Restriction Map of LDB19/YOR322C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

LDB19/YOR322C on chromosome XV from coordinates 921062 to 918606.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.3692

EMBOSS_001 MaeII |BtrI CviJI || SetI |SfeI* || TaiI || Tsp4CI* BceAI \\ \ \\ \ \ ATGGCATTTTCACGTCTTACATCTACTCATCAGTCCAATCATAACGGCTACAGTAATAGC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGTAAAAGTGCAGAATGTAGATGAGTAGTCAGGTTAGTATTGCCGATGTCATTATCG / // / // | |MaeII | |SfeI* | BtrI | Tsp4CI* TaiI CviJI SetI M A F S R L T S T H Q S N H N G Y S N S W H F H V L H L L I S P I I T A T V I A G I F T S Y I Y S S V Q S * R L Q * * Q ----:----|----:----|----:----|----:----|----:----|----:----| X A N E R R V D V * * D L * L P * L L L X P M K V D * M * E D T W D Y R S C Y Y H C K * T K C R S M L G I M V A V T I A AciI | MslI MboII | |FatI BbvII* Hin4I TfiI | ||CviAII | Tth111I Hin4I HphI HinfI | ||| NlaIII \ \ \ \ \ \ \\\ \ AACAAAAAAGGACAAAGTCTTCCACTAACCCTTTCTATTGATGTAGAATCACCGCCATGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTTTTTCCTGTTTCAGAAGGTGATTGGGAAAGATAACTACATCTTAGTGGCGGTACA / / // / / / // // BceAI | |Tth111I Hin4I HphI | || |FatI | BbvII* Hin4I | || CviAII MboII | || Hin4I | || Hin4I | |NlaIII | MslI | AciI HinfI TfiI N K K G Q S L P L T L S I D V E S P P C T K K D K V F H * P F L L M * N H R H V Q K R T K S S T N P F Y * C R I T A M C ----:----|----:----|----:----|----:----|----:----|----:----| L L F P C L R G S V R E I S T S D G G H C C F L V F D E V L G K * Q H L I V A M V F F S L T K W * G K R N I Y F * R W T SetI |AlwNI || MnlI TfiI || | DdeI HinfI || | BspCNI MaeIII Hin4I | DdeI || | |BseMII Tsp45I Hin4I | SauI* || | || Hpy166II Tsp4CI* \ \ \ \\ \ \\ \ \ GTTCTTTATGGGTCTGCTATGGAATCCTCAGGTGCTGTGCTAAGTGGACTTTTTACTGTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGAAATACCCAGACGATACCTTAGGAGTCCACGACACGATTCACCTGAAAAATGACAC / /// / // / / / | ||| | || | Hpy166II Tsp4CI* | ||| | || DdeI | ||| | |BseMII | ||| | BspCNI | ||| MnlI | ||AlwNI | |SauI* | |DdeI | SetI HinfI TfiI V L Y G S A M E S S G A V L S G L F T V F F M G L L W N P Q V L C * V D F L L * S L W V C Y G I L R C C A K W T F Y C D ----:----|----:----|----:----|----:----|----:----|----:----| T R * P D A I S D E P A T S L P S K V T H E K H T Q * P I R L H Q A L H V K * Q N K I P R S H F G * T S H * T S K K S H Tsp4CI* |BinI* |PshAI MseI || TaqI MboII || |MboI |AhaIII* || || DpnI || Eco57I || || |BstKTI || Eco57MI || || || SfeI* || | TfiI || || || | Tsp4CI* || | HinfI \\ \\ \\ \ \ \\ \ \ ACGGTTGTCGATCCCTACAGTAGTGCTGAAGATAAATCTTTAAAGAATACAGAATCTAAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGCCAACAGCTAGGGATGTCATCACGACTTCTATTTAGAAATTTCTTATGTCTTAGATTA / // // / // / // / / | || || MboI |SfeI* | || Eco57MI HinfI | || |DpnI Tsp4CI* | || Eco57I TfiI | || BstKTI | |MseI | || TaqI | AhaIII* | |BinI* MboII | PshAI Tsp4CI* Tsp45I MaeIII T V V D P Y S S A E D K S L K N T E S N R L S I P T V V L K I N L * R I Q N L M G C R S L Q * C * R * I F K E Y R I * C ----:----|----:----|----:----|----:----|----:----|----:----| V T T S G * L L A S S L D K F F V S D L S P Q R D R C Y H Q L Y I K L S Y L I * R N D I G V T T S F I F R * L I C F R I SalI |TaqI BsgI XbaI |AccI | TatI |MaeI ||HindII | |Csp6I TspDTI |PsrI ||Hpy166II CviJI PsrI | ||RsaI | CviRI* |Hpy178III* \\\ \ \ \ \\\ \ \ \\ GTGTCGACTACTTCTAAAAGCCTAAAAAGAAAGAGTACATTTGGTTCTGCACTTTCATCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CACAGCTGATGAAGATTTTCGGATTTTTCTTTCTCATGTAAACCAAGACGTGAAAGTAGA /// / / / /// / / / ||SalI | PsrI BsgI ||| TspDTI | PsrI |AccI CviJI ||TatI CviRI* |TaqI |Csp6I Hpy166II RsaI HindII V S T T S K S L K R K S T F G S A L S S C R L L L K A * K E R V H L V L H F H L V D Y F * K P K K K E Y I W F C T F I * ----:----|----:----|----:----|----:----|----:----|----:----| T D V V E L L R F L F L V N P E A S E D H T S * K * F G L F F S Y M Q N Q V K M H R S S R F A * F S L T C K T R C K * R SalI SgrDI |TaqI |AccI ||HindII ||Hpy166II |||Hpy99I ||||AcyI ||||MaeII |||||ZraI HgaI ||||||Hpy99I | AluI |||||||SetI | CviJI |||||||TaiI MboII Hin4II* | | SetI |||||||AatII |FokI | BseGI \ \ \ \\\\\\\\ \\ \ \ AGATTGTCCAGCTTGTCAGCGTCGACGTCAAATATCTCTCCTTCAACATCTTCTACATCC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAACAGGTCGAACAGTCGCAGCTGCAGTTTATAGAGAGGAAGTTGTAGAAGATGTAGG // / / / / ////// / / / / |XbaI | | HgaI | |||||MaeII MboII | | BseGI | | CviJI | |||||AcyI | Hin4II* | | AluI | ||||ZraI FokI | SetI | |||SgrDI Hpy178III* | |||SalI MaeI | ||AatII | ||AccI | ||TaqI | ||TaiI | ||SetI | |Hpy166II | |HindII | Hpy99I Hpy99I R L S S L S A S T S N I S P S T S S T S D C P A C Q R R R Q I S L L Q H L L H P I V Q L V S V D V K Y L S F N I F Y I H ----:----|----:----|----:----|----:----|----:----|----:----| L N D L K D A D V D F I E G E V D E V D * I T W S T L T S T L Y R E K L M K * M