Restriction Map of COT1/YOR316C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

COT1/YOR316C on chromosome XV from coordinates 907555 to 906236.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.15477

EMBOSS_001 TseI SetI |BisI MboII Hpy188I | TspEI ||BlsI | Tsp4CI* | TspDTI | | BbvI ||| MaeI | | TspRI \ \ \ \ \ \\\ \ \ \ \ ATGAAACTCGGAAGCAAACAGGTAAAAATTATATCCTTGTTGCTGCTAGACACAGTGTTC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTTGAGCCTTCGTTTGTCCATTTTTAATATAGGAACAACGACGATCTGTGTCACAAG / / / / / /// / / / | | SetI | BbvI ||| | | Tsp4CI* | TspDTI TspEI ||| | TspRI Hpy188I ||| | MboII ||| MaeI ||TseI |BisI BlsI M K L G S K Q V K I I S L L L L D T V F * N S E A N R * K L Y P C C C * T Q C S E T R K Q T G K N Y I L V A A R H S V L ----:----|----:----|----:----|----:----|----:----|----:----| X F S P L L C T F I I D K N S S S V T N X S V R F C V P L F * I R T A A L C L T H F E S A F L Y F N Y G Q Q Q * V C H E Hpy178III* | MboI | | DpnI | | |TaqI | | |BstKTI | | ||Hpy178III* | | ||| BssKI MlyI | | ||| |HpaII PleI | | ||| ||ScrFI MwoI | | ||| ||CauII* | AciI | | ||| ||| Csp6I | FnuDII* | | ||| BinI* ||| |RsaI BsmAI CviJI | | HinfI \ \ \\\ \ \\\ \\ \ \ \ \ \ TTCGGGATCGAGATAACTACCGGGTACTTGTCTCACTCTTTGGCTCTAATCGCGGACTCA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCCCTAGCTCTATTGATGGCCCATGAACAGAGTGAGAAACCGAGATTAGCGCCTGAGT /// /// / / /// / / / // / / / ||| ||| BinI* | ||Csp6I | | | || | | HinfI ||| ||Hpy178III* | |RsaI | | | || | AciI ||| |TaqI | BssKI | | | || FnuDII* ||| MboI CauII* | | | |PleI ||DpnI HpaII | | | MlyI |BstKTI ScrFI | | MwoI Hpy178III* | CviJI BsmAI F G I E I T T G Y L S H S L A L I A D S S G S R * L P G T C L T L W L * S R T H R D R D N Y R V L V S L F G S N R G L I ----:----|----:----|----:----|----:----|----:----|----:----| K P I S I V V P Y K D * E K A R I A S E R R S R S L * R T S T E S K P E L R P S E P D L Y S G P V Q R V R Q S * D R V * CviRI* | MwoI | |AsuI* | ||BmgT120I | |||CviJI NdeI TspEI BceAI | |||HaeIII \ \ \ \ \\\\ TTCCATATGCTAAACGATATAATTTCTCTTGTGGTTGCACTTTGGGCCGTAAATGTTGCC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTATACGATTTGCTATATTAAAGAGAACACCAACGTGAAACCCGGCATTTACAACGG / / / / / // NdeI TspEI | | MwoI |AsuI* | CviRI* BmgT120I BceAI HaeIII CviJI F H M L N D I I S L V V A L W A V N V A S I C * T I * F L L W L H F G P * M L P P Y A K R Y N F S C G C T L G R K C C Q ----:----|----:----|----:----|----:----|----:----|----:----| N W I S F S I I E R T T A S Q A T F T A M G Y A L R Y L K E Q P Q V K P R L H Q E M H * V I Y N R K H N C K P G Y I N G BetI* BspMII* |HpaII |Hpy178III* || MaeII || | Csp6I || | |RsaI || MmeI | |SetI || TfiI | |TaiI AciI || HinfI | ||Hpy166II TaqII BceAI \\ \ \ \\\ \ \ AAAAACAGAAATCCGGATTCAACGTACACTTATGGTTGGAAAAGGGCGGAGATTTTGGGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTGTCTTTAGGCCTAAGTTGCATGTGAATACCAACCTTTTCCCGCCTCTAAAACCCA /// / / /// / / // ||| | | ||Hpy166II | AciI |BceAI ||| | | ||Csp6I TaqII HgiAI* ||| | | |RsaI EciI ||| | | MaeII SduI ||| | TaiI ||| | SetI ||| HinfI ||| TfiI ||BspMII* ||BetI* |Hpy178III* |HpaII MmeI K N R N P D S T Y T Y G W K R A E I L G K T E I R I Q R T L M V G K G R R F W V K Q K S G F N V H L W L E K G G D F G C ----:----|----:----|----:----|----:----|----:----|----:----| L F L F G S E V Y V * P Q F L A S I K P W F C F D P N L T C K H N S F P P S K P F V S I R I * R V S I T P F P R L N Q T EciI Hin6I | SduI |GlaI | HgiAI* |Eco47III | | Hpy188I TspEI ||HhaI | | | MseI |BsmAI |||HaeII \ \ \ \ \\ \\\\ GCTCTGATTAACGCCGTCTTTTTGATTGCCTTATGTGTCTCAATTTTGATAGAAGCGCTA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGACTAATTGCGGCAGAAAAACTAACGGAATACACAGAGTTAAAACTATCTTCGCGAT / / // //// | MseI |BsmAI |||Hin6I Hpy188I TspEI ||Eco47III ||GlaI |HhaI HaeII A L I N A V F L I A L C V S I L I E A L L * L T P S F * L P Y V S Q F * * K R Y S D * R R L F D C L M C L N F D R S A T ----:----|----:----|----:----|----:----|----:----|----:----| A R I L A T K K I A K H T E I K I S A S H E S * R R R K S Q R I H R L K S L L A S Q N V G D K Q N G * T D * N Q Y F R * TaqII Hin4I | Hin4I TspEI Hin4I DdeI | Hin4I \ \ \ \ \ CAAAGAATTATTGCTCCCCCCGTGATTGAAAATCCTAAGTTTGTGTTGTATGTGGGTGTC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCTTAATAACGAGGGGGGCACTAACTTTTAGGATTCAAACACAACATACACCCACAG // / // |Hin4I | |Hin4I |Hin4I | |Hin4I TspEI | TaqII DdeI Q R I I A P P V I E N P K F V L Y V G V K E L L L P P * L K I L S L C C M W V S K N Y C S P R D * K S * V C V V C G C R ----:----|----:----|----:----|----:----|----:----|----:----| C L I I A G G T I S F G L N T N Y T P T V F F * Q E G R S Q F D * T Q T T H P H L S N N S G G H N F I R L K H Q I H T D Hpy178III* | MslI | | MboI | | BclI | | | DpnI | | | |BstKTI | | | ||Hpy178III* EcoRV | | | ||| FatI MmeI | TaqI Tsp4CI* | | | ||| |CviAII \ \ \ \ \ \ \ \\\ \\ GCAGGGTTGATATCGAACACCGTTGGACTTTTCTTATTTCACGACAATGATCAAGAGCAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCCCAACTATAGCTTGTGGCAACCTGAAAAGAATAAAGTGCTGTTACTAGTTCTCGTA / / / / / / // / / // / MmeI | TaqI Tsp4CI* | MslI || | | || CviAII EcoRV | || | | |NlaIII | || | | TstI | || | Hpy178III* | || BclI | || MboI | |DpnI | BstKTI Hpy178III* A G L I S N T V G L F L F H D N D Q E H Q G * Y R T P L D F S Y F T T M I K S M R V D I E H R W T F L I S R Q * S R A W ----:----|----:----|----:----|----:----|----:----|----:----| A P N I D F V T P S K K N * S L S * S C R L T S I S C R Q V K R I E R C H D L A C P Q Y R V G N S K E * K V V I I L L M MslI |FatI |NcoI SfaNI |StyI | FatI TstI |SecI* | |CviAII NlaIII |DsaI* | || NlaIII |MslI ||CviAII | || | FokI ||FatI ||| NlaIII | || | | CviRI* |||CviAII ||| |AciI | || | | | NdeI |||| NlaIII ||| |TspGWI TstI | || | | | EcoT22I \\\\ \ \\\ \\ \ \ \\ \ \ \ \ GGACATGGACACGGACATTCCCATGGCGGTATCTTTGCCGACCATGAGATGCATATGCCA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CCTGTACCTGTGCCTGTAAGGGTACCGCCATAGAAACGGCTGGTACTCTACGTATACGGT /// // // // / / // / // / / ||| |FatI || || TstI | || | || | BseGI ||| CviAII || || AciI | || | || NdeI ||NlaIII || |DsaI* | || | |FokI |MslI || |SecI* | || | CviRI* FatI || |StyI | || EcoT22I || |NcoI | |FatI || |FatI | CviAII || TspGWI NlaIII || CviAII SfaNI |NlaIII MslI G H G H G H S H G G I F A D H E M H M P D M D T D I P M A V S L P T M R C I C H T W T R T F P W R Y L C R P * D A Y A I ----:----|----:----|----:----|----:----|----:----|----:----| P C P C P C E W P P I K A S W S I C I G H V H V R V N G H R Y R Q R G H S A Y A S M S V S M G M A T D K G V M L H M H W MslI |FatI ||CviAII ||| NspI ||| NlaIII ||| |MslI ||| ||FatI ||| |||BccI ||| |||CviAII ||| |||| NlaIII BseGI ||| |||| |MslI | BccI ||| |||| || BstXI \ \ \\\ \\\\ \\ \ TCATCCCACACACATACACATGCCCATGTTGATGGAATAGAGAATACTACACCAATGGAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGGGTGTGTGTATGTGTACGGGTACAACTACCTTATCTCTTATGATGTGGTTACCTA / // //// //// BccI || |||| |||MslI || |||| ||FatI || |||| |CviAII || |||| |BstXI || |||| BccI || |||NlaIII || ||MslI || |FatI || CviAII |NlaIII |NspI MslI S S H T H T H A H V D G I E N T T P M D H P T H I H M P M L M E * R I L H Q W I I P H T Y T C P C * W N R E Y Y T N G * ----:----|----:----|----:----|----:----|----:----|----:----| D D W V C V C A W T S P I S F V V G I S M M G C V Y V H G H Q H F L S Y * V L P * G V C M C M G M N I S Y L I S C W H I Csp6I |RsaI TspGWI SfeI* \\ \ \ AGTACGGATAACATTAGTGAGATTATGCCTAATGCTATAGTAGATAGTTTTATGAACGAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TCATGCCTATTGTAATCACTCTAATACGGATTACGATATCATCTATCAAAATACTTGCTT // / / |Csp6I TspGWI SfeI* RsaI S T D N I S E I M P N A I V D S F M N E V R I T L V R L C L M L * * I V L * T K Y G * H * * D Y A * C Y S R * F Y E R K ----:----|----:----|----:----|----:----|----:----|----:----| L V S L M L S I I G L A I T S L K I F S Y Y P Y C * H S * A * H * L L Y N * S R T R I V N T L N H R I S Y Y I T K H V F HgaI BseGI | BccI CviRI* | | MaeII FokI | EcoT22I | | | SetI MaeI | BetI* | | AcyI | | | TaiI | TspDTI | |HpaII | | SfaNI | | | | CviJI \ \ \ \\ \ \ \ \ \ \ \ \ AATACTAGATTATTGACACCGGAAAATGCATCCAAGACGCCATCATACTCAACGTCAAGC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGATCTAATAACTGTGGCCTTTTACGTAGGTTCTGCGGTAGTATGAGTTGCAGTTCG / / / // / / / / /// / / | MaeI | || | CviRI* | SfaNI ||| | CviJI TspDTI | || EcoT22I AcyI ||| MaeII | || BseGI ||TaiI | |BetI* ||SetI | HpaII |HgaI FokI BccI N T R L L T P E N A S K T P S Y S T S S I L D Y * H R K M H P R R H H T Q R Q A Y * I I D T G K C I Q D A I I L N V K P ----:----|----:----|----:----|----:----|----:----|----:----| F V L N N V G S F A D L V G D Y E V D L F Y * I I S V P