Restriction Map of MYO2/YOR326W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

MYO2/YOR326W on chromosome XV from coordinates 925721 to 930445.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.4087

SfaNI | Csp6I | |RsaI BciVI | ||Hpy166II | TspEI CviJI \ \\\ \ \ \ ATGTCTTTTGAAGTGGGTACACGATGCTGGTATCCCCATAAAGAATTGGGCTGGATTGGG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGAAAACTTCACCCATGTGCTACGACCATAGGGGTATTTCTTAACCCGACCTAACCC /// / / / ||Hpy166II BciVI | CviJI ||Csp6I TspEI |RsaI SfaNI M S F E V G T R C W Y P H K E L G W I G C L L K W V H D A G I P I K N W A G L G V F * S G Y T M L V S P * R I G L D W G ----:----|----:----|----:----|----:----|----:----|----:----| X D K S T P V R H Q Y G W L S N P Q I P X T K Q L P Y V I S T D G Y L I P S S Q H R K F H T C S A P I G M F F Q A P N P Hpy99I | Csp6I | |RsaI | || BssKI | || EcoRII | || | ScrFI | || | BseBI | || | |SetI | || | ||BceAI | || | ||| MaeIII | || | ||| | MfeI AciI EciI | || | ||| | TspEI \ \ \ \\ \ \\\ \ \ GCGGAAGTAATCAAAAATGAGTTCAACGACGGCAAGTACCACCTGGAGTTACAATTGGAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGCCTTCATTAGTTTTTACTCAAGTTGCTGCCGTTCATGGTGGACCTCAATGTTAACCTT / / / // / / // / / AciI EciI Hpy99I || | | || | TspEI || | | || | MfeI || | | || MaeIII || | | |BceAI || | | EcoRII || | | BssKI || | BseBI || | ScrFI || SetI |Csp6I RsaI A E V I K N E F N D G K Y H L E L Q L E R K * S K M S S T T A S T T W S Y N W K G S N Q K * V Q R R Q V P P G V T I G R ----:----|----:----|----:----|----:----|----:----|----:----| A S T I L F S N L S P L Y W R S N C N S P P L L * F H T * R R C T G G P T V I P R F Y D F I L E V V A L V V Q L * L Q F GsuI Eco57MI SecI* |BbvII* DsaI* AsuI* ||TspGWI | TspDTI AvaII ||| MboII | |Hpy166II |BmgT120I \\\ \ \ \\ \\ GACGATGAAATCGTGTCCGTGGACACAAAAGACTTGAATAACGATAAGGACCAATCTCTA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTACTTTAGCACAGGCACCTGTGTTTTCTGAACTTATTGCTATTCCTGGTTAGAGAT / / / / / // | | BbvII* | Hpy166II |AvaII | | MboII | DsaI* |AsuI* | TspGWI | SecI* BmgT120I Eco57MI TspDTI GsuI D D E I V S V D T K D L N N D K D Q S L T M K S C P W T Q K T * I T I R T N L Y R * N R V R G H K R L E * R * G P I S T ----:----|----:----|----:----|----:----|----:----|----:----| S S S I T D T S V F S K F L S L S W D R L R H F R T R P C L L S S Y R Y P G I E V I F D H G H V C F V Q I V I L V L R * SetI MboII AciI DdeI MnlI Hin4I TspGWI MnlI \ \ \ \ \ \ CCGCTTCTTAGAAACCCTCCCATTTTGGAAGCAACGGAAGATTTGACCTCTTTATCTTAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GGCGAAGAATCTTTGGGAGGGTAAAACCTTCGTTGCCTTCTAAACTGGAGAAATAGAATG / / // / // / / AciI DdeI |Hin4I | |MboII | Hin4I MnlI | TspGWI MnlI SetI P L L R N P P I L E A T E D L T S L S Y R F L E T L P F W K Q R K I * P L Y L T A S * K P S H F G S N G R F D L F I L L ----:----|----:----|----:----|----:----|----:----|----:----| G S R L F G G M K S A V S S K V E K D * V A E * F G E W K P L L P L N S R K I K R K K S V R G N Q F C R F I Q G R * R V CviJI | Cac8I BccI | | AluI | Hin6I | | CviJI FatI | |GlaI | | PvuII |CviAII | |Eco47III | | NspBII* || NspI | ||HhaI MfeI Hin4I | | | SetI || NlaIII | |||HaeII TspEI \ \ \ \ \ \\ \ \ \\\\ \ TTGAATGAGCCAGCTGTTTTACATGCCATCAAACAGCGCTATTCTCAATTGAATATCTAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTACTCGGTCGACAAAATGTACGGTAGTTTGTCGCGATAAGAGTTAACTTATAGATG / / / / // //// / | | NspBII* | |FatI |||Hin6I TspEI | | PvuII | CviAII ||Eco47III MfeI | | CviJI NlaIII ||GlaI | | AluI NspI |HhaI | Cac8I HaeII | SetI BccI CviJI L N E P A V L H A I K Q R Y S Q L N I Y * M S Q L F Y M P S N S A I L N * I S T E * A S C F T C H Q T A L F S I E Y L H ----:----|----:----|----:----|----:----|----:----|----:----| K F S G A T K C A M L C R * E * N F I * S S H A L Q K V H W * V A S N E I S Y R Q I L W S N * M G D F L A I R L Q I D V MboI | DpnI | |BstKTI | || SalI | || |TaqI | || |AccI | || ||HindII | || ||Hpy166II | || ||| AluI AvaI | || ||| CviJI |BmeT110I Hpy188I | || ||| | SetI \\ \ \ \\ \\\ \ \ ACATACTCGGGTATTGTTCTGATTGCTACAAACCCTTTTGATCGTGTCGACCAGCTTTAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGTATGAGCCCATAACAAGACTAACGATGTTTGGGAAAACTAGCACAGCTGGTCGAAATA // / // / /// / / |AvaI Hpy188I || MboI ||| | CviJI BmeT110I |DpnI ||| | AluI BstKTI ||| SetI ||SalI |AccI |TaqI Hpy166II HindII T Y S G I V L I A T N P F D R V D Q L Y H T R V L F * L L Q T L L I V S T S F I I L G Y C S D C Y K P F * S C R P A L Y ----:----|----:----|----:----|----:----|----:----|----:----| V Y E P I T R I A V F G K S R T S W S * C M S P Y Q E S Q * L G K Q D H R G A K C V R T N N Q N S C V R K I T D V L K I BinI* | FatI | |CviAII | || MboI | || |NlaIII SetI | || ||DpnI |Hpy166II | || |||BstKTI MnlI || BsrI | || |||| FauI | Hin6I || NlaIV | || |||| | NdeI | |GlaI || | HphI | || |||| | | AciI | ||HhaI || | | SetI \ \\ \\\\ \ \ \ \ \\\ \\ \ \ \ ACACAAGACATGATCCAAGCATATGCGGGAAAGCGCAGAGGTGAACTGGAACCTCACTTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGTTCTGTACTAGGTTCGTATACGCCCTTTCGCGTCTCCACTTGACCTTGGAGTGAAC // /// / / / / / /// / / / // || ||| MboI | | | | ||| SetI | | |HphI || ||DpnI | | | | ||Hin6I | | NlaIV || |BstKTI | | | | |GlaI | | SetI || |FatI | | | | HhaI | BsrI || CviAII | | | MnlI Hpy166II |NlaIII | | AciI BinI* | NdeI FauI T Q D M I Q A Y A G K R R G E L E P H L H K T * S K H M R E S A E V N W N L T C T R H D P S I C G K A Q R * T G T S L V ----:----|----:----|----:----|----:----|----:----|----:----| V C S M I W A Y A P F R L P S S S G * K Y V L C S G L M H P F A C L H V P V E S C L V H D L C I R S L A S T F Q F R V Q MnlI MboII | BsrDI MwoI | SetI TspDTI \ \ \ \ \ \ TTTGCCATTGCCGAAGAAGCGTATAGGTTGATGAAAAATGACAAACAAAATCAAACCATT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGGTAACGGCTTCTTCGCATATCCAACTACTTTTTACTGTTTGTTTTAGTTTGGTAA / / / / / | BsrDI MwoI MboII TspDTI MnlI SetI F A I A E E A Y R L M K N D K Q N Q T I L P L P K K R I G * * K M T N K I K P L C H C R R S V * V D E K * Q T K S N H C ----:----|----:----|----:----|----:----|----:----|----:----| N A M A S S A Y L N I F F S L C F * V M T Q W Q R L L T Y T S S F H C V F D F W K G N G F F R I P Q H F I V F L I L G N TfiI HinfI HphI Tsp4CI* \ \ \ GTGGTAAGTGGTGAATCTGGTGCTGGAAAAACGGTTTCTGCCAAGTATATTATGCGTTAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CACCATTCACCACTTAGACCACGACCTTTTTGCCAAAGACGGTTCATATAATACGCAATA / / / | HphI Tsp4CI* HinfI TfiI V V S G E S G A G K T V S A K Y I M R Y W * V V N L V L E K R F L P S I L C V I G K W * I W C W K N G F C Q V Y Y A L F ----:----|----:----|----:----|----:----|----:----|----:----| T T L P S D P A P F V T E A L Y I I R * Q P L H H I Q H Q F F P K Q W T Y * A N H Y T T F R T S S F R N R G L I N H T I TatI Tsp4CI* ApoI Bsp1407I SfeI* TspEI |Csp6I Ksp632I* | MboII ||MmeI |MnlI | |AciI ||RsaI Hpy188I \\ \ \\ \\\ \ TTTGCTTCTGTAGAAGAGGAAAATTCCGCTACTGTACAACATCAAGTGGAAATGTCGGAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGAAGACATCTTCTCCTTTTAAGGCGATGACATGTTGTAGTTCACCTTTACAGCCTT / // // / // /// / | |SfeI* || | || ||Bsp1407I Hpy188I | Ksp632I* || | || ||TatI MnlI || | || |Csp6I || | || RsaI || | |MmeI || | Tsp4CI* || AciI |TspEI |ApoI MboII F A S V E E E N S A T V Q H Q V E M S E L L L * K R K I P L L Y N I K W K C R K C F C R R G K F R Y C T T S S G N V G N ----:----|----:----|----:----|----:----|----:----|----:----| K A E T S S S F E A V T C C * T S I D S N Q K Q L L P F N R * Q V V D L P F T P K S R Y F L F I G S S Y L M L H F H R F TfiI HinfI | MaeI FatI | | AluI |CviAII | | CviJI |BsiYI* | | | SetI || NlaIII DdeI \ \ \ \ \\ \ \ ACAGAACAAAAGATTCTAGCTACAAACCCTATCATGGAAGCATTTGGTAATGCTAAGACT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCTTGTTTTCTAAGATCGATGTTTGGGATAGTACCTTCGTAAACCATTACGATTCTGA / /// / / // / | ||CviJI | | |FatI DdeI | ||AluI | | CviAII | |MaeI | NlaIII | SetI BsiYI* HinfI TfiI T E Q K I L A T N P I M E A F G N A K T Q N