S Q G A Q * R R R * I D R R * C R R C G Cac8I | TspEI MboI | | MseI | DpnI BsmI | | | TsoI CviJI HphI | |BstKTI \ \ \ \ \ \ \ \ \\ ATATCGCATTCTCCCACGCCTGCTAATTTAAGAATAATGGCTGGTTATACCAAGATCACC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TATAGCGTAAGAGGGTGCGGACGATTAAATTCTTATTACCGACCAATATGGTTCTAGTGG / / / / / / // / BsmI Cac8I | MseI CviJI HphI || MboI | TsoI |DpnI TspEI BstKTI I S H S P T P A N L R I M A G Y T K I T Y R I L P R L L I * E * W L V I P R S P I A F S H A C * F K N N G W L Y Q D H H ----:----|----:----|----:----|----:----|----:----|----:----| M D C E G V G A L K L I I A P * V L I V W I A N E W A Q * N L F L P Q N Y W S * Y R M R G R R S I * S Y H S T I G L D G Csp6I |RsaI MaeII ||BinI* | SetI ||| MboI | TaiI ||| XhoII | | MaeIII ||| | DpnI | | Hpy99I DdeI ||| | |BstKTI MboII \ \ \ \ \\\ \ \\ \ ATTACGTCGGTAACACTAAGTTTGGTACAGAAGATCCATTTCCATAAACCCTTTGTGCCT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGCAGCCATTGTGATTCAAACCATGTCTTCTAGGTAAAGGTATTTGGGAAACACGGA // / / / /// // / / || MaeII | DdeI ||| || | MboII |Hpy99I MaeIII ||| || XhoII TaiI ||| || MboI SetI ||| |DpnI ||| BstKTI ||BinI* |Csp6I RsaI I T S V T L S L V Q K I H F H K P F V P L R R * H * V W Y R R S I S I N P L C L Y V G N T K F G T E D P F P * T L C A * ----:----|----:----|----:----|----:----|----:----|----:----| M V D T V S L K T C F I W K W L G K T G W * T P L V L N P V S S G N G Y V R Q A N R R Y C * T Q Y L L D M E M F G K H R FatI |CviAII || NlaIII CviRI* || | AluI | MnlI || | BseYI SspI | | SetI Tsp4CI* TspDTI || | CviJI \ \ \ \ \ \ \\ \ \ AATATTTCCTCAATGCAAACCTGTATGAACTGTAAAACAAAGATTACAAACATGAAAAGC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTATAAAGGAGTTACGTTTGGACATACTTGACATTTTGTTTCTAATGTTTGTACTTTTCG / / // / / / // / / SspI | |SetI Tsp4CI* TspDTI | || | CviJI | MnlI | || | AluI CviRI* | || | GsaI | || SetI | |FatI | CviAII NlaIII N I S S M Q T C M N C K T K I T N M K S I F P Q C K P V * T V K Q R L Q T * K A Y F L N A N L Y E L * N K D Y K H E K L ----:----|----:----|----:----|----:----|----:----|----:----| L I E E I C V Q I F Q L V F I V F M F L * Y K R L A F R Y S S Y F L S * L C S F I N G * H L G T H V T F C L N C V H F A BssKI SecI* EcoRII | ScrFI | BseBI SetI | | MboI | GsaI | | XhoII | | ApoI | | | DpnI | | TspEI | | | |BstKTI | | | TspDTI | | | || FalI | | | | Hpy188I | | | || FalI | | | | | MmeI | | | || | BinI* CviJI \ \ \ \ \ \ \ \ \ \\ \ \ \ TGGGAAATTCAGAGTAATACCCAGGATCTTTCTGTTGGAAGCCACTCTTACCCATTTTCC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCTTTAAGTCTCATTATGGGTCCTAGAAAGACAACCTTCGGTGAGAATGGGTAAAAGG / / // / //// / / / / | | || MmeI |||| | BinI* CviJI FalI | | |Hpy188I |||| XhoII FalI | | TspEI |||| MboI | | ApoI |||DpnI | TspDTI ||EcoRII BseYI ||BstKTI ||BssKI ||FalI ||FalI |SecI* BseBI ScrFI W E I Q S N T Q D L S V G S H S Y P F S G K F R V I P R I F L L E A T L T H F P G N S E * Y P G S F C W K P L L P I F L ----:----|----:----|----:----|----:----|----:----|----:----| Q S I * L L V W S R E T P L W E * G N E S P F E S Y Y G P D K Q Q F G S K G M K P F N L T I G L I K R N S A V R V W K G FalI FalI | BslFI | | BssKI | | |SecI* | | |HpaII | | ||ScrFI | | ||CauII* | | ||| BtgZI | | ||| | MboII BssKI | | ||| | TspDTI SecI* | | ||| | | FatI EcoRII | | ||| | | |CviAII | ScrFI | | ||| | | || NlaIII MaeI SetI CviJI | BseBI \ \ \\\ \ \ \\ \ \ \ \ \ \ TATCTTATACCGGGGTCTGTCCCATGTTCTTCATCGCTAGGTGCTACGGCTGAAACCCAG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGAATATGGCCCCAGACAGGGTACAAGAAGTAGCGATCCACGATGCCGACTTTGGGTC / / / // // // // / /// | | | || || |FatI |MaeI CviJI ||SecI* | | | || || CviAII SetI |BseBI | | | || |NlaIII |ScrFI | | | || BtgZI SetI | | | |MboII | | | TspDTI | | BssKI | | SecI* | CauII* | HpaII | ScrFI BslFI Y L I P G S V P C S S S L G A T A E T Q I L Y R G L S H V L H R * V L R L K P R S Y T G V C P M F F I A R C Y G * N P G ----:----|----:----|----:----|----:----|----:----|----:----| * R I G P D T G H E E D S P A V A S V W R D * V P T Q G M N K M A L H * P Q F G I K Y R P R D W T R * R * T S R S F G L MaeIII Tsp45I | MaeII | | SetI | | TaiI | | BinI* | | | MboI ApoI | | | XhoII TspEI SetI | | | | DpnI | MnlI BceAI | | | | |BstKTI | MboII \ \ \ \ \ \\ \ \ GTCAAATACGAACTTATCGCTGTTGTGACGTATATAGATCCTCATAGAAATTCCTTTTCT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTTATGCTTGAATAGCGACAACACTGCATATATCTAGGAGTATCTTTAAGGAAAAGA / / / // / // / / / | BceAI | || | || XhoII | TspEI EcoRII | || | || MboI | ApoI BssKI | || | |DpnI MboII | || | BstKTI MnlI | || BinI* | |MaeII | Tsp45I | MaeIII TaiI SetI V K Y E L I A V V T Y I D P H R N S F S S N T N L S L L * R I * I L I E I P F L Q I R T Y R C C D V Y R S S * K F L F F ----:----|----:----|----:----|----:----|----:----|----:----| T L Y S S I A T T V Y I S G * L F E K E P * I R V * R Q Q S T Y L D E Y F N R K D F V F K D S N H R I Y I R