Restriction Map of SRL1/YOR247W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SRL1/YOR247W on chromosome XV from coordinates 797676 to 798308.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2481

MseI SetI Hin4II* \ \ \ ATGCTTCAATCCGTTGTCTTTTTCGCTCTTTTAACCTTCGCAAGTTCTGTGTCAGCGATT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGAAGTTAGGCAACAGAAAAAGCGAGAAAATTGGAAGCGTTCAAGACACAGTCGCTAA / / MseI Hin4II* SetI M L Q S V V F F A L L T F A S S V S A I C F N P L S F S L F * P S Q V L C Q R F A S I R C L F R S F N L R K F C V S D L ----:----|----:----|----:----|----:----|----:----|----:----| X S * D T T K K A R K V K A L E T D A I X A E I R Q R K R E K L R R L N Q T L S H K L G N D K E S K * G E C T R H * R N Hin6I |GlaI ||HhaI |||BseYI |||HaeII |||| AluI |||| GsaI |||| CviJI |||| | SetI |||| | | XcmI |||| | | | StyI |||| | | | SecI* |||| | | | | HgiCI* |||| | | | | | NlaIV |||| | | | | | | BsmAI |||| | | | | | | |SduI Tsp4CI* |||| | | | | | | |BseSI \ \\\\ \ \ \ \ \ \ \\ TATTCAAACAATACTGTTTCTACAACTACCACTTTAGCGCCCAGCTACTCCTTGGTGCCC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAGTTTGTTATGACAAAGATGTTGATGGTGAAATCGCGGGTCGATGAGGAACCACGGG / ///// / / / /// / Tsp4CI* ||||| | | XcmI ||| HgiCI* ||||| | BseYI ||NlaIV ||||| | CviJI |BseSI ||||| | AluI |SduI ||||| SetI SecI* ||||GsaI StyI |||Hin6I ||GlaI |HhaI HaeII Y S N N T V S T T T T L A P S Y S L V P I Q T I L F L Q L P L * R P A T P W C P F K Q Y C F Y N Y H F S A Q L L L G A P ----:----|----:----|----:----|----:----|----:----|----:----| * E F L V T E V V V V K A G L * E K T G K N L C Y Q K * L * W K L A W S S R P A I * V I S N R C S G S * R G A V G Q H G Tsp4CI* SplI* | AccI |Csp6I HphI MaeIII | |MnlI ||RsaI Hpy99I |SetI Tsp45I SetI | |Hpy166II \\\ \ \\ \ \ \ \\ CAAGAGACTACCATATCGTACGCCGACGACACCACTACCTTTTTTGTCACCTCAACGGTC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTCTGATGGTATAGCATGCGGCTGCTGTGGTGATGGAAAAAACAGTGGAGTTGCCAG / /// / / / / / / // BsmAI ||| Hpy99I | HphI | | | |Hpy166II ||SplI* SetI | | | MnlI |Csp6I | | Tsp4CI* RsaI | Tsp45I | MaeIII SetI Q E T T I S Y A D D T T T F F V T S T V K R L P Y R T P T T P L P F L S P Q R S R D Y H I V R R R H H Y L F C H L N G L ----:----|----:----|----:----|----:----|----:----|----:----| W S V V M D Y A S S V V V K K T V E V T G L S * W I T R R R C W * R K Q * R L P L L S G Y R V G V V G S G K K D G * R D BsiI* | HphI | | AluI | | CviJI BseRI | | PflMI | BseRI | | Eco57I | |AciI | | BsiYI* | ||BisI | | Eco57MI | |||BlsI | | | SetI | ||||TauI | | | | Hpy166II MnlI | ||||CviJI | | | | | SetI |CviJI | ||||HaeIII MnlI \ \ \ \ \ \ \\ \ \\\\\ \ TACTCCACGAGCTGGTTCACCTCAACTTCAGCCACCATTACCAATGCGGCCTCCTCCTCC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAGGTGCTCGACCAAGTGGAGTTGAAGTCGGTGGTAATGGTTACGCCGGAGGAGGAGG / //// // / / / / //// / AccI |||CviJI |SetI | CviJI | | |||HaeIII