Restriction Map of YOR329W-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YOR329W-A on chromosome XV from coordinates 939348 to 939557.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.17230

TaqI | CviJI MaeIII | | Cac8I | FatI | | | CviRI* DdeI | |CviAII | | | | MboI | AluI | || NlaIII | | | | | DpnI | CviJI | || | ApoI | | | | | |BsrDI | |SfaNI | || | TspEI | | | | | |BstKTI | ||SetI \ \\ \ \ \ \ \ \ \ \\ \ \\\ ATGTTTCGTTACCATGTAAAATTTATCGAGCCTGCAATGATCTATAAAATCTTAGCTAAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAAAGCAATGGTACATTTTAAATAGCTCGGACGTTACTAGATATTTTAGAATCGATTG / // / / / / / // / /// / | |FatI | | | | | || MboI ||| SfaNI | CviAII | | | | | |DpnI ||CviJI MaeIII | | | | | BstKTI ||AluI NlaIII | | | | | BsrDI |DdeI | | | | CviRI* SetI | | | Cac8I | | CviJI | TaqI TspEI ApoI M F R Y H V K F I E P A M I Y K I L A N C F V T M * N L S S L Q * S I K S * L T V S L P C K I Y R A C N D L * N L S * R ----:----|----:----|----:----|----:----|----:----|----:----| X N R * W T F N I S G A I I * L I K A L X T E N G H L I * R A Q L S R Y F R L * H K T V M Y F K D L R C H D I F D * S V ApoI CviRI* ApoI TspEI | TspEI TspEI EcoRI | |MboII EcoRI | BslFI SetI \ \\ \ \ \ \ GAGAAGATGCAGATAATTTGGGTTTTGAATTCCTATTTTGAATTCTACCTTTTGTTTTGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTCTACGTCTATTAAACCCAAAACTTAAGGATAAAACTTAAGATGGAAAACAAAACA / / / / / / / | | TspEI EcoRI | | BslFI | MboII TspEI | SetI CviRI* ApoI EcoRI TspEI ApoI E K M Q I I W V L N S Y F E F Y L L F C R R C R * F G F * I P I L N S T F C F V E D A D N L G F E F L F * I L P F V L S ----:----|----:----|----:----|----:----|----:----|----:----| S F I C I I Q T K F E * K S N * R K N Q R S S A S L K P K S N R N Q I R G K T K L L H L Y N P N Q I G I K F E V K Q K T MseI |HpaI |HindII |Hpy166II \\ CCCCGTTTCCTAATGTTAACTCTTTTTCTAATAGGGGCAACTTACTTTTGTTTTCTCATT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGGGCAAAGGATTACAATTGAGAAAAAGATTATCCCCGTTGAATGAAAACAAAAGAGTAA // |MseI Hpy166II HindII HpaI P R F L M L T L F L I G A T Y F C F L I P V S * C * L F F * * G Q L T F V F S F P F P N V N S F S N R G N L L L F S H L ----:----|----:----|----:----|----:----|----:----|----:----| G R K R I N V R K R I P A V * K Q K R M D G N G L T L E K E L L P L K S K N E * G T E * H * S K K * Y P C S V K T K E N TGGCGAAAAAAAGTAAGTAGAAATAAATAA 190 200 210 ----:----|----:----|----:----| ACCGCTTTTTTTCATTCATCTTTATTTATT W R K K V S R N K * G E K K * V E I N X A K K S K * K * I X ----:----|----:----|----:----| Q R F F T L L F L Y K A F F L L Y F Y I P S F F Y T S I F L # Enzymes that cut Frequency Isoschizomers AluI 1 AluBI ApoI 3 AcsI,XapI BslFI 1 BsmFI,FaqI BsrDI 1 BseMI,Bse3DI BstKTI 1 Cac8I 1 BstC8I CviAII 1 CviJI 2 CviKI-1 CviRI* 2 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 1 MalI EcoRI 2 FatI 1 HindII 1 HincII HpaI 1 KspAI Hpy166II 1 Hpy8I MaeIII 1 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 1 MseI 1 Tru1I,Tru9I NlaIII 1 Hin1II,Hsp92II,FaeI SetI 2 SfaNI 1 LweI TaqI 1 TspEI 4 TasI,Tsp509I,Sse9I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AciI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BisI BlsI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseGI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BsmAI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI BtsI CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviQI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FauI Fnu4HI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin4II* Hin6I HindIII HinfI HinP1I HpaII HphI Hpy178III*Hpy188I Hpy99I HspAI KasI KpnI Ksp632I* MaeI MaeII MauBI McrI* MfeI MluI MlyI MmeI MnlI Mph1103I MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SecI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaiI TaqII TatI TauI TfiI TseI TsoI Tsp45I Tsp4CI* TspDTI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769