M S I G K R AluI BssKI CviJI SecI* |XmnI MwoI EcoRII ||SetI | SfaNI | ScrFI ||| DdeI | |BtgZI | BseBI ||| |SapI | |CviRI* BetI* | |Hin4II* ||| |Ksp632I* | || MaeI |HpaII | || MboII ||| || AciI | || BceAI \\ \ \\ \ \\\ \\ \ \ \\ \ TCCGGTCATTCTACTCCCAGGAAAGAAGGAAGCTCTTCTAAGAAGCGGTTGTTGCAACTA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCCAGTAAGATGAGGGTCCTTTCTTCCTTCGAGAAGATTCTTCGCCAACAACGTTGAT // //// / / // // // / // / |BetI* |||| | | |XmnI || |MwoI | || BceAI HpaII |||| | | CviJI || AciI | || MaeI |||| | | AluI |Ksp632I* | |BtgZI |||| | SetI |SapI | SfaNI |||| MboII DdeI CviRI* |||EcoRII |||BssKI ||SecI* |BseBI |ScrFI Hin4II* S G H S T P R K E G S S S K K R L L Q L P V I L L P G K K E A L L R S G C C N * R S F Y S Q E R R K L F * E A V V A T S ----:----|----:----|----:----|----:----|----:----|----:----| E P * E V G L F S P L E E L F R N N C S K R D N * E W S L L F S K * S A T T A V G T M R S G P F F S A R R L L P Q Q L * AccI |FauI |BssNAI |Hpy166II || AciI || | Hin6I BsaBI || | FnuDII* | MlyI || | |GlaI | PleI || | ||AciI | |MslI || | ||HhaI | || MaeIII || | ||FnuDII* | || Tsp45I || | ||| AsuI* | || |BccI || | ||| Cac8I | || |BtgZI || | ||| |BmgT120I ApoI DdeI | || || HinfI || | ||| ||CviJI TspEI EcoP15I | || || | TaqI || | ||| ||HaeIII EcoRI | EcoP15I \ \\ \\ \ \ \\ \ \\\ \\\ \ \ \ GCGATGCCCATCGCCGTGACTCGAAGTATACCGCGCGGGCCTGATAAGAATTCTCTAAGA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CGCTACGGGTAGCGGCACTGAGCTTCATATGGCGCGCCCGGACTATTCTTAAGAGATTCT / // / // / /// /// / // / // / | || | || TaqI ||| ||| | |AsuI* | || EcoP15I | || | |HinfI ||| ||| | BmgT120I | |DdeI | || | Tsp45I ||| ||| | HaeIII | EcoP15I | || | MaeIII ||| ||| | CviJI EcoRI | || | BtgZI ||| ||| Cac8I TspEI | || BccI ||| ||| AciI ApoI | |MslI ||| ||FnuDII* | |PleI ||| ||Hin6I | MlyI ||| |GlaI BsaBI ||| FnuDII* ||| AciI ||| HhaI ||FauI |AccI Hpy166II BssNAI A M P I A V T R S I P R G P D K N S L R R C P S P * L E V Y R A G L I R I L * E D A H R R D S K Y T A R A * * E F S K S ----:----|----:----|----:----|----:----|----:----|----:----| A I G M A T V R L I G R P G S L F E R L L S A W R R S E F Y V A R A Q Y S N E L R H G D G H S S T Y R A P R I L I R * S SfeI* |BbvI || BbvI || | MnlI || | | MseI || | | |HpaI || | | |HindII || | | |Hpy166II || | | || TseI || | | || |BisI || | | || ||BlsI || | | || |||TseI || | | || |||MboII || | | || ||||BisI EcoP15I || | | || |||||BlsI \ \\ \ \ \\ \\\\\\ GTATTTCCTCCTACAGAGTTAACTGCTGCTGCTGTTCTTCCTAATGTTGTATATCCTAAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CATAAAGGAGGATGTCTCAATTGACGACGACGACAAGAAGGATTACAACATATAGGATTT / // /// ////// EcoP15I || ||MseI |||||TseI || || ||||BisI || || |||BlsI || || ||TseI || || |MboII || || |BisI || || BlsI || |Hpy166II || |HindII || |HpaI || BbvI |MnlI |BbvI SfeI* V F P P T E L T A A A V L P N V V Y P K Y F L L Q S * L L L L F F L M L Y I L N I S S Y R V N C C C C S S * C C I S * I ----:----|----:----|----:----|----:----|----:----|----:----| T N G G V S N V A A A T R G L T T Y G L L I E E * L T L Q Q Q Q E E * H Q I D * Y K R R C L * S S S S N K R I N Y I R F MboII | Tsp4CI* TspEI | | TspDTI BccI MmeI \ \ \ \ \ \ TCTACTTTTCCTTTGGAGATGAAATTAGACGGTGTTTCTTCGGGGGATAGGAGATGGCGA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGAAAAGGAAACCTCTACTTTAATCTGCCACAAAGAAGCCCCCTATCCTCTACCGCT / / / / / / | | | TspDTI BccI MmeI | | Tsp4CI* | MboII TspEI S T F P L E M K L D G V S S G D R R W R L L F L W R * N * T V F L R G I G D G E Y F S F G D E I R R C F F G G * E M A N ----:----|----:----|----:----|----:----|----:----|----:----| D V K G K S I F N S P T E E P S L L H R I * K E K P S S I L R H K K P P Y S I A R S K R Q L H F * V T N R R P I P S P S FatI |CviAII || NspI BsmI MboII || NlaIII | TspEI TspEI | MseI || | BsrI \ \ \ \ \ \\ \ \ ATGCGTAAATTGAGTTGGAGAATTGAAGAAACTACAAGAGTTAAAGCACATGCTTGTCCA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TACGCATTTAACTCAACCTCTTAACTTCTTTGATGTTCTCAATTTCGTGTACGAACAGGT / / / / / / // / BsmI TspEI TspEI MboII MseI | || TspRI | || BsrI | |FatI | CviAII NlaIII NspI M R K L S W R I E E T T R V K A H A C P C V N * V G E L K K L Q E L K H M L V Q A * I E L E N * R N Y K S * S T C L S S ----:----|----:----|----:----|----:----|----:----|----:----| I R L N L Q L I S S V V L T L A C A Q G F A Y I S N S F Q L F * L L * L V H K D H T F Q T P S N F F S C S N F C M S T W ApaLI | CviRI* | Hpy166II | | SduI | | BseSI | | TspRI | | HgiAI* | | | MslI | | | |FatI | | | ||CviAII SapI HinfI | | | |||MnlI Ksp632I* MseI | Hpy188I | | | |||| TspEI |BspMI SetI | | PleI | | | |||| NlaIII || TspDTI | MboII | | |MlyI \ \ \ \\\\ \ \\ \ \ \ \ \ \\ GTGCACAAGCATGAATTGAGGCAGTTAGAAGAGCAGGTTAAAATAAAAGAGTCAGAAAAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CACGTGTTCGTACTTAACTCCGTCAATCTTCTCGTCCAATTTTATTTTCTCAGTCTTTTT / / / /// // / / / / / // // / | | | ||| || TspEI | | BspMI SetI |MseI || PleI | | | ||| |FatI | Ksp632I* MboII || MlyI | | | ||| CviAII | SapI |Hpy188I | | | ||MnlI TspDTI HinfI | | | |NlaIII | | | MslI | | ApaLI | Hpy166II | CviRI* HgiAI* BseSI SduI V H K H E L R Q L E E Q V K I K E S E K C T S M N * G S * K S R L K * K S Q K K A Q A * I E A V R R A G * N K R V R K K ----:----|----:----|----:----|----:----|----:----|----:----| T C L C S N L C N S S C T L I F S D S F L A C A H I S A T L L A P * F L L T L F H V L M F Q P L * F L L N F Y F L * F F Hpy166II | MaeI | | AsuI* | | |CviJI BssKI | | |HaeIII |HpaII | | |BmgT120I ||ScrFI CviJI MseI | | || HphI ||CauII* \ \ \ \ \\ \ \\\ AGTAAAAAGCCACGCAGTCATATTAAGCGTTATGGTGAACTAGGCCCACAAATCCGGGTT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTTTTCGGTGCGTCAGTATAATTCGCAATACCACTTGATCCGGGTGTTTAGGCCCAA / / / / /// / / CviJI MseI | | ||AsuI* | BssKI | | |BmgT120I CauII* | | |HphI HpaII | | HaeIII ScrFI | | CviJI | MaeI Hpy166II S K K P R S H I K R Y G E L G P Q I R V V K S H A V I L S V M V N * A H K S G L * K A T Q S Y * A L W * T R P T N P G C ----:----|----:----|----:----|----:----|----:----|----:----| L L F G R L * I L R * P S S P G C I R T F Y F A V C D Y * A N H H V L G V F G P T F L W A T M N L T I T F * A W L D P N Hpy99I | CviJI | | BssKI | | EcoRII | | | ScrFI | | | BseBI | | | | Cac8I | | | | | BssKI | | | | | CviJI | | | | | | SduI | | | | | | HpaII | | | | | | ScrFI | | | | | | CauII* | | | | | | HgiJII* CviRI* | | | | | | | McrI* | Hpy166II | | | | | | | |Hpy178III* | | BceAI | | | | | | | || Hpy166II \ \ \ \ \ \ \ \ \ \ \\ \ GCAGTAAACTCTTTAGAAAATATGCCGTCGCAAAGGCTTCCAGGCGAGCCCGGTCGTGAA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCATTTGAGAAATCTTTTATACGGCAGCGTTTCCGAAGGTCCGCTCGGGCCAGCACTT / / / / / / / / / /// // | | BceAI Hpy99I CviJI | | | | ||| |Hpy166II | Hpy166II | | | | ||| Hpy178III* CviRI* | | | | ||BssKI | | | | |HpaII | | | | |McrI* | | | | CauII* | | | | ScrFI | | | CviJI | | HgiJII* | | Cac8I | | SduI | EcoRII | BssKI BseBI ScrFI A V N S L E N M P S Q R L P G E P G R E Q * T L * K I C R R K G F Q A S P V V N S K L F R K Y A V A K A S R R A R S * T ----:----|----:----|----:----|----:----|----:----|----:----| A T F E K S F I G D C L S G P S G P R S Q L L S K L F Y A T A F A E L R A R D H C Y V R * F I H R R L P K W A L G T T F AsuI* MboII AvaII | SetI |NlaIV HindII | TspEI |BmgT120I Hpy166II | | HgaI ||MmeI | BsrI BsaBI \ \ \ \\\ \ \ \ CAAGCACCTAATTCTTCGGGTCCAGCGTCAACTGGTAATGTTGGACTTGATGATGAAAAT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCGTGGATTAAGAAGCCCAGGTCGCAGTTGACCATTACAACCTGAACTACTACTTTTA // / //// / / / |SetI TspEI |||AvaII | BsrI BsaBI MboII |||AsuI* Hpy166II ||| HindII ||BmgT120I |NlaIV HgaI MmeI Q A P N S S G P A S T G N V G L D D E N K H L I L R V Q R Q L V M L D L M M K I S T * F F G S S V N W * C W T * * * K S ----:----|----:----|----:----|----:----|----:----|----:----| C A G L E E P G A D V P L T P S S S S F V L V * N K P D L T L Q Y H Q V Q H H F L C R I R R T W R * S T I N S K I I F I ApoI TspEI MboII EcoRI |TspDTI | BseGI || BbvII* | | BfiI || |BssKI | | |BseGI || ||FokI | | || BsrI || |||HpaII | | || MslI || |||ScrFI | | || | MaeIII || |||CauII* | | || | Tsp45I MseI || ||||TspDTI | | || | |BccI | TspDTI || |||||MboII | | || | || HgaI | |MnlI || ||||||FokI | | || | || | TspRI \ \\ \\ \\\\\\\ \ \ \\ \ \\ \ \ CCTGTTAATGAAGATGAGGAAGACCAACCCGGTAGCGAATTCATCCATCCCAGTGACGAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GGACAATTACTTCTACTCCTTCTGGTTGGGCCATCGCTTAAGTAGGTAGGGTCACTGCTG /// / / /// / / / / / / / // / ||MnlI TspDTI | ||| | | | | | | | || HgaI |MseI MboII | ||| | | | | | | | |Tsp45I TspDTI | ||| | | | | | | | |MaeIII | ||| | | | | | | | Hpy99I | ||| | | | | | | BccI | ||| | | | | | MslI | ||| | | | | TspRI | ||| | | | | BsrI | ||| | | | BseGI | ||| | | | BfiI | ||| | | EcoRI | ||| | | TspEI | ||| | | ApoI | ||| | BseGI | ||| FokI | ||BssKI | ||FokI | |HpaII | BbvII* | CauII* | MboII | ScrFI TspDTI P V N E D E E D Q P G S E F I H P S D D L L M K M R K T N P V A N S S I P V T T C * * R * G R P T R * R I H P S Q * R R ----:----|----:----|----:----|----:----|----:----|----:----| G T L S S S S S W G P L S N M W G L S S D Q * H L H P L G V R Y R I * G D W H R R N I F I L F V L G T A F E D M G T V V Hin6I Hpy99I TseI FnuDII* | HgaI CviRI* |GlaI | | Hpy178III* |BisI |BbvI | | | MaeIII ||BlsI ||HhaI \ \ \ \ \\\ \\\ GCTTTGCGTCAGGAGTTACTAATGCAGCAACAACGCGCAAGACAACAACAACTTCAACAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAACGCAGTCCTCAATGATTACGTCGTTGTTGCGCGTTCTGTTGTTGTTGAAGTTGTT / / //// /// / | | |||TseI ||| BbvI | | ||BisI ||Hin6I | | |BlsI |GlaI | | CviRI* FnuDII* | MaeIII HhaI Hpy178III* HgaI A L R Q E L L M Q Q Q R A R Q Q Q L Q Q L C V R S Y * C S N N A Q D N N N F N K F A S G V T N A A T T R K T T T T S T R ----:----|----:----|----:----|----:----|----:----|----:----| A