F H M W S A M M S L T L I S S * Q C R F I C G L R W * V * R * A Cac8I | AciI MboI | NspBII* BglII | |BisI XhoII | ||BlsI | DpnI | |||AciI Hin6I | |BstKTI | |||TauI |GlaI | || MseI | |||| TspEI EciI ||HhaI | || |AhaIII* \ \\\\ \ \ \\\ \ \\ \\ CATACGATTGCCAGCGGCGGAAATTACACAGAACACAACAAGCGCAAGAGATCTTTAAAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTATGCTAACGGTCGCCGCCTTTAATGTGTCTTGTGTTGTTCGCGTTCTCTAGAAATTTA / /// / / / /// // / // | ||| AciI | EciI ||Hin6I || | |MseI | ||BisI TspEI |GlaI || | AhaIII* | ||AciI HhaI || XhoII | |BlsI || BglII | NspBII* || MboI | TauI |DpnI Cac8I BstKTI H T I A S G G N Y T E H N K R K R S L N I R L P A A E I T Q N T T S A R D L * I Y D C Q R R K L H R T Q Q A Q E I F K Y ----:----|----:----|----:----|----:----|----:----|----:----| W V I A L P P F * V S C L L R L L D K F G Y S Q W R R F N C L V C C A C S I K L M R N G A A S I V C F V V L A L S R * I FatI CviRI* |CviAII MaeII ||EcoT22I |SfaNI ||| MboII || SetI BtgZI ||| NlaIII || TaiI | MwoI TspDTI \\\ \ \\ \ \ \ \ ATGCATGGTGTGTTTCTTCACGTTTTGGGCGATGCTCTTGGCAACATCGGCGTTATGTTG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTACCACACAAAGAAGTGCAAAACCCGCTACGAGAACCGTTGTAGCCGCAATACAAC / / // / / / / / / | | |FatI | | SfaNI | BtgZI TspDTI | | CviAII | MaeII MwoI | | MboII TaiI | CviRI* SetI | NlaIII EcoT22I M H G V F L H V L G D A L G N I G V M L C M V C F F T F W A M L L A T S A L C C A W C V S S R F G R C S W Q H R R Y V V ----:----|----:----|----:----|----:----|----:----|----:----| I C P T N R * T K P S A R P L M P T I N Y A H H T E E R K P R H E Q C C R R * T H M T H K K V N Q A I S K A V D A N H Q BinI* | MboI | XhoII | | DpnI BbvII* | | |BstKTI CviRI* | MboII TaqII | | ||AciI \ \ \ \ \ \ \\\ TCTGCATTTTTCATTTGGAAGACCGACTATTCTTGGAAGTATTATACAGATCCGCTTGTC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGACGTAAAAAGTAAACCTTCTGGCTGATAAGAACCTTCATAATATGTCTAGGCGAACAG / / / / // / / CviRI* | TaqII | || | AciI BbvII* | || XhoII MboII | || MboI | |DpnI | BstKTI BinI* S A F F I W K T D Y S W K Y Y T D P L V L H F S F G R P T I L G S I I Q I R L S C I F H L E D R L F L E V L Y R S A C L ----:----|----:----|----:----|----:----|----:----|----:----| D A N K M Q F V S * E Q F Y * V S G S T T Q M K * K S S R S N K S T N Y L D A Q R C K E N P L G V I R P L I I C I R K D BsmAI | TspEI | | AgeI Hin6I | | BetI* |GlaI MnlI | | Cfr10I ||HhaI CviRI* | | |HpaII TspEI ||| MnlI | CviJI \ \ \\ \ \\\ \ \ \ TCATTGATAATTACCGGTATAATTTTTTCCTCTGCGCTTCCTCTATCGTGCAAGGCTTCC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAACTATTAATGGCCATATTAAAAAAGGAGACGCGAAGGAGATAGCACGTTCCGAAGG / / // / /// / // / | | |Cfr10I TspEI ||| MnlI || CviJI | | |BetI* ||Hin6I |CviRI* | | |AgeI |GlaI MnlI | | HpaII HhaI | TspEI BsmAI S L I I T G I I F S S A L P L S C K A S H * * L P V * F F P L R F L Y R A R L P I D N Y R Y N F F L C A S S I V Q G F Q ----:----|----:----|----:----|----:----|----:----|----:----| E N I I V P I I K E E A S G R D H L A E R M S L * R Y L K K R Q A E E I T C P K * Q Y N G T Y N K G R R K R * R A L S G Hin4II* | HpaII | | MboI | | | FalI | | | FalI MboI | | | DpnI SetI SspI | | | |BstKTI | DpnI | MaeIII SetI | | | ||Hin4II* | |BstKTI \ \ \ \ \ \ \\\ \ \\ AAAATATTGTTACAAGCGACACCTTCCACTTTATCCGGCGATCAAGTAGAAGGTGATCTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTATAACAATGTTCGCTGTGGAAGGTGAAATAGGCCGCTAGTTCATCTTCCACTAGAA / / / / // //// / // / SspI MaeIII SetI | || |||MboI SetI || MboI | || ||Hin4II* |DpnI | || |DpnI BstKTI | || BstKTI | |HpaII | FalI | FalI Hin4II* K I L L Q A T P S T L S G D Q V E G D L K Y C Y K R H L P L Y P A I K * K V I F N I V T S D T F H F I R R S S R R * S F ----:----|----:----|----:----|----:----|----:----|----:----| L I N N C A V G E V K D P S * T S P S R W F I T V L S V K W K I R R D L L L H D F Y Q * L R C R G S * G A I L Y F T I K BssKI EcoRII | ScrFI | BseBI | | FalI | | FalI | | | TspDTI | | | | AluI | | | | CviJI | | | | | SetI | | | | | | FatI | | | | | | BspHI | | | | | | |CviAII ApoI | | | | | | |Hpy178III* TspEI HphI | | | | | | || NlaIII | MseI HinfI \ \ \ \ \ \ \ \\ \ \ \ \ TTGAAAATACCAGGAATAATAGCTATTCATGATTTCCATATTTGGAATTTAACAGAGTCT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTTTATGGTCCTTATTATCGATAAGTACTAAAGGTATAAACCTTAAATTGTCTCAGA / / / / / / / // / / / HphI | | | | | | |BspHI | MseI HinfI | | | | | | |FatI TspEI | | | | | | Hpy178III* ApoI | | | | | | CviAII | | | | | NlaIII | | | | CviJI | | | | AluI | | | SetI | | EcoRII | | TspDTI | | BssKI | BseBI | ScrFI FalI FalI L K I P G I I A I H D F H I W N L T E S * K Y Q E * * L F M I S I F G I * Q S L E N T R N N S Y S * F P Y L E F N R V Y ----:----|----:----|----:----|----:----|----:----|----:----| K F I G P I I A I * S K W I Q F K V S D K S F V L F L L * E H N G Y K S N L L T Q F Y W S Y Y S N M I E M N P I * C L R EcoRV | BssKI BssKI | CviJI EcoRII | | HpaII | ScrFI | | ScrFI | BseBI PleI CviRI* | | CauII* | |CfrI |MlyI CviRI* |SfaNI MaeI | | | TspEI | |SetI \\ \ \\ \ \ \ \ \ \ \\ ATTTTTATTGCATCTTTGCATATTCAACTAGATATCAGCCCGGAACAATTTACTGACCTG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAATAACGTAGAAACGTATAAGTTGATCTATAGTCGGGCCTTGTTAAATGACTGGAC / / / / / / / /// / / / PleI CviRI* | SfaNI | | | ||BssKI | | BseBI MlyI CviRI* | | | |HpaII | | ScrFI | | | CauII* | SetI | | | ScrFI TspEI | | CviJI | EcoRV MaeI I F I A S L H I Q L D I S P E Q F T D L F L L H L C I F N * I S A R N N L L T W F Y C I F A Y S T R Y Q P G T I Y * P G ----:----|----:----|----:----|----:----|----:----|----:----| I K I A D K C I * S S I L G S C N V S R * K * Q M K A Y E V L Y * G P V I * Q G N K N C R Q M N L * I D A R F L K S V Q MboI BalI | DpnI CviJI | |HphI AciI CviRI* HaeIII | |BstKTI | MslI BsmI AciI | SetI \ \ \\ \ \ \ \ \ \ GCCAAAATAGTTAGATCAAAACTTCACCGCTATGGCATTCACTCCGCTACTTTGCAACCT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTTTATCAATCTAGTTTTGAAGTGGCGATACCGTAAGTGAGGCGATGAAACGTTGGA / / // / / / / / / | CfrI || MboI | BsmI AciI | SetI EcoRII |DpnI MslI CviRI* HaeIII |HphI AciI BssKI BstKTI CviJI BalI A K I V R S K L H R Y G I H S A T L Q P P K * L D Q N F T A M A F T P L L C N L Q N S * I K T S P L W H S L R Y F A T * ----:----|----:----|----:----|----:----|----:----|----:----| A L I T L D F S * R * P M * E A V K C G P W F L * I L V E G S H C E S R * K A V G F Y N S * F K V A I A N V G S S Q L R BsmAI | MlyI | PleI | CviJI MboI | |HpaII BclI | || HinfI SetI ApoI MaeIII | || | StyI | DpnI TspEI MnlI | SetI | || | SecI* | |BstKTI \ \ \ \ \ \\ \ \ \ \\ GAATTTATTACCAGAGAGGTTACTTCAACCGAAAGAGCCGGAGACTCCCAAGGTGATCAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAAATAATGGTCTCTCCAATGAAGTTGGCTTTCTCGGCCTCTGAGGGTTCCACTAGTA / / / / //// / / / // / | MnlI SetI MaeIII |||HpaII | | | || BclI TspEI ||BsmAI | | | || MboI ApoI |PleI | | | |DpnI CviJI | | | BstKTI MlyI | | SecI* | | StyI | SetI HinfI E F I T R E V T S T E R A G D S Q G D H N L L P E R L L Q P K E P E T P K V I I I Y Y Q R G Y F N R K S R R L P R * S S ----:----|----:----|----:----|----:----|----:----|----:----| S N I V L S T V E V S L A P S E W P S * Q I * * W L P * K L R F L R L S G L H D F K N G S L N S * G F S G S V G L T I M HphI | TspDTI FauI CviJI Csp6I SetI | | AciI | MseI HaeIII NdeI |RsaI BsrI NlaIV \ \ \ \ \ \ \ \\ \ \ CTACAAAATGACCCGCTTTCATTAAGGCCAAAGACATATGGTACTGGCATTTCAGGTTCC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GATGTTTTACTGGGCGAAAGTAATTCCGGTTTCTGTATACCATGACCGTAAAGTCCAAGG / / / / / / / // / / / / | TspDTI AciI | | HaeIII | || BsrI | | BcgI HphI | | CviJI | |Csp6I | NlaIV | MseI | RsaI SetI FauI NdeI L Q N D P L S L R P K T Y G T G I S G S Y K M T R F H * G Q R H M V L A F Q V P T K * P A F I K A K D I W Y W H F R F H ----:----|----:----|----:----|----:----|----:----|----:----| R C F S G S E N L G F V Y P V P M E P E D V F H G A K M L A L S M H Y Q C K L N * L I V R K * * P W L C I T S A N * T G Hpy99I | TseI | Hpy99I | |BisI | ||BlsI | ||| HgaI | ||| | CviRI* | ||| | | BcgI | ||| | | | AluI | ||| | | | CviJI | ||| | | | PvuII | ||| | | | NspBII* MboI | ||| | | | | SetI | DpnI | ||| | | | | | MnlI | |BstKTI BcgI BbvI TaqI | ||| | | | | | | DdeI | || MseI \ \ \ \ \\\ \ \ \ \ \ \ \ \ \\ \ ACTTGTCTTATCGACGACGCTGCCAACTGCAACACAGCTGATTGCTTAGAGGATCATTAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TGAACAGAATAGCTGCTGCGACGGTTGACGTTGTGTCGACTAACGAATCTCCTAGTAATT // // /// // / / / / / // / / || || ||TseI || | | | MnlI | || | MseI || || |BisI || | | NspBII* | || MboI || || BlsI || | | PvuII | |DpnI || |Hpy99I || | | CviJI | BstKTI || TaqI || | | AluI DdeI |Hpy99I || | SetI BbvI || BcgI |HgaI CviRI* T C L I D