAAGTAGTTCTCAAACAAACAAAA / // // / BsmI || |BbvII* Hpy178III* || TspDTI |AsuII |TaqI MboII M E H S H W F R K M S S L H Q E F V C F W S I L I G F E K C L H F I K S L F V F G A F S L V S K N V F T S S R V C L F S ----:----|----:----|----:----|----:----|----:----|----:----| X S C E * Q N R F I D E S * * S N T Q K X P A N E N T E F F T K V E D L T Q K N H L M R M P K S F H R * K M L L K N T K AsuI* |CviJI |HaeIII |BmgT120I MseI \\ \ CTTTTTTGGCCCTTGACTTAA 70 80 ----:----|----:----|- GAAAAAACCGGGAACTGAATT /// / ||AsuI* MseI |BmgT120I HaeIII CviJI L F W P L T * F F G P * L X F L A L D L X ----:----|----:----|- R K Q G K V * E K K A R S K K K P G Q S L # Enzymes that cut Frequency Isoschizomers AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BmgT120I 1 BsmI 1 BsaMI,Mva1269I,PctI CviJI 1 CviKI-1 HaeIII 1 BsnI,BsuRI,BshFI,PhoI Hpy178III* 1 Hpy188III MboII 1 MseI 1 Tru1I,Tru9I TaqI 1 TspDTI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AciI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AluI AlwNI ApaI ApaLI ApoI AscI Asp718I AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvI BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BisI BlsI BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviAII CviQI CviRI* DdeI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FatI FauI Fnu4HI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin4II* Hin6I HindII HindIII HinfI HinP1I HpaI HpaII HphI Hpy166II Hpy188I Hpy8I Hpy99I HspAI KasI KpnI Ksp632I* MaeI MaeII MaeIII MauBI MboI McrI* MfeI MluI MlyI MmeI MnlI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SecI* SetI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaiI TaqII TatI TauI TfiI TseI TsoI Tsp45I Tsp4CI* TspEI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769