K R * S N S I C C C R A L C C C S * C R K A D P T V L A A V V R L V V V V E V S Q T L L * * H L L L A C S L L L K L L XmnI | SetI AluI | | Hpy188I CviJI Ksp632I* | | | MboII | SetI Tsp4CI* |MnlI | | | TspGWI DdeI Ksp632I* \ \ \ \\ \ \ \ \ \ \ GAGCTAAAAAACAACAGTAGTTTATTTACGGAAGAGGTTCGGATAATATCTAAGGGAGAA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGATTTTTTGTTGTCATCAAATAAATGCCTTCTCCAAGCCTATTATAGATTCCCTCTT / / / / / // /// / | CviJI Tsp4CI* | | |XmnI ||MboII DdeI | AluI | | SetI |TspGWI SetI | Ksp632I* Hpy188I MnlI E L K N N S S L F T E E V R I I S K G E S * K T T V V Y L R K R F G * Y L R E K A K K Q Q * F I Y G R G S D N I * G R N ----:----|----:----|----:----|----:----|----:----|----:----| S S F F L L L K N V S S T R I I D L P S L A L F C C Y N I * P L P E S L I * P L L * F V V T T * K R F L N P Y Y R L S F AluI CviJI MboII |MaeI |BseGI ||SetI BccI |TspDTI FokI |||MaeIII \ \\ \ \\\\ ATGAAGAGTGGATGGAAAACCGATTTTGACAATAATGGAAAGATTGAGCTAGTTACAGAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTCTCACCTACCTTTTGGCTAAAACTGTTATTACCTTTCTAACTCGATCAATGTCTT / / / / / / / / | BccI TspDTI FokI | | MaeI MaeIII Ksp632I* MboII | CviJI BseGI | AluI SetI M K S G W K T D F D N N G K I E L V T E * R V D G K P I L T I M E R L S * L Q K E E W M E N R F * Q * W K D * A S Y R N ----:----|----:----|----:----|----:----|----:----|----:----| I F L P H F V S K S L L P F I S S T V S F S S H I S F R N Q C Y H F S Q A L * L H L T S P F G I K V I I S L N L * N C F FatI CviRI* |CviAII ||Cac8I ||EcoT22I ||| SphI ||| NspI BsmAI ||| CviRI* HgaI Esp3I ||| NlaIII | MseI AcyI | BetI* ||| | EcoT22I | |TspEI BslFI | |HpaII ||| | |TaqI SfaNI \ \\ \ \ \\ \\\ \ \\ \ ATAGATTGTATGGGACTTAATTCAGGCGTCTCTAATCCGGTAATGCATGCATCGACACTA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TATCTAACATACCCTGAATTAAGTCCGCAGAGATTAGGCCATTACGTACGTAGCTGTGAT // / / / / // / / /// / || TspEI | BslFI | || | | ||| TaqI |HgaI AcyI | || | | ||CviRI* MseI | || | | ||FatI | || | | |CviAII | || | | EcoT22I | || | | Cac8I | || | CviRI* | || | NlaIII | || | NspI | || | SphI | || EcoT22I | |BetI* | HpaII Esp3I BsmAI I D C M G L N S G V S N P V M H A S T L * I V W D L I Q A S L I R * C M H R H Y R L Y G T * F R R L * S G N A C I D T T ----:----|----:----|----:----|----:----|----:----|----:----| I S Q I P S L E P T E L G T I C A D V S F L N Y P V * N L R R * D P L A H M S V Y I T H S K I * A D R I R Y H M C R C * CviJI |BseYI BinI* || GsaI | MboI || | XcmI | BamHI SecI* || | |MslI | XhoII DsaI* || | || SfaNI | | DpnI | BsiYI* || | || | CviJI | | NlaIV | | Hin4II* || | || | | Cac8I | | |BstKTI \ \ \ \\ \ \\ \ \ \ \ \ \\ CAAACTCCTTCCACGGGCAATAAGAAGCCCAGCATCAATGTGGCTTGCGATATACAGGAT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTGAGGAAGGTGCCCGTTATTCTTCGGGTCGTAGTTACACCGAACGCTATATGTCCTA / / // // / / / / / / // SfaNI | |Hin4II* || | | MslI | SfaNI | |NlaIV | DsaI* || | XcmI | Cac8I | |DpnI | SecI* || BseYI CviJI | BstKTI BsiYI* |GsaI BinI* CviJI Q T P S T G N K K P S I N V A C D I Q D K L L P R A I R S P A S M W L A I Y R I N S F H G Q * E A Q H Q C G L R Y T G S ----:----|----:----|----:----|----:----|----:----|----:----| C V G E V P L L F G L M L T A Q S I C S V F E K W P C Y S A W C * H P K R Y V P L S R G R A I L L G A D I H S A I Y L I ApoI TspEI | BinI* | | BsiYI* PflMI BtsI | | | SetI CviJI BsiYI* TspRI CviRI* \ \ \ \ \ \ \ \ CCAAATTTAGGTTTGTATGTAAGCCACATCTTGGCAGTGGAAATAGTTGTTGCAGAAGAA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTAAATCCAAACATACATTCGGTGTAGAACCGTCACCTTTATCAACAACGTCTTCTT / / /// / / / / / / | | ||SetI | | TspRI BtsI CviRI* BsrDI | | |TspEI | BsiYI* | | |ApoI | PflMI | | BinI* CviJI | BsiYI* XhoII BamHI MboI P N L G L Y V S H I L A V E I V V A E E Q I * V C M * A T S W Q W K * L L Q K K K F R F V C K P H L G S G N S C C R R N ----:----|----:----|----:----|----:----|----:----|----:----| G F K P K Y T L W M K A T S I T T A S S D L N L N T H L G C R P L P F L Q Q L L W I * T Q I Y A V D Q C H F Y N N C F F BsrDI | CviRI* | |MboII SetI TspGWI \ \\ \ \ ACATTGCAATATGCCAATGGGCAACCTATACGGAAACCAAACTCCAAAAACAAGAAAGAA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAACGTTATACGGTTACCCGTTGGATATGCCTTTGGTTTGAGGTTTTTGTTCTTTCTT / / / CviRI* SetI TspGWI MboII T L Q Y A N G Q P I R K P N S K N K K E H C N M P M G N L Y G N Q T P K T R K K I A I C Q W A T Y T E T K L Q K Q E R N ----:----|----:----|----:----|----:----|----:----|----:----| V N C Y A L P C G I R F G F E L F L F S F M A I H W H A V * V S V L S W F C S L C Q L I G I P L R Y P F W V G F V L F F TspDTI Hpy178III* | MboI | BclI | | DpnI | | |BstKTI | | || DdeI | | || EspI* | | || | AluI | | || | CviJI | | || | | SetI TspDTI | | || | | |TspEI TspEI \ \ \ \\ \ \ \\ \ ACTAATAACAATACGATGAATGTTCATAATCCTGATCAACGCTTAGCTGAATTATCTCCA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TGATTATTGTTATGCTACTTACAAGTATTAGGACTAGTTGCGAATCGACTTAATAGAGGT / / /// / /// / TspDTI | ||| BclI ||CviJI TspEI | ||| MboI ||AluI | ||DpnI |EspI* | |BstKTI |DdeI | Hpy178III* SetI TspDTI T N N N T M N V H N P D Q R L A E L S P L I T I R * M F I I L I N A * L N Y L Q * * Q Y D E C S * S * S T L S * I I S N ----:----|----:----|----:----|----:----|----:----|----:----| V L L L V I F T * L G S * R K A S N D G F * Y C Y S S H E Y D Q D V S L Q I I E S I V I R H I N M I R I L A * S F * R W Csp6I |RsaI || Hin6I || |GlaI || ||FatI || ||HhaI || |||CviAII || |||| MwoI || |||| NlaIII || |||| |AsuI* || |||| |DraII AgeI || |||| ||NlaIV BetI* || |||| ||BmgT120I SgrAI || |||| |||CviJI Cfr10I || |||| |||HaeIII |HpaII CviRI* || |||| |||| BceAI |MboII \ \\ \\\\ \\\\ \ \\ ATTTTTGCAAATAGAAATACACCGAAAGTACGGCGCATGGGGCCTGAAGATATAACACCG 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAACGTTTATCTTTATGTGGCTTTCATGCCGCGTACCCCGGACTTCTATATTGTGGC / / // //// // /// / / / | CviRI* || |||| || ||| BceAI | HpaII TspEI || |||| || ||DraII MboII || |||| || ||AsuI* || |||| || |BmgT120I || |||| || |HaeIII || |||| || |CviJI || |||| || NlaIV || |||| |FatI || |||| CviAII || |||MwoI || ||NlaIII || ||Hin6I || |GlaI || HhaI |Csp6I RsaI I F A N R N T P K V R R M G P E D I T P F L Q I E I H R K Y G A W G L K I * H R F C K * K Y T E S T A H G A * R Y N T G ----:----|----:----|----:----|----:----|----:----|----:----| I K A F L F V G F T R R M P G S S I V G L K Q L Y F Y V S L V A C P A Q L Y L V N K C I S I C R F Y P A H P R F I Y C R TatI |Csp6I SfaNI ||RsaI Tsp4CI* Eco57I ||ScaI | MaeI Eco57MI |||Hin4I | | MaeIII | HphI |||| Hin4II* MmeI | | | Hin4I \ \ \\\\ \ \ \ \ \ \ GTGAATAGTAATAAGTCCAACCATAGTACTAATAAGGAGAAGGCATCTAACGGTGCTAGT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CACTTATCATTATTCAGGTTGGTATCATGATTATTCCTCTTCCGTAGATTGCCACGATCA / / / / /// / / / // / | Eco57MI HphI | ||| | MmeI | || MaeI | Eco57I | ||| Hin4II* | |SfaNI Cfr10I | ||TatI | Hin4I SgrAI | |Csp6I Tsp4CI* BetI* | ScaI AgeI | RsaI Hin4I V N S N K S N H S T N K E K A S N G A S * I V I S P T I V L I R R R H L T V L V E * * * V Q P * Y * * G E G I * R C * * ----:----|----:----|----:----|----:----|----:----|----:----| T F L L L D L W L V L L S F A D L P A L P S Y Y Y T W G Y Y * Y P S P M * R H * H I T I L G V M T S I L L L C R V T S T BsrI TspRI |TseI |CviRI* ||BisI |||BlsI |||| MaeII |||| AflIII |||| |PmaCI BsgI |||| |BsaAI Hin4I |||| || SetI Hin4I |||| || TaiI |CviRI* |||| || | MseI ||TspEI |||| || | BbvI |||BsmI Hpy188I \\\\ \\ \ \ \\\\ \ AACTCTAATATAGTGAGTGTTCCCACTGGTGCAGCACGTGTTTTAAGAATGCAATTCAGA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAGATTATATCACTCACAAGGGTGACCACGTCGTGCACAAAATTCTTACGTTAAGTCT / / / ///// // / / // / // MaeIII TspRI | ||||| || | | || | |Hpy188I | ||||| || | | || | TspEI | ||||| || | | || CviRI* | ||||| || | | || BsmI | ||||| || | | |BsgI | ||||| || | | BbvI | ||||| || | Hin4I | ||||| || | Hin4I | ||||| || | MseI | ||||| || AflIII | ||||| |MaeII | ||||| BsaAI | ||||| PmaCI | ||||TaiI | ||||SetI | |||TseI | ||BisI | |BlsI | CviRI* BsrI N S N I V S V P T G A A R V L R M Q F R T L I * * V F P L V Q H V F * E C N S D L * Y S E C S H W C S T C F K N A I Q I ----:----|----:----|----:----|----:----|----:----|----:----| L E L I T L T G V P A A R T K L I C N L Y S * Y L S H E W Q H L V H K L F A I * V R I Y H T N G S T C C T N * S H L E S MaeIII Tsp45I Tsp4CI* | AlwNI | | Hin4I | | Hin4I | | |TspRI | | ||MboI | | ||BglII | | ||XhoII | | ||| DpnI | | ||| |BstKTI | | ||| ||Hpy178III* | | ||| ||| TfiI | | ||| ||| HinfI | | ||| ||| | BssKI | | ||| ||| | EcoRII | | ||| ||| | |SecI* Hin4I | | ||| ||| Hin4I | ||ScrFI Hin4I BslFI MseI | | ||| ||| Hin4I | ||BseBI |XmnI | MboII \ \ \ \\\ \\\ \ \ \\\ \\ \ \ TTAACAGTCACTGAAAGATCTGGACTTGGAATCTCCTGGGACGAAGAAGTTCCTCCCATT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| AATTGTCAGTGACTTTCTAGACCTGAACCTTAGAGGACCCTGCTTCTTCAAGGAGGGTAA / /// / / // / / / / / / / / / / | ||| | | || | | | | | Hin4I XmnI | | BplI | ||| | | || | | | | | Hin4I | | BplI | ||| | | || | | | | EcoRII | BslFI | ||| | | || | | | | BssKI MboII | ||| | | || | | | | SecI* | ||| | | || | | | BseBI | ||| | | || | | | ScrFI | ||| | | || | | HinfI | ||| | | || | | TfiI | ||| | | || | Hpy178III* | ||| | | || XhoII | ||| | | || BglII | ||| | | || MboI | ||| | | |DpnI | ||| | | BstKTI | ||| | | Hin4I | ||| | | Hin4I | ||| | Tsp45I | ||| | MaeIII | ||| Hin4I | ||| Hin4I | ||AlwNI | |TspRI | Tsp4CI* MseI L T V T E R S G L G I S W D E E V P P I * Q S L K D L D L E S P G T K K F L P F N S H * K I W T W N L L G R R S S S H L ----:----|----:----|----:----|----:----|----:----|----:----| N V T V S L D P S P I E Q S S S T G G M I L L * Q F I Q V Q F R R P R L L E E W * C D S F S R S K S D G P V F F N R G N FatI |CviAII || MaeIII || |NlaIII || || BplI || || BplI || || | AluI || || | CviJI || || | Ecl136II || || | | SetI || || | | SduI MnlI || || | | SacI | BplI || || | | HgiAI* TfiI | BplI TaqI || || | | HgiJII* HinfI \ \ \ \\ \\ \ \ \ \ TACCAAGATGTCGAGTTGCTCTCGCCACCATGTTACGAGCTCTCTATAAATAATGGAATC 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGTTCTACAGCTCAACGAGAGCGGTGGTACAATGCTCGAGAGATATTTATTACCTTAG / / / // // / / MnlI TaqI | || || Ecl136II HinfI | || || CviJI TfiI | || || AluI | || |HgiJII* | || |HgiAI* | || |SacI | || |SduI | || |SetI | || MaeIII | |FatI | CviAII | BplI | BplI NlaIII Y Q D V E L L S P P C Y E L S I N N G I T K M S S C S R H H V T S S L * I M E S P R C R V A L A T M L R A L Y K * W N Q ----:----|----:----|----:----|----:----|----:----|----:----| * W S T S N S E G G H * S S E I F L P I K G L H R T A R A V M N R A R * L Y H F V L I D L Q E R W W T V L E R Y I I S D MnlI TatI |MboI |Csp6I || DpnI FokI ||RsaI || |BstKTI |AciI ||ScaI || || Hpy188I BseGI ||BisI \\\ \\ \\ \ \ \\\ AAAAATAAACTTTATTCAACAATGAGTACTCCTGTTAGATCAGAGGATGATTTTGTGGGC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTATTTGAAATAAGTTGTTACTCATGAGGACAATCTAGTCTCCTACTAAAACACCCG /// / // / / // ||TatI | || Hpy188I BseGI |BlsI |Csp6I | || MboI TauI ScaI | |DpnI RsaI | BstKTI MnlI K N K L Y S T M S T P V R S E D D F V G K I N F I Q Q * V L L L D Q R M I L W A K * T L F N N E Y S C * I R G * F C G R ----:----|----:----|----:----|----:----|----:----|----:----| L F L S * E V I L V G T L D S S S K T P * F Y V K N L L S Y E Q * I L P H N Q P F I F K I * C H T S R N S * L I I K H A CviJI | TaqI | SduI | HgiJII* | | BssKI | | SexAI | | EcoRII | | | ScrFI | | | BseBI | | | |SetI | | | ||AsuI* | | | ||AvaII | | | |||BmgT120I BlsI | | | |||| MaeII |TseI | | | |||| | Csp6I |TauI BtgZI CviJI | | | |||| | |RsaI ||BisI | MboII |StyI | | | |||| | |SetI |||BlsI BbvI | |TspDTI |SecI* | | | |||| | |TaiI \\\\ \ \ \\ \\ \ \ \ \\\\ \ \\ GGCAGCGATGAAGATATTGGGAACTATGAGAGCCAAGGGCTCGAACCTGGTCCTAACGTA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTCGCTACTTCTATAACCCTTGATACTCTCGGTTCCCGAGCTTGGACCAGGATTGCAT ///// / / / / / / // / /// / /// ||||TseI | | BtgZI | | | || | ||| | ||Csp6I |||BisI | TspDTI | | | || | ||| | |RsaI ||BlsI | MboII | | | || | ||| | MaeII |FokI BbvI | | | || | ||| TaiI BisI | | | || | ||| SetI AciI | | | || | ||AvaII | | | || | ||AsuI* | | | || | |BmgT120I | | | || | EcoRII | | | || | SexAI | | | || | BssKI | | | || BseBI | | | || ScrFI | | | |SetI | | | TaqI | | CviJI | HgiJII* | SecI* | StyI | SduI CviJI G S D E D I G N Y E S Q G L E P G P N V A A M K I L G T M R A K G S N L V L T Y Q R * R Y W E L * E P R A R T W S * R T ----:----|----:----|----:----|----:----|----:----|----:----| P L S S S I P F * S L W P S S G P G L T R C R H L Y Q S S H S G L A R V Q D * R A A I F I N P V I L A L P E F R T R V Y MaeIII | MboI | | DpnI TspEI | | |BstKTI | MseI AciI CviJI \ \ \\ \ \ \ \ CAGGAAGTAACGATCACACAAAATAAATTAACGATACCACCAACCGCACATCACTACCAG 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCTTCATTGCTAGTGTGTTTTATTTAATTGCTATGGTGGTTGGCGTGTAGTGATGGTC /// / // / / ||| MboI |MseI AciI CviJI ||DpnI TspEI |BstKTI MaeIII Q E V T I T Q N K L T I P P T A H H Y Q R K * R S H K I N * R Y H Q P H I T T S G S N D H T K * I N D T T N R T S L P A ----:----|----:----|----:----|----:----|----:----|----:----| C S T V I V C F L N V I G G V A C * * W V P L L S * V F Y I L S V V L R V D S G L F Y R D C L I F * R Y W W G C M V V L HphI BinI* |TatI |Ksp632I* |Tsp4CI* || MnlI ||Csp6I || |MboI |||RsaI || |XhoII |||| MaeIII MboII || || DpnI |||| Tsp45I BsrI Cac8I || || |BstKTI |||| Tsp4CI* TspRI \ \\ \\ \\ \\\\ \ \ CCTGCTTCCTCTTCGCAAAGATCCCTTACCACAGTACAGTCACCACCACTGGAAAGTGTT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| GGACGAAGGAGAAGCGTTTCTAGGGAATGGTGTCATGTCAGTGGTGGTGACCTTTCACAA // / // // / // /// // / |Cac8I | || || XhoII || ||| |TspRI BsrI MboII | || || MboI || ||| Tsp45I | || |DpnI || ||| MaeIII | || BstKTI || ||Tsp4CI* | |Ksp632I* || ||TatI | MnlI || |Csp6I BinI* || RsaI |Tsp4CI* HphI P A S S S Q R S L T T V Q S P P L E S V L L P L R K D P L P Q Y S H H H W K V L C F L F A K I P Y H S T V T T T G K C C ----:----|----:----|----:----|----:----|----:----|----:----| G A E E E C L D R V V T C D G G S S L T A Q K R K A F I G * W L V T V V V P F H R S G R R L S G K G C Y L * W W Q F T N Csp6I Hpy166II |RsaI || SetI || | BsiYI* || | | Hpy166II || | | | FatI || | | | AflIII || | | | BspLU11I* BssKI || | | | |CviAII EcoRII || | | | || NspI |SecI* || | | | || NlaIII ||ScrFI || | | | || | HindII ||BseBI || | | | || | Hpy166II \\\ \\ \ \ \ \\ \ \ GTTAGTGTCCAGGGTAGTGTACCTTTTCGTGGACATGTGTTGACACCACATAGCACAAGA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CAATCACAGGTCCCATCACATGGAAAAGCACCTGTACACAACTGTGGTGTATCGTGTTCT / / /// / / / // / | | ||| | | | || Hpy166II | | ||| | | | || HindII | | ||| | | | |BspLU11I* | | ||| | | | |AflIII | | ||| | | | |FatI | | ||| | | | CviAII | | ||| | | NlaIII | | ||| | | NspI | | ||| | Hpy166II | | ||| BsiYI* | | ||Csp6I | | |RsaI | | |SetI | | Hpy166II | EcoRII | BssKI | SecI* BseBI ScrFI V S V Q G S V P F R G H V L T P H S T R L V S R V V Y L F V D M C * H H I A Q E * C P G * C T F S W T C V D T T * H K R ----:----|----:----|----:----|----:----|----:----|----:----| T L T W P L T G K R P C T N V G C L V L Q * H G P Y H V K E H V H T S V V Y C L N T D L T T Y R K T S M H Q C W M A C S Hpy188I | XbaI | |MaeI | |Hpy178III* EcoRV | || TfiI | Hpy188I | || HinfI BfiI BsrI \ \ \ \\ \ \ \ GATATCAGAATACAAAACTTTTCCGATTTTCTAGATTCCAATAGAATAACCCAGTAG 2410 2420 2430 2440 2450 ----:----|----:----|----:----|----:----|----:----|----:-- CTATAGTCTTATGTTTTGAAAAGGCTAAAAGATCTAAGGTTATCTTATTGGGTCATC / / / // / / / | Hpy188I Hpy188I || HinfI BfiI BsrI EcoRV || TfiI |XbaI Hpy178III* MaeI D I R I Q N F S D F L D S N R I T Q * I S E Y K T F P I F * I P I E * P S X Y Q N T K L F R F S R F Q * N N P V X ----:----|----:----|----:----|----:----|----:----|----:-- S I L I C F K E S K R S E L L I V W Y L Y * F V F S K R N E L N W Y F L G T I D S Y L V K G I K * I G I S Y G L L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 3 FblI,XmiI AciI 6 BspACI,SsiI AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 2 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AluI 7 AluBI AlwNI 2 CaiI ApaLI 1 Alw44I,VneI ApoI 5 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BamHI 1 BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 4 BceAI 5 BclI 1 FbaI,Ksp22I BetI* 3 BsaWI BfiI 2 BmrI,BmuI BglII 1 BinI* 7 AlwI,BspPI,AclWI BisI 6 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 6 BmgT120I 5 BplI 2 BsaAI 1 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BseBI 7 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 1 BseSI 1 BaeGI,BstSLI BseYI 2 BsgI 2 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 3 BsaMI,Mva1269I,PctI BspCNI 1 BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 6 BseNI,Bse1I,BsrSI BssKI 11 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 11 BtgZI 4 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 6 BstC8I CauII* 4 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 8 CviQI,RsaNI CviAII 9 CviJI 24 CviKI-1 CviRI* 13 HpyCH4V DdeI 7 BstDEI,HpyF3I DpnI 11 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI Ecl136II 1 EcoICRI Eco57I 2 AcuI Eco57MI 2 EcoP15I 3 EcoRI 2 EcoRII 7 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 2 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 9 FauI 1 SmuI FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 5 GlaI 3 GsaI 2 HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 5 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiJII* 3 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 7 Hin4II* 4 HpyAV Hin6I 3 HinP1I,HspAI HindII 5 HincII HinfI 8 HpaI 1 KspAI HpaII 7 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 13 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 7 Hpy99I 5 Ksp632I* 5 Eam1104I,EarI,Bst6I MaeI 7 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 12 MboI 11 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 21 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 2 SchI MmeI 4 MnlI 10 MseI 11 Tru1I,Tru9I MslI 5 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspI 3 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PleI 2 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PshAI 1 BstPAI,BoxI PsrI 1 RsaI 8 AfaI SacI 1 Psp124BI,SstI SalI 2 SapI 2 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 2 BmcAI,AssI,ZrmI ScrFI 11 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 8 BseDI,BssECI,BsaJI SetI 24 SexAI 1 MabI SfaNI 4 LweI SfeI* 3 BstSFI,SfcI,BfmI SgrAI 1 SgrDI 1 SphI 1 PaeI,BbuI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 6 TaqI 7 TatI 4 TauI 1 TfiI 6 PfeI TseI 5 ApeKI TsoI 1 Tsp45I 6 NmuCI Tsp4CI* 11 HpyCH4III,TaaI,Bst4CI TspDTI 13 TspEI 16 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 6 TscAI Tth111I 1 PflFI,PsyI,AspI XbaI 2 XcmI 1 XhoII 6 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AclI AflII AjuI AlfI AloI ApaI AscI Asp718I AsuII AvaI AvrII BaeI BalI BarI BbvCI Bce83I* BcgI BciVI BdaI BglI BmeT110I BmtI Bpu10I BsaXI BsePI BseRI BsiI* Bsp120I Bsp1407I BspHI BspMII* BspOI BsrBI BstAPI BstEII BstXI Cfr9I CfrI ClaI CspCI DinI DraIII DrdI Eam1105I EciI Eco31I Eco47III EcoNI EgeI EheI FseI FspAI GsuI HaeII HgiCI* HindIII KasI KpnI MauBI MfeI MluI MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NspBII* OliI PacI PasI PfoI PmeI PpiI PpuMI PsiI PspOMI PspXI PstI PvuI PvuII RsrII SacII SanDI SfiI SfoI SgfI SmaI SmlI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TspMI TstI VspI XhoI XmaCI XmaI XmaIII* # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769