K R F * L Q T L S W K H L V M L R L R T K D S S Y K P Y H G S I W * C * D Y ----:----|----:----|----:----|----:----|----:----|----:----| V S C F I R A V F G I M S A N P L A L V F L V F S E L * L G * * P L M Q Y H * S C F L L N * S C V R D H F C K T I S L S XbaI |MaeI |Hpy178III* MboII || ApoI | TspEI Hpy178III* || TspEI TaqI \ \ \ \\ \ \ ACCAGAAATGACAATTCTTCCAGATTTGGTAAGTATCTAGAAATTTTATTCGATAAGGAC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTCTTTACTGTTAAGAAGGTCTAAACCATTCATAGATCTTTAAAATAAGCTATTCCTG / / / // / / / MboII TspEI Hpy178III* |XbaI TspEI TaqI Hin4I | ApoI Hpy178III* MaeI T R N D N S S R F G K Y L E I L F D K D P E M T I L P D L V S I * K F Y S I R T Q K * Q F F Q I W * V S R N F I R * G H ----:----|----:----|----:----|----:----|----:----|----:----| V L F S L E E L N P L Y R S I K N S L S * W F H C N K W I Q Y T D L F K I R Y P G S I V I R G S K T L I * F N * E I L V BinI* | MmeI | | MboI | | BamHI | | XhoII AsuI* | | | DpnI AvaII | | | NlaIV Tsp4CI* | | | |BstKTI |BmgT120I | | | ||AciI || Hpy178III* Hin4I | | | ||| BinI* Hin4I || | Hpy166II \ \ \ \ \\\ \ \ \\ \ \ ACATCTATTATTGGAGCAAGGATCCGCACATACTTGTTGGAACGGTCCAGATTAGTTTAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAGATAATAACCTCGTTCCTAGGCGTGTATGAACAACCTTGCCAGGTCTAATCAAATG // // / / / / / // / / || || | | | Hin4I | || | Hpy166II || || | | BinI* | || Hpy178III* || || | AciI | |AvaII || || XhoII | |AsuI* || || BamHI | BmgT120I || || MboI Tsp4CI* || |NlaIV || |DpnI || BstKTI |BinI* MmeI T S I I G A R I R T Y L L E R S R L V Y H L L L E Q G S A H T C W N G P D * F T I Y Y W S K D P H I L V G T V Q I S L P ----:----|----:----|----:----|----:----|----:----|----:----| V D I I P A L I R V Y K N S R D L N T * C M * * Q L L S G C M S T P V T W I L K C R N N S C P D A C V Q Q F P G S * N V CviJI |AciI |BisI ||BlsI |||TauI TspEI AluI |||| MfeI | MseI CviJI |||| TspEI | VspI CviJI | SetI \\\\ \ \ \ \ \ \ CAGCCGCCAATTGAGAGAAACTACCACATATTTTATCAATTAATGGCTGGATTACCAGCT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGGCGGTTAACTCTCTTTGATGGTGTATAAAATAGTTAATTACCGACCTAATGGTCGA //// / // / / / |||AciI TspEI || CviJI | CviJI ||BisI MfeI |VspI | AluI |BlsI |MseI SetI CviJI TspEI TauI Q P P I E R N Y H I F Y Q L M A G L P A S R Q L R E T T T Y F I N * W L D Y Q L A A N * E K L P H I L S I N G W I T S S ----:----|----:----|----:----|----:----|----:----|----:----| W G G I S L F * W M N * * N I A P N G A G A A L Q S F S G C I K D I L P Q I V L L R W N L S V V V Y K I L * H S S * W S DdeI | Hpy188I | | MnlI | | | BspCNI | | | |FatI | | | |BseMII | | | ||CviAII | | | ||| NlaIII MnlI TspEI | | | ||| | StyI | StyI | SfaNI | | | ||| | SecI* | SecI* | CviRI* SfaNI | | | ||| | | AciI \ \ \ \ \ \ \ \ \\\ \ \ \ CAAACCAAGGAGGAATTGCATCTTACCGATGCCTCAGATTACTTCTACATGAACCAAGGC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTGGTTCCTCCTTAACGTAGAATGGCTACGGAGTCTAATGAAGATGTACTTGGTTCCG / / // / / // / // / // / MnlI SecI* || SfaNI | |DdeI | || | |FatI SecI* StyI |CviRI* | | | || | CviAII StyI TspEI | | | || NlaIII | | | |BseMII | | | BspCNI | | MnlI | Hpy188I SfaNI Q T K E E L H L T D A S D Y F Y M N Q G K P R R N C I L P M P Q I T S T * T K A N Q G G I A S Y R C L R L L L H E P R R ----:----|----:----|----:----|----:----|----:----|----:----| * V L S S N C R V S A E S * K * M F W P E F W P P I A D * R H R L N S R C S G L L G L L F Q M K G I G * I V E V H V L A MboI | DpnI | HphI MmeI MaeIII | |BstKTI Tsp4CI* Tsp45I | || SfaNI TspEI | CviRI* | TspDTI | || |Tsp4CI* |SfaNI | | EcoT22I \ \ \ \\ \\ \\ \ \ \ GGTGACACCAAGATCAACGGTATTGATGATGCCAAAGAATACAAAATTACAGTAGATGCA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTGTGGTTCTAGTTGCCATAACTACTACGGTTTCTTATGTTTTAATGTCATCTACGT // / // / / / /// / / || | || | | SfaNI ||| | CviRI* || | || | Tsp4CI* ||| EcoT22I || | || MboI ||Tsp4CI* || | |DpnI |SfaNI || | BstKTI |MmeI || | HphI TspEI || Tsp45I || MaeIII |TspDTI AciI G D T K I N G I D D A K E Y K I T V D A V T P R S T V L M M P K N T K L Q * M H * H Q D Q R Y * * C Q R I Q N Y S R C I ----:----|----:----|----:----|----:----|----:----|----:----| P S V L I L P I S S A L S Y L I V T S A R H C W S * R Y Q H H W L I C F * L L H T V G L D V T N I I G F F V F N C Y I C SspI | MseI | | MboI | | BglII | | XhoII | | | DpnI | | | |BstKTI | | | || CfrI | | | || | CviJI PshAI | | | || | HaeIII | HphI | | | || | |AciI | | Hpy188I | | | || | |BisI | | |TfiI StyI | | | || | ||BlsI | | |HinfI SecI* | | | || | |||TauI \ \ \\ \ \ \ \ \\ \ \\\\ TTGACATTAGTCGGAATCACCAAGGAAACTCAACACCAAATATTTAAGATCTTGGCCGCA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AACTGTAATCAGCCTTAGTGGTTCCTTTGAGTTGTGGTTTATAAATTCTAGAACCGGCGT // / / / / / // / //// || | HinfI SecI* SspI | || | |||AciI || | TfiI StyI | || | ||CfrI || Hpy188I | || | ||BisI |HphI | || | |BlsI PshAI | || | HaeIII | || | CviJI | || | TauI | || XhoII | || BglII | || MboI | |DpnI | BstKTI MseI L T L V G I T K E T Q H Q I F K I L A A * H * S E S P R K L N T K Y L R S W P H D I S R N H Q G N S T P N I * D L G R T ----:----|----:----|----:----|----:----|----:----|----:----| N V N T P I V L S V * C W I N L I K A A M S M L R F * W P F E V G F I * S R P R Q C * D S D G L F S L V L Y K L D Q G C CviRI* | EcoT22I | | SfaNI | | | AluI | | | CviJI | | | PvuII TspEI SfaNI | | | NspBII* CviRI* MaeIII | MseI | MaeI | | | | SetI \ \ \ \ \ \ \ \ \ \ \ CTTCTGCATATCGGTAACATAGAAATTAAAAAAACTAGAAATGATGCATCACTATCAGCT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGACGTATAGCCATTGTATCTTTAATTTTTTTGATCTTTACTACGTAGTGATAGTCGA / / // / / / / // CviRI* MaeIII |MseI SfaNI | CviRI* | |SfaNI TspEI MaeI EcoT22I | NspBII* | PvuII | CviJI | AluI SetI L L H I G N I E I K K T R N D A S L S A F C I S V T * K L K K L E M M H H Y Q L S A Y R * H R N * K N * K * C I T I S * ----:----|----:----|----:----|----:----|----:----|----:----| S R C I P L M S I L F V L F S A D S D A V E A Y R Y C L F * F F * F H H M V I L K Q M D T V Y F N F F S S I I C * * * S SetI | BsiYI* | | BsrI | | |Cac8I | | || TspEI | | || | SfaNI | | || | BseYI | | || | | GsaI CviJI | | || | | |TspEI HphI \ \ \ \\ \ \ \\ \ GATGAGCCAAACCTGAAACTGGCGTGCGAATTGCTGGGAATTGATGCCTACAACTTTGCC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTCGGTTTGGACTTTGACCGCACGCTTAACGACCCTTAACTACGGATGTTGAAACGG / / / / / // / / / | SetI | | Cac8I || | TspEI HphI CviJI | BsrI || BseYI BsiYI* || SfaNI |GsaI TspEI D E P N L K L A C E L L G I D A Y N F A M S Q T * N W R A N C W E L M P T T L P * A K P E T G V R I A G N * C L Q L C Q ----:----|----:----|----:----|----:----|----:----|----:----| S S G F R F S A H S N S P I S A * L K A Q H A L G S V P T R I A P F Q H R C S Q I L W V Q F Q R A F Q Q S N I G V V K G TaqI MaeIII MboI SetI AsuII Tsp45I | DpnI | Hpy188I | TfiI BstEII | |BstKTI | | TspEI | HinfI TspEI \ \ \\ \ \ \ \ \ \ AAATGGGTCACCAAAAAGCAGATCATTACAAGGTCAGAGAAAATTGTTTCGAATCTAAAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTTACCCAGTGGTTTTTCGTCTAGTAATGTTCCAGTCTCTTTTAACAAAGCTTAGATTTA / // / / / / / / BstEII || MboI SetI Hpy188I TspEI | HinfI Tsp45I |DpnI | TfiI MaeIII BstKTI AsuII TaqI K W V T K K Q I I T R S E K I V S N L N N G S P K S R S L Q G Q R K L F R I * I M G H Q K A D H Y K V R E N C F E S K L ----:----|----:----|----:----|----:----|----:----|----:----| L H T V L F C I M V L D S F I T E F R F W I P * W F A S * * L T L S F Q K S D L F P D G F L L D N C P * L F N N R I * I AluI CviJI | SetI | | MwoI | | | TspGWI | | | | TsoI | | | | | TfiI | | | | | HinfI | | | | | | XcmI | | | | | | | SecI* | | | | | | | DsaI* | | | | | | | | CviJI | | | | | | | | |DdeI | | | | | | | | || EciI AciI TaqI \ \ \ \ \ \ \ \ \\ \ \ \ TATAGTCAAGCTCTGGTTGCCAAAGATTCCGTGGCTAAGTTTATTTATTCCGCCCTTTTC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| ATATCAGTTCGAGACCAACGGTTTCTAAGGCACCGATTCAAATAAATAAGGCGGGAAAAG / / / / / / / / // // / TspEI | | | | TsoI | | || |DdeI AciI | | | TspGWI | | || EciI | | MwoI | | |CviJI | CviJI | | DsaI* | AluI | | SecI* SetI | HinfI | TfiI XcmI Y S Q A L V A K D S V A K F I Y S A L F I V K L W L P K I P W L S L F I P P F S * S S S G C Q R F R G * V Y L F R P F R ----:----|----:----|----:----|----:----|----:----|----:----| * L * A R T A L S E T A L N I * E A R K N Y D L E P Q W L N R P * T * K N R G K I T L S Q N G F I G H S L K N I G G K E CviRI* | BssKI | | HpaII | | ScrFI | | CauII* | | | CviJI | | | | Hpy166II CviJI Tsp4CI* | | | | | TspEI \ \ \ \ \ \ \ \ GATTGGCTTGTGGAAAATATCAACACCGTGTTATGCAACCCGGCTGTGAACGACCAAATT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CTAACCGAACACCTTTTATAGTTGTGGCACAATACGTTGGGCCGACACTTGCTGGTTTAA / / / / /// / / TaqI CviJI Tsp4CI* | ||| Hpy166II TspEI | ||BssKI SetI | ||CviJI | |HpaII | CauII* | ScrFI CviRI* D W L V E N I N T V L C N P A V N D Q I I G L W K I S T P C Y A T R L * T T K L L A C G K Y Q H R V M Q P G C E R P N * ----:----|----:----|----:----|----:----|----:----|----:----| S Q S T S F I L V T N H L G A T F S W I R N A Q P F Y * C R T I C G P Q S R G F I P K H F I D V G H * A V R S H V V L N AluI CviJI ApoI | SetI Hpy178III* TspDTI TspEI \ \ \ \ \ AGCTCATTTATTGGTGTTCTGGATATTTATGGGTTTGAACATTTTGAAAAAAATTCATTT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAGTAAATAACCACAAGACCTATAAATACCCAAACTTGTAAAACTTTTTTTAAGTAAA / / / / CviJI Hpy178III* TspDTI TspEI AluI ApoI S S F I G V L D I Y G F E H F E K N S F A H L L V F W I F M G L N I L K K I H L L I Y W C S G Y L W V * T F * K K F I * ----:----|----:----|----:----|----:----|----:----|----:----| L E N I P T R S I * P N S C K S F F E N * S M * Q H E P Y K H T Q V N Q F F N M A * K N T N Q I N I P K F M K F F I * K FatI AflIII BspLU11I* |CviAII || NspI TspEI MseI || NlaIII \ \ \\ \ GAACAATTTTGTATTAACTATGCCAACGAAAAACTACAACAAGAGTTCAACCAACATGTT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTTAAAACATAATTGATACGGTTGCTTTTTGATGTTGTTCTCAAGTTGGTTGTACAA / / / // TspEI MseI | |BspLU11I* | |AflIII | |FatI | CviAII NlaIII NspI E Q F C I N Y A N E K L Q Q E F N Q H V N N F V L T M P T K N Y N K S S T N M F T I L Y * L C Q R K T T T R V Q P T C F ----:----|----:----|----:----|----:----|----:----|----:----| S C N Q I L * A L S F S C C S N L W C T Q V I K Y * S H W R F V V V L T * G V H F L K T N V I G V F F * L L L E V L M N MaeII | MseI | SetI | TaiI TspEI | | MboII TspEI MboII MseI \ \ \ \ \ \ \ TTCAAATTAGAGCAAGAAGAATACGTTAAAGAAGAAATTGAATGGTCTTTTATAGAGTTT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTTAATCTCGTTCTTCTTATGCAATTTCTTCTTTAACTTACCAGAAAATATCTCAAA / / / // / / TspEI | | |MseI | MboII | | MboII TspEI | MaeII TaiI SetI F K L E Q E E Y V K E E I E W S F I E F S N * S K K N T L K K K L N G L L * S L Q I R A R R I R * R R N * M V F Y R V * ----:----|----:----|----:----|----:----|----:----|----:----| K L N S C S S Y T L S S I S H D K I S N K * I L A L L I R * L L F Q I T K * L T E F * L L F F V N F F F N F P R K Y L K MboI | DpnI BtsI | |BstKTI EcoP15I SetI | || Hpy188I | TspRI \ \ \\ \ \ \ AATGATAATCAACCTTGTATTGATCTGATTGAAAACAAGTTGGGTATTTTATCACTGCTT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTATTAGTTGGAACATAACTAGACTAACTTTTGTTCAACCCATAAAATAGTGACGAA / / // / / / MseI SetI || Hpy188I | EcoP15I || MboI TspRI |DpnI BtsI BstKTI N D N Q P C I D L I E N K L G I L S L L M I I N L V L I * L K T S W V F Y H C L * * S T L Y * S D * K Q V G Y F I T A * ----:----|----:----|----:----|----:----|----:----|----:----| L S L * G Q I S R I S F L N P I K D S S * H Y D V K Y Q D S Q F C T P Y K I V A I I I L R T N I Q N F V L Q T N * * Q K NlaIV MaeIII BspMI BstEII | Hpy188I AsuI* | SetI | | TfiI AvaII | MboII | | HinfI |BmgT120I | | SetI | | Hpy99I ||NlaIV MmeI \ \ \ \ \ \ \\\ \ GACGAAGAAAGTAGGTTACCTGCTGGTTCCGACGAATCTTGGACCCAAAAACTTTATCAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTTCTTTCATCCAATGGACGACCAAGGCTGCTTAGAACCTGGGTTTTTGAAATAGTT / / / / / / / / // / | | | BstEII | | BspMI HinfI |AvaII MmeI | | | MaeIII | Hpy188I TfiI |AsuI* | | SetI | Hpy99I BmgT120I | MboII NlaIV NlaIV SetI D E E S R L P A G S D E S W T Q K L Y Q T K K V G Y L L V P T N L G P K N F I K R R K * V T C W F R R I L D P K T L S N ----:----|----:----|----:----|----:----|----:----|----:----| S S S L L N G A P E S S D Q V W F S * * Q R L F Y T V Q Q N R R I K S G F V K D V F F T P * R S T G V F R P G L F K I L TfiI HinfI ApoI | BsiYI* TspEI \ \ \ ACTTTGGATAAATCTCCTACGAACAAAGTATTTTCTAAACCAAGATTCGGGCAAACTAAA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAACCTATTTAGAGGATGCTTGTTTCATAAAAGATTTGGTTCTAAGCCCGTTTGATTT / / | HinfI | TfiI BsiYI* T L D K S P T N K V F S K P R F G Q T K L W I N L L R T K Y F L N Q D S G K L N F G * I S Y E Q S I F * T K I R A N * I ----:----|----:----|----:----|----:----|----:----|----:----| V K S L D G V F L T N E L G L N P C V L F K P Y I E * S C L I K * V L I R A F * S Q I F R R R V F Y K R F W S E P L S F XbaI Hin4I Hpy178III* |MaeI Hin4I | CviJI |Hpy178III* Hin4II* |BsmAI \ \ \\ \ \\ TTTATCGTGAGCCATTATGCTCTAGATGTCGCTTATGATGTGGAAGGATTTATTGAAAAA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AAATAGCACTCGGTAATACGAGATCTACAGCGAATACTACACCTTCCTAAATAACTTTTT / / / // / / TspEI | CviJI |XbaI Hin4II* Hin4I ApoI Hpy178III* Hpy178III* Hin4I MaeI F I V S H Y A L D V A Y D V E G F I E K L S * A I M L * M S L M M W K D L L K K Y R E P L C S R C R L * C G R I Y * K K ----:----|----:----|----:----|----:----|----:----|----:----| N I T L W * A R S T A * S T S P N I S F I * R S G N H E L H R K H H P L I * Q F K D H A M I S * I D S I I H F S K N F F Hin4I Hin4I Tsp4CI* | Hin4II* | Hpy188I | | TspGWI CviJI BsmAI \ \ \ \ \ \ \ AATAGAGACACCGTATCTGACGGACATTTGGAAGTGTTGAAGGCTTCTACCAACGAGACA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCTCTGTGGCATAGACTGCCTGTAAACCTTCACAACTTCCGAAGATGGTTGCTCTGT / / / / // / / BsmAI | Hpy188I Hin4I |TspGWI CviJI BsmAI Tsp4CI* Hin4I Hin4II* N R D T V S D G H L E V L K A S T N E T I E T P Y L T D I W K C * R L L P T R H * R H R I * R T F G S V E G F Y Q R D T ----:----|----:----|----:----|----:----|----:----|----:----| F L S V T D S P C K S T N F A E V L S V F Y L C R I Q R V N P L T S P K * W R S I S V G Y R V S M Q F H Q L S R G V L C TseI AluI CviJI MboII |BisI HindIII MnlI ||BlsI BstXI | AluI | DdeI BbvI ||SetI | BsrI | CviJI \ \ \ \\\ \ \ \ \ CTAATAAATATCTTAGAGGGATTAGAAAAAGCTGCCAAAAAACTGGAAGAAGCGAAAAAG 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GATTATTTATAGAATCTCCCTAATCTTTTTCGACGGTTTTTTGACCTTCTTCGCTTTTTC / / / / //// / / // / MnlI DdeI BbvI | |||| BstXI BsrI || CviJI | |||TseI || AluI | ||BisI |SetI | |BlsI MboII | CviJI | AluI SetI L I N I L E G L E K A A K K L E E A K K * * I S * R D * K K L P K N W K K R K S N K Y L R G I R K S C Q K T G R S E K A ----:----|----:----|----:----|----:----|----:----|----:----| S I F I K S P N S F A A L F S S S A F F V L L Y R L P I L F L Q W F V P L L S F * Y I D * L S * F F S G F F Q F F R F L BssKI CviJI EcoRII | ScrFI | BseBI | | AsuI* Tsp4CI* | | AvaII | MseI Cac8I | | |BmgT120I | |HpaI SetI | CviJI | | ||SetI | |HindII | TspEI | | Cac8I | | ||| Hpy188I | |Hpy166II \ \ \ \ \ \ \ \\\ \ \ \\ CTTGAATTAGAGCAGGCTGGCAGTAAAAAGCCAGGTCCGATAAGAACGGTTAACAGGAAA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTTAATCTCGTCCGACCGTCATTTTTCGGTCCAGGCTATTCTTGCCAATTGTCCTTT / / / / / / // /// / // | TspEI | | Cac8I | || ||Hpy188I | |MseI HindIII | CviJI | || ||AvaII | Hpy166II Cac8I | || ||AsuI* | HindII | || |BmgT120I | HpaI | || EcoRII Tsp4CI* | || BssKI | |BseBI | |ScrFI | SetI CviJI L E L E Q A G S K K P G P I R T V N R K L N * S R L A V K S Q V R * E R L T G N * I R A G W Q * K A R S D K N G * Q E T ----:----|----:----|----:----|----:----|----:----|----:----| S S N S C A P L L F G P G I L V T L L F A Q I L A P Q C Y F A L D S L F P * C S K F * L L S A T F L W T R Y S R N V