D A A N C N T A D C L E D H * L V L S T T L P T A T Q L I A * R I I X L S Y R R R C Q L Q H S * L L R G S L X ----:----|----:----|----:----|----:----|----:----|----:----| V Q R I S S A A L Q L V A S Q K S S * * W K D * R R R Q W S C C L Q N S L P D N S T K D V V S G V A V C S I A * L I M L # Enzymes that cut Frequency Isoschizomers AciI 9 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AluI 2 AluBI ApoI 2 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 3 BceAI 2 BcgI 1 BclI 2 FbaI,Ksp22I BetI* 3 BsaWI BglII 1 BinI* 2 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BsmAI 4 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspHI 1 CciI,PagI,RcaI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 1 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstKTI 9 BstXI 1 BtgZI 1 Cac8I 1 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 4 CviQI,RsaNI CviAII 8 CviJI 10 CviKI-1 CviRI* 10 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 9 MalI DsaI* 1 BtgI,BstDSI EciI 2 Eco47III 1 Aor51HI,AfeI EcoRII 2 AjnI,Psp6I,PspGI EcoRV 2 Eco32I EcoT22I 3 Mph1103I,NsiI,Zsp2I FalI 2 FatI 8 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 3 HaeII 1 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HhaI 3 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 2 HpyAV Hin6I 3 HinP1I,HspAI HinfI 4 HpaII 7 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 2 Hpy99I 2 MaeI 3 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 2 MboI 9 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MlyI 3 SchI MmeI 2 MnlI 4 MseI 5 Tru1I,Tru9I MslI 7 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NcoI 1 Bsp19I NdeI 3 FauNDI NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 1 BstNSI,XceI PleI 3 PpsI PvuII 1 RsaI 4 AfaI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 13 SfaNI 4 LweI SfeI* 1 BstSFI,SfcI,BfmI SspI 1 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 3 TaqII 3 TauI 1 TfiI 1 PfeI TseI 2 ApeKI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 10 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI TstI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AflII AflIII AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BamHI BarI BbvCI Bce83I* BciVI BdaI BfiI BglI BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmFI Bsp120I Bsp1407I BspCNI BspLU11I* BspMI BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstZ17I BtrI BtsI Cfr9I ClaI CspCI DinI DraII DraIII DrdI Eam1105I Ecl136II Eco31I Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EgeI EheI Esp3I EspI* FaqI FseI FspAI GsaI GsuI HgiCI* HgiJII* HindII HindIII HpaI KasI KpnI Ksp632I* MauBI McrI* MfeI MluI MroNI MstI* NaeI NarI NgoMIV NheI NmeAIII NotI NruI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TatI TsoI Tsp45I TspMI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769