P F BsiYI* | SetI | NlaIV | | FatI | | |CviAII | | || NlaIII BdaI BccI | | || | MseI BdaI TspDTI \ \ \\ \ \ \ \ CCCACTTTAGGTTCCATGTTTAAGCAATCTTTGATTGAACTAATGAATACCATCAACTCA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTGAAATCCAAGGTACAAATTCGTTAGAAACTAACTTGATTACTTATGGTAGTTGAGT / / / / // / / / / | | | | || MseI BdaI | BccI | | | | |FatI BdaI TspDTI | | | | CviAII | | | NlaIII | | NlaIV | SetI BsiYI* P T L G S M F K Q S L I E L M N T I N S P L * V P C L S N L * L N * * I P S T Q H F R F H V * A I F D * T N E Y H Q L N ----:----|----:----|----:----|----:----|----:----|----:----| G V K P E M N L C D K I S S I F V M L E V W K L N W T * A I K S Q V L S Y W * S G S * T G H K L L R Q N F * H I G D V * HindIII | AluI | CviJI BdaI | | SetI BdaI CviJI CviRI* | | | TspEI \ \ \ \ \ \ \ ACTAATGTTCATTATATTCGTTGTATAAAGCCTAATGCAGATAAAGAAGCTTGGCAATTT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TGATTACAAGTAATATAAGCAACATATTTCGGATTACGTCTATTTCTTCGAACCGTTAAA / / / / / / / BdaI CviJI CviRI* | | HindIII TspEI BdaI | CviJI | AluI SetI T N V H Y I R C I K P N A D K E A W Q F L M F I I F V V * S L M Q I K K L G N L * C S L Y S L Y K A * C R * R S L A I * ----:----|----:----|----:----|----:----|----:----|----:----| V L T * * I R Q I F G L A S L S A Q C N L * H E N Y E N Y L A * H L Y L L K A I S I N M I N T T Y L R I C I F F S P L K BsmAI | DdeI | | Hpy188I BccI | | | CviJI BspCNI TspEI | | | |AlwNI |BseMII \ \ \ \ \\ \\ GATAATTTGATGGTGTTGTCTCAACTCAGAGCCTGTGGTGTTTTGGAAACTATTAGAATA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTAAACTACCACAACAGAGTTGAGTCTCGGACACCACAAAACCTTTGATAATCTTAT / / /// / // | TspEI ||| | |BseMII BccI ||| | BspCNI ||| CviJI ||AlwNI |DdeI Hpy188I BsmAI D N L M V L S Q L R A C G V L E T I R I I I * W C C L N S E P V V F W K L L E Y * F D G V V S T Q S L W C F G N Y * N I ----:----|----:----|----:----|----:----|----:----|----:----| S L K I T N D * S L A Q P T K S V I L I Q Y N S P T T E V * L R H H K P F * * F I I Q H H Q R L E S G T T N Q F S N S Y ApoI TspEI | Hin4I SetI | Hin4I BseYI |Hin4II* | | MseI | GsaI MaeI |Hpy166II | | MboII Hpy178III* \ \ \ \\ \ \ \ \ TCTTGTGCTGGGTTTCCTTCTAGGTGGACTTTTGAAGAATTTGTATTAAGATATTACATC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AGAACACGACCCAAAGGAAGATCCACCTGAAAACTTCTTAAACATAATTCTATAATGTAG / / // // / / / / | BseYI || |Hpy166II | | | MseI GsaI || Hin4II* | | MboII |MaeI | TspEI SetI | ApoI Hin4I Hin4I S C A G F P S R W T F E E F V L R Y Y I L V L G F L L G G L L K N L Y * D I T S L C W V S F * V D F * R I C I K I L H L ----:----|----:----|----:----|----:----|----:----|----:----| D Q A P N G E L H V K S S N T N L Y * M I K H Q T E K * T S K Q L I Q I L I N C R T S P K R R P P S K F F K Y * S I V D MboII AsuI* AvaII DraII FatI PpuMI |CviAII |BtsI || Hin4I |NlaIV || Hin4I |TspRI SfeI* || NlaIII |BmgT120I | Hin4I || |XcmI || SetI BslFI | Hin4I EcoRV \\ \\ \\ \ \ \ \ \ TTGATACCACATGAGCAGTGGGACCTAATCTTCAAAAAAAAGGAAACTACAGAAGAAGAT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AACTATGGTGTACTCGTCACCCTGGATTAGAAGTTTTTTTTCCTTTGATGTCTTCTTCTA / // // / /// / / / // | || |TspRI | ||PpuMI BslFI Hin4I SfeI* |EcoRV | || |XcmI | ||DraII Hin4I TsoI | || |FatI | ||AvaII | || CviAII | ||AsuI* | |NlaIII | |BmgT120I | Hin4I | NlaIV | Hin4I | SetI Hpy178III* MboII BtsI L I P H E Q W D L I F K K K E T T E E D * Y H M S S G T * S S K K R K L Q K K I D T T * A V G P N L Q K K G N Y R R R Y ----:----|----:----|----:----|----:----|----:----|----:----| K I G C S C H S R I K L F F S V V S S S R S V V H A T P G L R * F F P F * L L L Q Y W M L L P V * D E F F L F S C F F I MseI TspRI |BinI* || SfaNI || | MboI || | |Hin4I TsoI || | |Hin4I | MboII || | ||DpnI | | MslI || | |||BstKTI Csp6I | | MboII || | |||| MaeI Tsp4CI* |RsaI \ \ \ \\ \ \\\\ \ \ \\ ATCATATCAGTGGTTAAAATGATCCTAGATGCTACTGTAAAGGACAAATCCAAGTACCAG 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTATAGTCACCAATTTTACTAGGATCTACGATGACATTTCCTGTTTAGGTTCATGGTC / /// / // / / / // | ||MslI | || | MaeI Tsp4CI* |Csp6I | |MboII | || MboI RsaI | TspRI | |SfaNI MboII | |DpnI | BstKTI Hin4I Hin4I BinI* MseI I I S V V K M I L D A T V K D K S K Y Q S Y Q W L K * S * M L L * R T N P S T R H I S G * N D P R C Y C K G Q I Q V P D ----:----|----:----|----:----|----:----|----:----|----:----| I M D T T L I I R S A V T F S L D L Y W Y * I L P * F S G L H * Q L P C I W T G D Y * H N F H D * I S S Y L V F G L V L Cac8I | CviRI* | | Hpy178III* MboII | | | AlfI | ApoI | | | AlfI | TspEI | | | | DdeI | | BspMI SetI | | | | | SfaNI \ \ \ \ \ \ \ \ \ \ ATTGGTAATACAAAAATTTTCTTCAAAGCAGGTATGCTTGCATATCTGGAAAAACTTAGA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TAACCATTATGTTTTTAAAAGAAGTTTCGTCCATACGAACGTATAGACCTTTTTGAATCT / / / / / / // / MboII | BspMI SetI | CviRI* |AlfI DdeI TspEI Cac8I |AlfI ApoI Hpy178III* I G N T K I F F K A G M L A Y L E K L R L V I Q K F S S K Q V C L H I W K N L E W * Y K N F L Q S R Y A C I S G K T * K ----:----|----:----|----:----|----:----|----:----|----:----| I P L V F I K K L A P I S A Y R S F S L S Q Y Y L F K R * L L Y A Q M D P F V * N T I C F N E E F C T H K C I Q F F K S CviRI* | EcoT22I | |TspEI | || MfeI | || TspEI | || | BinI* | || | |AlfI | || | |AlfI | || | || MboI MboII | || | || | DpnI |AluI | || | || | |BstKTI |CviJI | || | || | ||Hpy178III* || SetI | || | || | ||| TspEI || | SspI \ \\ \ \\ \ \\\ \ \\ \ \ AGCAATAAGATGCATAATTCAATTGTTATGATCCAGAAGAAAATTAGAGCTAAATATTAC 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTTATTCTACGTATTAAGTTAACAATACTAGGTCTTCTTTTAATCTCGATTTATAATG / / / / /// // / / / / / / / SfaNI | CviRI* | ||| || | | | | CviJI SspI Tsp4CI* EcoT22I | ||| || | | | | AluI | ||| || | | | MboII | ||| || | | | SetI | ||| || | | TspEI | ||| || | Hpy178III* | ||| || MboI | ||| |DpnI | ||| BstKTI | ||BinI* | |TspEI | |MfeI | AlfI | AlfI TspEI S N K M H N S I V M I Q K K I R A K Y Y A I R C I I Q L L * S R R K L E L N I T Q * D A * F N C Y D P E E N * S * I L P ----:----|----:----|----:----|----:----|----:----|----:----| L L L I C L E I T I I W F F I L A L Y * F C Y S A Y N L Q * S G S S F * L * I N A I L H M I * N N H D L L F N S S F I V BspCNI MwoI |BccI BstAPI CviJI |BseMII Tsp4CI* | CviRI* DdeI HaeIII || CviRI* TspDTI SetI \ \ \ \ \ \\ \ \ \ CGTAAGCAGTATTTGCAAATATCTCAGGCCATCAAGTATTTGCAGAACAACATCAAAGGT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| GCATTCGTCATAAACGTTTATAGAGTCCGGTAGTTCATAAACGTCTTGTTGTAGTTTCCA / / / / // / / / / | CviRI* | | || | CviRI* TspDTI SetI BstAPI | | || BccI MwoI | | |BseMII | | BspCNI | HaeIII | CviJI DdeI R K Q Y L Q I S Q A I K Y L Q N N I K G V S S I C K Y L R P S S I C R T T S K V * A V F A N I S G H Q V F A E Q H Q R F ----:----|----:----|----:----|----:----|----:----|----:----| R L C Y K C I D * A M L Y K C F L M L P G Y A T N A F I E P W * T N A S C C * L T L L I Q L Y R L G D L I Q L V V D F T MseI |HpaI HindII |HindII Hpy166II |Hpy166II | MluI || TspDTI | AflIII || | Tsp4CI* | | FnuDII* || | | CviRI* | | | MseI || | | TspDTI \ \ \ \ \\ \ \ \ TTCATCATTCGTCAACGCGTTAATGATGAAATGAAAGTTAACTGTGCAACTTTATTACAG 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTAGTAAGCAGTTGCGCAATTACTACTTTACTTTCAATTGACACGTTGAAATAATGTC / / / / // / / / | | | MseI || | | CviRI* | | AflIII || | TspDTI | | MluI || Tsp4CI* | FnuDII* |MseI Hpy166II Hpy166II HindII TspDTI HindII HpaI F I I R Q R V N D E M K V N C A T L L Q S S F V N A L M M K * K L T V Q L Y Y R H H S S T R * * * N E S * L C N F I T G ----:----|----:----|----:----|----:----|----:----|----:----| K M M R * R T L S S I F T L Q A V K N C N * * E D V R * H H F S L * S H L K I V E D N T L A N I I F H F N V T C S * * L CviJI HaeIII |AciI |BisI ||BlsI |||TauI |||| FokI |||| |BsiYI* ApoI |||| || TspGWI BseGI BccI TspEI TspEI \\\\ \\ \ \ \ \ \ GCCGCTTACAGGGGTCATTCCATCCGTGCCAATGTGTTCAGCGTATTGAGAACAATTACA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCGAATGTCCCCAGTAAGGTAGGCACGGTTACACAAGTCGCATAACTCTTGTTAATGT ///// / / / / ||||| TspGWI BseGI BccI TspEI ||||| FokI ||||BsiYI* |||AciI ||BisI |BlsI HaeIII CviJI TauI A A Y R G H S I R A N V F S V L R T I T P L T G V I P S V P M C S A Y * E Q L Q R L Q G S F H P C Q C V Q R I E N N Y K ----:----|----:----|----:----|----:----|----:----|----:----| A A * L P * E M R A L T N L T N L V I V P R K C P D N W G H W H T * R I S F L * G S V P T M G D T G I H E A Y Q S C N C BbvI FatI |CviAII CviRI* TspEI || NlaIII \ \ \\ \ AATTTGCAAAAGAAAATTAGAAAGGAACTAAAACAAAGACAACTGAAACAAGAACATGAA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAACGTTTTCTTTTAATCTTTCCTTGATTTTGTTTCTGTTGACTTTGTTCTTGTACTT / / / / // | CviRI* TspEI | |FatI TspEI | |BbvI ApoI | CviAII NlaIII N L Q K K I R K E L K Q R Q L K Q E H E I C K R K L E R N * N K D N * N K N M N F A K E N * K G T K T K T T E T R T * I ----:----|----:----|----:----|----:----|----:----|----:----| F K C F F I L F S S F C L C S F C S C S L N A F S F * F P V L V F V V S V L V H I Q L L F N S L F * F L S L Q F L F M F Hin4I TseI |AsuI* CviJI |BisI |AvaII | MboI ||BlsI |DraII | | DpnI |||AciI |PpuMI | | |TaqI ||||TspDTI ||BmgT120I | | |BstKTI |||||MaeIII ||| SetI | | ||Hpy178III* \\\\\\ \\\ \ \ \ \\\ TATAATGCTGCGGTAACTATTCAAAGTAAAGTTAGGACCTTTGAGCCGAGATCGAGATTT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTACGACGCCATTGATAAGTTTCATTTCAATCCTGGAAACTCGGCTCTAGCTCTAAA /// / / / /// / // /// ||| AciI MaeIII Hin4I ||PpuMI | || ||Hpy178III* ||TseI ||DraII | || |TaqI |TspDTI ||AvaII | || MboI |BisI ||AsuI* | |DpnI BlsI || | BstKTI || CviJI |BmgT120I SetI Y N A A V T I Q S K V R T F E P R S R F I M L R * L F K V K L G P L S R D R D F * C C G N Y S K * S * D L * A E I E I F ----:----|----:----|----:----|----:----|----:----|----:----| Y L A A T V I * L L T L V K S G L D L N I Y H Q P L * E F Y L * S R Q A S I S I I I S R Y S N L T F N P G K L R S R S K MboI TseI BclI AluI |BbvI CviJI ||DpnI |BisI |||BstKTI ||BlsI ||||SapI ||SetI Hin4I Tsp4CI* ||||Ksp632I* ||| MboII | NmeAIII | TspRI |||||Hpy188I ||| | MboII \ \ \ \ \\\\\\ \\\ \ \ TTACGCACTAAAAAAGACACTGTTGTTGTCCAATCTTTGATCAGAAGAAGAGCTGCTCAA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| AATGCGTGATTTTTTCTGTGACAACAACAGGTTAGAAACTAGTCTTCTTCTCGACGAGTT / / / / // // / / //// / Hin4I | | Tsp4CI* || || | | |||| MboII | TspRI || || | | |||MboII NmeAIII || || | | |||TseI || || | | ||BisI || || | | |BlsI || || | | CviJI || || | | AluI || || | SetI || || Ksp632I* || || SapI || |BbvI || Hpy188I || BclI || MboI |DpnI BstKTI L R T K K D T V V V Q S L I R R R A A Q Y A L K K T L L L S N L * S E E E L L K T H * K R H C C C P I F D Q K K S C S K ----:----|----:----|----:----|----:----|----:----|----:----| K R V L F S V T T T W D K I L L L A A * K V C * F L C Q Q Q G I K S * F F L Q E * A S F F V S N N D L R Q D S S S S S L Hin4II* |MfeI |TspEI Hpy188I || Hin4I HgaI |Hin4I AluI TspEI || Hin4I | MseI |Hin4I CviJI \ \\ \ \ \ \\ \ AGGAAATTGAAACAATTGAAGGCAGACGCTAAATCAGTTAATCATCTGAAAGAAGTGAGC 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTTTAACTTTGTTAACTTCCGTCTGCGATTTAGTCAATTAGTAGACTTTCTTCACTCG / / / // / / / / | | TspEI || | Hpy188I | CviJI | | MfeI || Hin4I | AluI | Hin4II* || Hin4I SetI | Hin4I |MseI | Hin4I HgaI TspEI R K L K Q L K A D A K S V N H L K E V S G N * N N * R Q T L N Q L I I * K K * A E I E T I E G R R * I S * S S E R S E L ----:----|----:----|----:----|----:----|----:----|----:----| L F N F C N F A S A L D T L * R F S T L F S I S V I S P L R * I L * D D S L L S P F Q F L Q L C V S F * N I M Q F F H A TfiI HinfI | HgaI | |MaeI | || BseGI | || | StyI | || | SecI* | || | | SfaNI | || | | |SetI SetI Hin4I | || | | |Hin4I | TspEI Hin4I FokI | || | | |Hin4I \ \ \ \ \ \\ \ \ \\ TATAAATTAGAGAATAAAGTGATTGAACTGACGCAGAATCTAGCATCCAAGGTCAAAGAA 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTTAATCTCTTATTTCACTAACTTGACTGCGTCTTAGATCGTAGGTTCCAGTTTCTT / / / / // / // / / TspEI Hin4I FokI | || | || | SfaNI Hin4I | || | || SecI* | || | || StyI | || | |SetI | || | Hin4I | || | Hin4I | || HgaI | |MaeI | BseGI HinfI TfiI Y K L E N K V I E L T Q N L A S K V K E I N * R I K * L N * R R I * H P R S K K * I R E * S D * T D A E S S I Q G Q R K ----:----|----:----|----:----|----:----|----:----|----:----| * L N S F L T I S S V C F R A D L T L S S Y I L S Y L S Q V S A S D L M W P * L I F * L I F H N F Q R L I * C G L D F F TspEI MboII | MseI SfeI* SetI |MaeIII \ \ \ \ \\ AATAAAGAAATGACAGAAAGAATTAAAGAACTACAGGTTCAAGTGGAAGAAAGTGCCAAG 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTCTTTACTGTCTTTCTTAATTTCTTGATGTCCAAGTTCACCTTCTTTCACGGTTC // // / |MseI |SfeI* MboII TspEI SetI N K E M T E R I K E L Q V Q V E E S A K I K K * Q K E L K N Y R F K W K K V P S * R N D R K N * R T T G S S G R K C Q V ----:----|----:----|----:----|----:----|----:----|----:----| F L S I V S L I L S S C T * T S S L A L F Y L F S L F F * L V V P E L P L F H W I F F H C F S N F F * L N L H F F T G L SduI HgiAI* | MseI BsmAI | TspDTI Hpy188I \ \ \ \ TTACAAGAGACATTAGAAAATATGAAAAAAGAGCACTTAATAGATATTGATAATCAGAAA 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTTCTCTGTAATCTTTTATACTTTTTTCTCGTGAATTATCTATAACTATTAGTCTTT // / / / / |BsmAI | | MseI Hpy188I MaeIII | TspDTI HgiAI* SduI L Q E T L E N M K K E H L I D I D N Q K Y K R H * K I * K K S T * * I L I I R N T R D I R K Y E K R A L N R Y * * S E I ----:----|----:----|----:----|----:----|----:----|----:----| N C S V N S F I F F S C K I S I S L * F T V L S M L F Y S F L A S L L Y Q Y D S * L L C * F I H F F L V * Y I N I I L F DdeI TspEI TspEI CviRI* TspRI \ \ \ \ \ TCTAAGGATATGGAATTACAAAAAACTATTGAGAACAATTTGCAATCCACTGAACAAACT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| AGATTCCTATACCTTAATGTTTTTTGATAACTCTTGTTAAACGTTAGGTGACTTGTTTGA / / / / / / DdeI TspEI | | TspRI MmeI | CviRI* TspEI S K D M E L Q K T I E N N L Q S T E Q T L R I W N Y K K L L R T I C N P L N K L * G Y G I T K N Y * E Q F A I H * T N S ----:----|----:----|----:----|----:----|----:----|----:----| D L S I S N C F V I S F L K C D V S C V I * P Y P I V F F * Q S C N A I W Q V F R L I H F * L F S N L V I Q L G S F L S TspEI FatI FatI | HgaI |CviAII |CviAII | | MnlI || NlaIII || NlaIII MmeI | | | TsoI || | MseI || | TspEI \ \ \ \ \ \\ \ \ \\ \ \ CTAAAGGACGCTCAATTAGAGTTGGAGGACATGGTTAAACAACATGATGAATTGAAAGAA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| GATTTCCTGCGAGTTAATCTCAACCTCCTGTACCAATTTGTTGTACTACTTAACTTTCTT / // / // / / // / / | |HgaI | || MseI | |FatI TspEI TspDTI | TsoI | |FatI | CviAII TspEI | CviAII NlaIII MnlI NlaIII L K D A Q L E L E D M V K Q H D E L K E * R T L N * S W R T W L N N M M N * K K K G R S I R V G G H G * T T * * I E R R ----:----|----:----|----:----|----:----|----:----|----:----| R F S A * N S N S S M T L C C S S N F S E L P R E I L T P P C P * V V H H I S L * L V S L * L Q L V H N F L M I F Q F F TfiI HinfI |TspDTI MboII TspEI MboII \\ \ \ \ GAATCTAAAAAGCAACTTGAAGAATTAGAGCAAACAAAGAAAACATTGGTTGAATACCAG 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGATTTTTCGTTGAACTTCTTAATCTCGTTTGTTTCTTTTGTAACCAACTTATGGTC / / / / | MboII | MboII HinfI TspEI TfiI E S K K Q L E E L E Q T K K T L V E Y Q N L K S N L K N * S K Q R K H W L N T R I * K A T * R I R A N K E N I G * I P D ----:----|----:----|----:----|----:----|----:----|----:----| S D L F C S S S N S C V F F V N T S Y W L I * F A V Q L I L A F L S F M P Q I G F R F L L K F F * L L C L F C Q N F V L MaeI CviRI* | MboII MseI | TspGWI MseI | |MaeIII |BsmAI | | MseI |AhaIII* TspEI | || SetI \\ \ \ \ \\ \ \ \\ \ ACATTAAACGGAGACTTGCAAAACGAAGTTAAATCTTTAAAGGAAGAAATTGCTAGGTTA 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAATTTGCCTCTGAACGTTTTGCTTCAATTTAGAAATTTCCTTCTTTAACGATCCAAT / / / / / // / // | BsmAI | TspGWI MseI |MseI | |MaeI MseI CviRI* AhaIII* | MboII | SetI TspEI T L N G D L Q N E V K S L K E E I A R L H * T E T C K T K L N L * R K K L L G Y I K R R L A K R S * I F K G R N C * V T ----:----|----:----|----:----|----:----|----:----|----:----| V N F P S K C F S T L D K F S S I A L N S M L R L S A F R L * I K L P L F Q * T C * V S V Q L V F N F R * L F F N S P * FatI |CviAII || NlaIII || | BseYI || | BstXI || | | GsaI || | | HgiCI* || | | | NlaIV || | | | |SduI || | | | |BseSI || | | | || MaeIII || | | | || Tsp4CI* || | | | || | SpeI || | | | || | |MaeI || | | | || | || TatI || | | | || | || |Csp6I || | | | || | || |Hpy166II MnlI || | | | || | || ||RsaI SetI | MseI \\ \ \ \ \\ \ \\ \\\ \ \ \ CAAACTGCCATGTCGCTGGGCACCGTTACTACTAGTGTACTACCTCAAACACCATTAAAG 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTGACGGTACAGCGACCCGTGGCAATGATGATCACATGATGGAGTTTGTGGTAATTTC / / // / // / / / // ///// / / MaeIII | || | || | | | || ||||SetI MnlI MseI | || | || | | | || |||TatI | || | || | | | || ||Csp6I | || | || | | | || |RsaI | || | || | | | || Hpy166II | || | || | | | |SpeI | || | || | | | MaeI | || | || | | MaeIII | || | || | Tsp4CI* | || | || | HgiCI* | || | || NlaIV | || | |BseYI | || | BseSI | || | SduI | || GsaI | |FatI | CviAII | BstXI NlaIII Q T A M S L G T V T T S V L P Q T P L K K L P C R W A P L L L V Y Y L K H H * R N C H V A G H R Y Y * C T T S N T I K G ----:----|----:----|----:----|----:----|----:----|----:----| C V A M D S P V T V V L T S G * V G N F V F Q W T A P C R * * * H V V E F V M L L S G H R Q A G N S S T Y * R L C W * L ApoI ApoI MnlI FokI TspEI TspEI | BseGI |AciI | SfaNI SmlI EcoRI Hpy188I \ \ \\ \ \ \ \ \ GATGTAATGGGAGGCGGTGCTTCAAATTTCAACAATATGATGCTTGAGAATTCCGACTTA 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| CTACATTACCCTCCGCCACGAAGTTTAAAGTTGTTATACTACGAACTCTTAAGGCTGAAT // // / / / // |BseGI |FokI | SfaNI SmlI |Hpy188I MnlI AciI TspEI EcoRI ApoI TspEI ApoI D V M G G G A S N F N N M M L E N S D L M * W E A V L Q I S T I * C L R I P T Y C N G R R C F K F Q Q Y D A * E F R L I ----:----|----:----|----:----|----:----|----:----|----:----| S T I P P P A E F K L L I I S S F E S K P H L P L R H K L N * C Y S A Q S N R S I Y H S A T S * I E V I H H K L I G V * XbaI |MaeI |Hpy178III* BetI* || MboI BsiYI* BsaBI || BglII BspMII* |TfiI || XhoII |HpaII |HinfI || | DpnI |Hpy178III* Bce83I* || MmeI || | |BstKTI ||BccI TspDTI Hin4I \ \\ \ \\ \ \\ \\\ \ \ TCTCCTAATGATTTGAATCTAAAGTCTAGATCTACTCCATCGTCCGGAAACAACCACATT 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGGATTACTAAACTTAGATTTCAGATCTAGATGAGGTAGCAGGCCTTTGTTGGTGTAA / // / /// / / // / / Bce83I* || HinfI ||| XhoII | || | Hin4I || TfiI ||| BglII | || TspDTI |MmeI ||| MboI | |BspMII* BsaBI ||DpnI | |BetI* |BstKTI | Hpy178III* |XbaI | HpaII Hpy178III* | BccI MaeI BsiYI* S P N D L N L K S R S T P S S G N N H I L L M I * I * S L D L L H R P E T T T L S * * F E S K V * I Y S I V R K Q P H * ----:----|----:----|----:----|----:----|----:----|----:----| D G L S K F R F D L D V G D D P F L W M I E * H N S D L T * I * E M T R F C G C R R I I Q I * L R S R S W R G S V V V N TaqI |MboI || DpnI || |PvuI || |McrI* || |BstKTI || ||Hpy178III* TfiI || |||NruI HinfI || |||FnuDII* Hin4I Ksp632I* \ \\ \\\\ \ \ GATTCATTGAGTGTCGATCGCGAAAATGGTGTCAATGCTACACAAATCAATGAAGAGTTA 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAGTAACTCACAGCTAGCGCTTTTACCACAGTTACGATGTGTTTAGTTACTTCTCAAT / // /// / / HinfI || ||| Hin4I Ksp632I* TfiI || ||Hpy178III* || |FnuDII* || |NruI || MboI |DpnI BstKTI McrI* TaqI PvuI D S L S V D R E N G V N A T Q I N E E L I H * V S I A K M V S M L H K S M K S Y F I E C R S R K W C Q C Y T N Q * R V I ----:----|----:----|----:----|----:----|----:----|----:----| S E N L T S R S F P T L A V C I L S S N Q N M S H R D R F H H * H * V F * H L T I * Q T D I A F I T D I S C L D I F L * StuI CviJI HaeIII MboII TfiI | MseI |TspDTI ApoI HinfI | EcoNI ||MnlI TspEI | Hpy178III* | | BsiYI* |||SetI |TspRI | | Hin4II* | | |TspGWI \\\\ \\ \ \ \ \ \ \\ TACAGGTTATTGGAGGACACTGAAATTTTGAATCAAGAAATCACGGAAGGCCTGTTAAAG 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTCCAATAACCTCCTGTGACTTTAAAACTTAGTTCTTTAGTGCCTTCCGGACAATTTC / / / / / / / / / // | MnlI TspRI TspEI | | Hin4II* | | |MseI TspDTI ApoI | Hpy178III* | | TspGWI MboII HinfI | | EcoNI SetI TfiI | BsiYI* HaeIII CviJI StuI Y R L L E D T E I L N Q E I T E G L L K T G Y W R T L K F * I K K S R K A C * R Q V I G G H * N F E S R N H G R P V K G ----:----|----:----|----:----|----:----|----:----|----:----| Y L N N S S V S I K F * S I V S P R N F I C T I P P C Q F K S D L F * P L G T L V P * Q L V S F N Q I L F D R F A Q * L TfiI HinfI | TaqI BsiYI* | AsuII | BseGI | |SfaNI | | MwoI | || Csp6I | | | AluI | || |RsaI | | | FokI DdeI MaeII | || ||BetI* | | | CviJI | Esp3I | SetI | || |||HpaII | | | | SetI | BsmAI | TaiI \ \\ \\\\ \ \ \ \ \ \ \ \ \ GGATTCGAAGTACCGGATGCTGGTGTAGCTATTCAACTAAGTAAAAGAGACGTTGTTTAT 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAAGCTTCATGGCCTACGACCACATCGATAAGTTGATTCATTTTCTCTGCAACAAATA / / /// // / / / / / / / / / | | ||| || | | | | FokI DdeI | | MaeII | | ||| || | | | CviJI | TaiI | | ||| || | | | AluI | SetI | | ||| || | | SetI BsmAI | | ||| || | MwoI Esp3I | | ||| || BseGI | | ||| |BsiYI* | | ||| |BetI* | | ||| HpaII | | ||Csp6I | | |RsaI | | SfaNI | AsuII | TaqI HinfI TfiI G F E V P D A G V A I Q L S K R D V V Y D S K Y R M L V * L F N * V K E T L F I I R S T G C W C S Y S T K * K R R C L S ----:----|----:----|----:----|----:----|----:----|----:----| P N S T G S A P T A I * S L L L S T T * P I R L V P H Q H L * E V L Y F L R Q K S E F Y R I S T Y S N L * T F S V N N I HpaII | CviJI | |MaeI MseI CviJI MwoI \ \\ \ \ \ CCGGCTAGAATACTGATTATAGTTTTAAGTGAAATGTGGAGATTTGGGCTGACCAAGCAA 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| GGCCGATCTTATGACTAATATCAAAATTCACTTTACACCTCTAAACCCGACTGGTTCGTT // / / / / || MaeI MseI | MwoI |CviJI CviJI HpaII P A R I L I I V L S E M W R F G L T K Q R L E Y * L * F * V K C G D L G * P S K G * N T D Y S F K * N V E I W A D Q A K ----:----|----:----|----:----|----:----|----:----|----:----| G A L I S I I T K L S I H L N P S V L C D P * F V S * L K L H F T S I Q A S W A R S S Y Q N Y N * T F H P S K P Q G L L HindIII MaeIII | AluI Tsp45I | XmnI | Hin4II* | CviJI | |MfeI | | SetI TspEI | |TspEI \ \ \ \ \ \\ AGTGAAAGCTTTCTTGCCCAAGTATTGACTACAATTCAAAAAGTTGTCACTCAATTGAAG 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTTTCGAAAGAACGGGTTCATAACTGATGTTAAGTTTTTCAACAGTGAGTTAACTTC / / / / / / | | HindIII TspEI | TspEI | CviJI | MfeI | XmnI Hin4II* | AluI Tsp45I SetI MaeIII S E S F L A Q V L T T I Q K V V T Q L K V K A F L P K Y * L Q F K K L S L N * R * K L S C P S I D Y N S K S C H S I E G ----:----|----:----|----:----|----:----|----:----|----:----| L S L K R A W T N V V I * F T T V * N F F H F S E Q G L I S * L E F L Q * E I S T F A K K G L Y Q S C N L F N D S L Q L BplI BplI |AclI |MaeII MseI AciI || SetI MaeIII |TspEI |TsoI || TaiI \ \\ \\ \\ \ GGTAACGATTTAATTCCAAGCGGTGTATTCTGGTTAGCAAACGTTAGAGAGTTATACTCA 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTGCTAAATTAAGGTTCGCCACATAAGACCAATCGTTTGCAATCTCTCAATATGAGT / / / / / / / / | | | | AciI BplI | MaeII | | | TsoI BplI | AclI | | TspEI TaiI | MseI SetI MaeIII G N D L I P S G V F W L A N V R E L Y S V T I * F Q A V Y S G * Q T L E S Y T H * R F N S K R C I L V S K R * R V I L I ----:----|----:----|----:----|----:----|----:----|----:----| P L S K I G L P T N Q N A F T L S N Y E P Y R N L E L R H I R T L L R * L T I S T V I * N W A T Y E P * C V N S L * V * AclI MaeII FatI | SetI |CviAII BplI | TaiI || MnlI BplI MseI | | MboII || NlaIII \ \ \ \ \ \\ \ TTTGTGGTGTTTGCTCTAAACTCTATTTTAACCGAAGAAACGTTCAAAAACGGCATGACC 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| AAACACCACAAACGAGATTTGAGATAAAATTGGCTTCTTTGCAAGTTTTTGCCGTACTGG / / / / / / // BplI MseI | | MboII | |FatI BplI | MaeII | CviAII | AclI | MnlI TaiI NlaIII SetI F V V F A L N S I L T E E T F K N G M T L W C L L * T L F * P K K R S K T A * P C G V C S K L Y F N R R N V Q K R H D R ----:----|----:----|----:----|----:----|----:----|----:----| N T T N A R F E I K V S S V N L F P M V M Q P T Q E L S * K L R L F T * F R C S K H H K S * V R N * G F F R E F V A H G BseGI | TaqI | AsuII | | AluI TaqII | | FokI |TspDTI MaeIII | | CviJI BceAI || BseRI Tsp45I | | | SetI \ \\ \ \ \ \ \ \ GATGAGGAGTATAAGGAGTATGTTTCATTGGTCACAGAACTAAAGGATGATTTCGAAGCT 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTCCTCATATTCCTCATACAAAGTAACCAGTGTCTTGATTTCCTACTAAAGCTTCGA / // / / / // / | || BseRI Tsp45I BseGI || CviJI | |TspDTI MaeIII || AluI | TaqII |SetI BceAI AsuII TaqI D E E Y K E Y V S L V T E L K D D F E A M R S I R S M F H W S Q N * R M I S K L * G V * G V C F I G H R T K G * F R S S ----:----|----:----|----:----|----:----|----:----|----:----| S S S Y L S Y T E N T V S S F S S K S A R H P T Y P T H K M P * L V L P H N R L I L L I L L I N * Q D C F * L I I E F S TspEI | CviRI* | | MboII | | | MfeI | | | TspEI | | | | Eco57I | | | | Eco57MI DdeI PsiI CviJI | | | | | CviRI* \ \ \ \ \ \ \ \ \ CTAAGTTATAATATATATAACATTTGGCTGAAGAAATTGCAGAAGCAATTGCAAAAAAAG 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| GATTCAATATTATATATATTGTAAACCGACTTCTTTAACGTCTTCGTTAACGTTTTTTTC / / / / // / / // | | PsiI CviJI || MboII | |CviRI* | DdeI |CviRI* | TspEI FokI TspEI | MfeI Eco57MI Eco57I L S Y N I Y N I W L K K L Q K Q L Q K K * V I I Y I T F G * R N C R S N C K K R K L * Y I * H L A E E I A E A I A K K G ----:----|----:----|----:----|----:----|----:----|----:----| R L * L I Y L M Q S F F N C F C N C F F E L N Y Y I Y C K A S S I A S A I A F F * T I I Y I V N P Q L F Q L L L Q L F L BssKI SexAI Hin6I CviJI EcoRII |GlaI HaeIII | ScrFI ||AciI | MwoI Hpy188I | BseBI ||HhaI | | XcmI |TfiI | | FauI ||FnuDII* AciI | | |BccI |HinfI | | SetI ||| FauI NspBII* \ \ \\ \\ \ \ \ \\\ \ \ GCCATCAATGCTGTGGTCATCTCCGAATCATTACCAGGTTTCAGCGCGGGAGAAACCAGC 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTAGTTACGACACCAGTAGAGGCTTAGTAATGGTCCAAAGTCGCGCCCTCTTTGGTCG / / / / / / // / / /// / / / | | | BccI | HinfI || | | ||| AciI FauI NspBII* | | XcmI | TfiI || | | ||FnuDII* | MwoI Hpy188I || | | ||Hin6I HaeIII || | | |GlaI CviJI || | | HhaI || | FauI || EcoRII || SexAI || BssKI |BseBI |ScrFI SetI A I N A V V I S E S L P G F S A G E T S P S M L W S S P N H Y Q V S A R E K P A H Q C C G H L R I I T R F Q R G R N Q R ----:----|----:----|----:----|----:----|----:----|----:----| A M L A T T M E S D N G P K L A P S V L P W * H Q P * R R I M V L N * R P L F W G D I S H D D G F * * W T E A R S F G A MboII ApoI | BdaI Eco57I TspEI TspRI | BdaI Eco57MI \ \ \ \ \ GGGTTTTTGAACAAAATTTTTGCTAACACTGAAGAATATACAATGGACGACATTTTGACC 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| CCCAAAAACTTGTTTTAAAAACGATTGTGACTTCTTATATGTTACCTGCTGTAAAACTGG / / / // / / AciI TspEI TspRI |BdaI Eco57MI SetI ApoI |BdaI Eco57I MboII G F L N K I F A N T E E Y T M D D I L T G F * T K F L L T L K N I Q W T T F * P V F E Q N F C * H * R I Y N G R H F D L ----:----|----:----|----:----|----:----|----:----|----:----| P N K F L I K A L V S S Y V I S S M K V R T K S C F K Q * C Q L I Y L P R C K S P K Q V F N K S V S F F I C H V V N Q G BdaI BdaI | BsrI | |FatI | |CviRI* | ||CviAII | |||TspDTI FatI SetI | |||| NlaIII TspDTI |CviAII \ \ \\\\ \ \ \\ TTTTTCAACAGCATATACTGGTGCATGAAATCTTTTCATATTGAGAATGAAGTGTTCCAT 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAAGTTGTCGTATATGACCACGTACTTTAGAAAAGTATAACTCTTACTTCACAAGGTA / / / // / / / | | | |FatI TspDTI | TspDTI | | | CviAII | CviAII | | CviRI* NlaIII | | NlaIII | | TspDTI | BsrI BdaI BdaI F F N S I Y W C M K S F H I E N E V F H F S T A Y T G A * N L F I L R M K C S M F Q Q H I L V H E I F S Y * E * S V P C ----:----|----:----|----:----|----:----|----:----|----:----| K K L L M Y Q H M F D K * I S F S T N W R K * C C I S T C S I K E Y Q S H L T G K E V A Y V P A H F R K M N L I F H E M TspEI | MseI | VspI NlaIII | | FatI |SfeI* | | BspHI |TspDTI CviRI* | | |CviAII || MaeIII SfaNI |TspEI FokI | | |Hpy178III* || Tsp45I SetI TspEI ||BseGI |MseI | | || NlaIII \\ \ \ \ \\\ \\ \ \ \\ \ GCTGTAGTCACAACCTTATTGAATTATGTGGATGCAATTTGTTTTAACGAATTAATCATG 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| CGACATCAGTGTTGGAATAACTTAATACACCTACGTTAAACAAAATTGCTTAATTAGTAC / / // / / / // // / // FatI | |SetI TspEI | TspEI |FokI || | |BspHI | Tsp45I SfaNI CviRI* MseI || | |FatI | MaeIII BseGI || | Hpy178III* SfeI* || | CviAII || NlaIII |VspI |MseI TspEI A V V T T L L N Y V D A I C F N E L I M L * S Q P Y * I M W M Q F V L T N * S * C S H N L I E L C G C N L F * R I N H E ----:----|----:----|----:----|----:----|----:----|----:----| A T T V V K N F * T S A I Q K L S N I M H Q L * L R I S N H P H L K N * R I L * S Y D C G * Q I I H I C N T K V F * D H AclI MaeII |MaeIII MaeII || SetI | SetI || TaiI | TaiI MboII MfeI || | MaeI | TspEI TspDTI BbvII* TspEI || | |MnlI \ \ \ \ \ \\ \ \\ AAACGTAATTTCTTGTCGTGGAAAAGGGGTCTTCAATTGAACTACAACGTTACTAGATTA 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGCATTAAAGAACAGCACCTTTTCCCCAGAAGTTAACTTGATGTTGCAATGATCTAAT / / // / / / / / / / | | |TspDTI | BbvII* TspEI | | | MaeI | | TspEI MboII MfeI | | MaeIII | MaeII | | MnlI TaiI | MaeII SetI | AclI TaiI SetI K R N F L S W K R G L Q L N Y N V T R L N V I S C R G K G V F N * T T T L L D * T * F L V V E K G S S I E L Q R Y * I R ----:----|----:----|----:----|----:----|----:----|----:----| F R L K K D H F L P R * N F * L T V L N S V Y N R T T S F P D E I S S C R * * I F T I E Q R P F P T K L Q V V V N S S * FatI |CviAII || NlaIII || |CviJI || ||HgaI || |||BccI || |||| BseMII || |||| |BspCNI || |||| || Csp6I || |||| || |RsaI TfiI CviRI* || |||| || || DdeI HinfI \ \\ \\\\ \\ \\ \ \ GAGGAATGGTGCAAGACGCATGGCTTGACAGATGGTACTGAGTGCTTACAACATTTGATT 4270 4280 4290 4300 4310 4320 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTTACCACGTTCTGCGTACCGAACTGTCTACCATGACTCACGAATGTTGTAAACTAA / / /// //// // / / CviRI* | ||| |||HgaI || DdeI HinfI | ||| ||BspCNI |Csp6I TfiI | ||| |BseMII RsaI | ||| BccI | ||CviJI | |FatI | CviAII NlaIII E E W C K T H G L T D G T E C L Q H L I R N G A R R M A * Q M V L S A Y N I * F G M V Q D A W L D R W Y * V L T T F D S ----:----|----:----|----:----|----:----|----:----|----:----| S S H H L V C P K V S P V S H K C C K I L P I T C S A H S S L H Y Q T S V V N S L F P A L R M A Q C I T S L A * L M Q N Hpy188I | AciI | | DdeI BbvII* | | EspI* | EcoRV | | | AluI | |MnlI | | | CviJI AccI | |MboII | | | |TspGWI |BssNAI | || SmlI | | | ||SetI |Hpy166II | || AflII | | | ||| CviRI* || TaqI | || |MseI \ \ \ \\\ \ \\ \ \ \\ \\ CAGACCGCTAAGCTACTGCAAGTCCGTAAGTATACTATCGAAGACATTGATATCTTAAGA 4330 4340 4350 4360 4370 4380 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTGGCGATTCGATGACGTTCAGGCATTCATATGATAGCTTCTGTAACTATAGAATTCT / / /// / // / / // | | ||CviJI CviRI* |AccI TaqI | |AflII | | ||AluI Hpy166II | |SmlI | | |TspGWI BssNAI | MseI | | |EspI* BbvII* | | |DdeI MboII | | SetI EcoRV | AciI MnlI Hpy188I Q T A K L L Q V R K Y T I E D I D I L R R P L S Y C K S V S I L S K T L I S * E D R * A T A S P * V Y Y R R H * Y L K R ----:----|----:----|----:----|----:----|----:----|----:----| * V A L S S C T R L Y V I S S M S I K L E S R * A V A L G Y T Y * R L C Q Y R L L G S L * Q L D T L I S D F V N I D * S SetI BssKI |CviRI* SexAI || MfeI EcoRII || TspEI | Hin4I || | AarI | Hin4I || | BspMI | ScrFI ApoI || | | CviRI* | BseBI TspEI BsgI || | | | TspEI | | SetI \ \ \\ \ \ \ \ \ \ \ GGAATTTGTTATTCGCTAACACCTGCACAATTGCAAAAATTGATTTCACAATACCAGGTG 4390 4400 4410 4420 4430 4440 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTAAACAATAAGCGATTGTGGACGTGTTAACGTTTTTAACTAAAGTGTTATGGTCCAC / / / /// / / // / TspEI SetI CviRI* ||BspMI TspEI | || EcoRII ApoI ||AarI | || SexAI BsgI |CviRI* | || BssKI TspEI | |BseBI MfeI | |ScrFI | SetI Hin4I Hin4I G I C Y S L T P A Q L Q K L I S Q Y Q V E F V I R * H L H N C K N * F H N T R W N L L F A N T C T I A K I D F T I P G G ----:----|----:----|----:----|----:----|----:----|----:----| P I Q * E S V G A C N C F N I E C Y W T L F K N N A L V Q V I A F I S K V I G P S N T I R * C R C L Q L F Q N * L V L H Eam1105I | TspEI | BsmAI SmlI MaeII | |PleI Hin4I AflII | SetI BbvI |HinfI ||MlyI Hin4I |MseI | TaiI | MseI \\ \\\ \ \\ \ \ \ \ GCAGACTATGAGTCTCCAATTCCACAGGAAATCTTAAGATACGTTGCTGATATAGTTAAG 4450 4460 4470 4480 4490 4500 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCTGATACTCAGAGGTTAAGGTGTCCTTTAGAATTCTATGCAACGACTATATCAATTC / / / // // / / / | HinfI | |Hin4I || | MaeII MseI Eam1105I | |Hin4I || TaiI BbvI | BsmAI || SetI | TspEI |AflII PleI |SmlI MlyI MseI A D Y E S P I P Q E I L R Y V A D I V K Q T M S L Q F H R K S * D T L L I * L R R L * V S N S T G N L K I R C * Y S * E ----:----|----:----|----:----|----:----|----:----|----:----| A S * S D G I G C S I K L Y T A S I T L P L S H T E L E V P F R L I R Q Q Y L * C V I L R W N W L F D * S V N S I Y N L MaeIII TseI Tsp45I AluI | BsiI* CviJI | Hpy178III* |BisI | | TseI |MboII SetI | | |BisI |TspDTI | TfiI | | ||BlsI ||BlsI | HinfI | | |||GsuI ||SetI | | DdeI | | |||Eco57MI \\\ \ \ \ \ \ \\\\ AAAGAAGCTGCGTTATCTTCATCAGGTAATGATTCTAAGGGTCACGAGCATAGCAGCAGT 4510 4520 4530 4540 4550 4560 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTCGACGCAATAGAAGTAGTCCATTACTAAGATTCCCAGTGCTCGTATCGTCGTCA ////// / / / / / /// |||||TseI SetI | DdeI | BsiI* ||TseI ||||BisI HinfI | |BisI |||BlsI TfiI | Eco57MI ||CviJI | BlsI ||MboII | GsuI ||AluI Hpy178III* |TspDTI Tsp45I SetI MaeIII K E A A L S S S G N D S K G H E H S S S K K L R Y L H Q V M I L R V T S I A A V R S C V I F I R * * F * G S R A * Q Q Y ----:----|----:----|----:----|----:----|----:----|----:----| F S A A N D E D P L S E L P * S C L L L S L L Q T I K M L Y H N * P D R A Y C C F F S R * R * * T I I R L T V L M A A T Hpy178III* | BsiYI* | | AsuI* | | AvaII | | |BmgT120I | | ||SetI BbvI | | ||EcoP15I \ \ \ \\\ ATATTTATCACTCCAGAAACAGGTCCATTTACTGACCCATTCAGTTTGATAAAGACAAGA 4570 4580 4590 4600 4610 4620 ----:----|----:----|----:----|----:----|----:----|----:----| TATAAATAGTGAGGTCTTTGTCCAGGTAAATGACTGGGTAAGTCAAACTATTTCTGTTCT / // / /// BbvI || | ||EcoP15I || | |AvaII || | |AsuI* || | BmgT120I || SetI |BsiYI* Hpy178III* I F I T P E T G P F T D P F S L I K T R Y L S L Q K Q V H L L T H S V * * R Q E I Y H S R N R S I Y * P I Q F D K D K K ----:----|----:----|----:----|----:----|----:----|----:----| I N I V G S V P G N V S G N L K I F V L Y I * * E L F L D M * Q G M * N S L S L Y K D S W F C T W K S V W E T Q Y L C S ApoI CviJI DdeI TspEI BarI | TsoI BarI | MnlI \ \ \ \ \ \ \ AAATTTGACCAAGTAGAAGCCTATATACCAGCGTGGTTATCCTTGCCCTCAACTAAGAGA 4630 4640 4650 4660 4670 4680 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAAACTGGTTCATCTTCGGATATATGGTCGCACCAATAGGAACGGGAGTTGATTCTCT / / / / / / | TspEI | TsoI BarI MnlI | ApoI CviJI DdeI BarI K F D Q V E A Y I P A W L S L P S T K R N L T K * K P I Y Q R G Y P C P Q L R E I * P S R S L Y T S V V I L A L N * E N ----:----|----:----|----:----|----:----|----:----|----:----| F N S W T S A * I G A H N D K G E V L L F I Q G L L L R Y V L T T I R A R L * S F K V L Y F G I Y W R P * G Q G * S L S Hpy178III* HindII | CfrI Hpy166II | | CviJI | AjuI | | HaeIII | SetI | | | AjuI \ \ \ \ \ \ ATAGTTGACCTTGTTGCCCAACAAGTCGTTCAAGACGGCCACTAA 4690 4700 4710 4720 ----:----|----:----|----:----|----:----|----: TATCAACTGGAACAACGGGTTGTTCAGCAAGTTCTGCCGGTGATT // / / / |SetI | | CfrI Hpy166II | HaeIII HindII | CviJI AjuI | AjuI Hpy178III* I V D L V A Q Q V V Q D G H * * L T L L P N K S F K T A T X S * P C C P T S R S R R P L X ----:----|----:----|----:----|----:----|----: I T S R T A W C T T * S P W * F L Q G Q Q G V L R E L R G S Y N V K N G L L D N L V A V L # Enzymes that cut Frequency Isoschizomers AarI 1 AccI 2 FblI,XmiI AciI 16 BspACI,SsiI AclI 3 Psp1406I AflII 2 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 2 AhaIII* 1 DraI AjuI 1 AlfI 2 AluI 18 AluBI AlwNI 1 CaiI ApoI 13 AcsI,XapI AsuI* 7 Cfr13I,PspPI,Sau96I,AspS9I AsuII 3 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 7 Bme18I,Eco47I,SinI,VpaK11BI BamHI 1 BarI 1 BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 8 Bce83I* 1 BpuEI BceAI 2 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BdaI 4 BetI* 2 BsaWI BglII 2 BinI* 5 AlwI,BspPI,AclWI BisI 8 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 8 BmeT110I 1 BmgT120I 7 BplI 2 BsaBI 1 Bse8I,BseJI BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 4 BseRI 1 BseSI 1 BaeGI,BstSLI BseYI 3 BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 9 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 7 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 4 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 3 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 1 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 1 BstEII 2 BstPI,Eco91I,EcoO65I,PspEI BstKTI 13 BstXI 2 BtsI 2 Cac8I 5 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 2 AcoI,EaeI Csp6I 7 CviQI,RsaNI CviAII 16 CviJI 44 CviKI-1 CviRI* 22 HpyCH4V DdeI 15 BstDEI,HpyF3I DpnI 13 MalI DraII 2 EcoO109I DsaI* 2 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI EciI 2 Eco47III 1 Aor51HI,AfeI Eco57I 2 AcuI Eco57MI 4 EcoNI 1 BstENI,XagI EcoP15I 2 EcoRI 1 EcoRII 4 AjnI,Psp6I,PspGI EcoRV 2 Eco32I EcoT22I 3 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FatI 16 FauI 3 SmuI FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 GlaI 3 GsaI 3 GsuI 2 BpmI HaeII 1 BstH2I HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgaI 4 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 3 BstHHI,CfoI,AspLEI Hin4I 16 Hin4II* 6 HpyAV Hin6I 3 HinP1I,HspAI HindII 5 HincII HindIII 3 HinfI 17 HpaI 2 KspAI HpaII 4 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 13 Hpy8I Hpy178III* 18 Hpy188III Hpy188I 16 Hpy99I 2 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 12 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 15 MboI 13 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 28 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 9 MunI MluI 1 MlyI 1 SchI MmeI 6 MnlI 16 MseI 29 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 6 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 16 Hin1II,Hsp92II,FaeI NlaIV 7 BspLI,BmiI,PspN4I NmeAIII 1 NruI 1 BtuMI,Bsp68I NspBII* 3 MspA1I NspI 2 BstNSI,XceI PleI 1 PpsI PpuMI 2 Psp5II,PspPPI PshAI 1 BstPAI,BoxI PsiI 1 AanI PvuI 1 MvrI,Ple19I,BpvUI PvuII 2 RsaI 7 AfaI SalI 1 SapI 1 LguI,PciSI,BspQI ScrFI 5 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 6 BseDI,BssECI,BsaJI SetI 55 SexAI 2 MabI SfaNI 14 LweI SfeI* 4 BstSFI,SfcI,BfmI SmlI 3 SmoI SpeI 1 BcuI,AhlI SspI 2 StuI 1 Eco147I,PceI,SseBI,AatI StyI 4 Eco130I,EcoT14I,ErhI,BssT1I TaiI 7 TaqI 9 TaqII 1 TatI 2 TauI 3 TfiI 16 PfeI TseI 5 ApeKI TsoI 5 Tsp45I 6 NmuCI Tsp4CI* 13 HpyCH4III,TaaI,Bst4CI TspDTI 19 TspEI 61 TasI,Tsp509I,Sse9I TspGWI 8 TspRI 7 TscAI VspI 2 PshBI,AseI XbaI 3 XcmI 3 XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AcyI AgeI AloI ApaI ApaLI AscI Asp718I AvrII BaeI BalI BbvCI BcgI BfiI BglI BmtI Bpu10I BsaAI BsaXI BsePI BsmI Bsp120I BspOI BsrBI BtgZI BtrI Cfr10I Cfr9I ClaI CspCI DinI DraIII DrdI Ecl136II Eco31I EcoICRI EgeI EheI FalI FseI FspAI HgiJII* KasI KpnI MauBI MroNI MstI* NaeI NarI NcoI NgoMIV NheI NotI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PspOMI PspXI PsrI PstI RsrII SacI SacII SanDI SauI* ScaI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I SwaI TspMI TstI Tth111I XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769