MnlI |||AluI Hpy166II MnlI | | |||CviJI ||BsiI* | | ||BisI |Eco57MI | | ||AciI |Eco57I | | |BlsI |SetI | | TauI BsiYI* | BseRI PflMI BseRI HphI Y S T S W F T S T S A T I T N A A S S S T P R A G S P Q L Q P P L P M R P P P P L H E L V H L N F S H H Y Q C G L L L L ----:----|----:----|----:----|----:----|----:----|----:----| * E V L Q N V E V E A V M V L A A E E E R S W S S T * R L K L W W * W H P R R R V G R A P E G * S * G G N G I R G G G G Ksp632I* |CviJI |HaeIII || MnlI || | Hpy178III* || | | MboI || | | XhoII MboII || | | | DpnI |MnlI || | | | |BstKTI FatI || Hpy166II || | | | || MnlI |CviAII || |MnlI || | | | || MaeIII TfiI || NlaIII SetI || || SetI || | | | || | BinI* HinfI || |TspEI TaqII \\ \\ \ \\ \ \ \ \\ \ \ \ \\ \\ \ TTGTCCACCTCTTCGGCCTCTGGATCTGTAACCCCAGAATCCACCCATGAAATTACCTCC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AACAGGTGGAGAAGCCGGAGACCTAGACATTGGGGTCTTAGGTGGGTACTTTAATGGAGG // // /// /// / // / / // / / / || |SetI ||| ||| | |MaeIII | | |FatI | | TspDTI || Hpy166II ||| ||| | BinI* | | | | | SetI || MnlI ||| ||| XhoII | | | | TaqII |MnlI ||| ||| MnlI | | | TspEI MboII ||| ||| MboI | | | SetI ||| ||DpnI | | CviAII ||| |BstKTI | NlaIII ||| Hpy178III* HinfI ||Ksp632I* TfiI |MnlI HaeIII CviJI L S T S S A S G S V T P E S T H E I T S C P P L R P L D L * P Q N P P M K L P P V H L F G L W I C N P R I H P * N Y L H ----:----|----:----|----:----|----:----|----:----|----:----| K D V E E A E P D T V G S D V W S I V E R T W R K P R Q I Q L G L I W G H F * R Q G G R R G R S R Y G W F G G M F N G G BbvI |DrdI |MnlI MlyI ||MaeII PleI |||BtrI | FatI |||| SetI | BspHI |||| TaiI | |CviAII |||| |Hpy166II | |Hpy178III* TspDTI |||| || TseI | || BsaXI | TaqI |||| || |BisI | || |HinfI | SetI |||| || |TspDTI | || |NlaIII | | MnlI |||| || ||BlsI | || || Hin4II* BsmAI \ \ \ \\\\ \\ \\\ \ \\ \\ \ \ ACCTCGACTATCACGTCCACTTTGCTGCTAACCCTTCATGACTCCACTACTTTGTCTCCA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGGAGCTGATAGTGCAGGTGAAACGACGATTGGGAAGTACTGAGGTGATGAAACAGAGGT // /// // / / /// /// // // || ||| || | | ||TseI ||| || |HinfI || ||| || | | |BisI ||| || Hin4II* || ||| || | | BlsI ||| |BspHI || ||| || | TspDTI ||| |FatI || ||| || Hpy166II ||| Hpy178III* || ||| |MaeII ||| CviAII || ||| |BbvI ||NlaIII || ||| BtrI ||BsaXI || ||TaiI |PleI || ||SetI MlyI || |MnlI || DrdI |TaqI MnlI T S T I T S T L L L T L H D S T T L S P P R L S R P L C C * P F M T P L L C L H L D Y H V H F A A N P S * L H Y F V S I ----:----|----:----|----:----|----:----|----:----|----:----| V E V I V D V K S S V R * S E V V K D G W R S * * T W K A A L G E H S W * K T E G R S D R G S Q Q * G K M V G S S Q R W BccI BbvI | SfeI* MaeIII | |BsaXI Tsp45I | ||TseI | TspRI | ||CviRI* | | TfiI | |||BisI | | HinfI | ||||BlsI | | | SfaNI | ||||PstI | | | | MboII CviRI* SetI \ \\\\\ \ \ \ \ \ \ \ TCATCTACTGCAGCAAGTGTCAGTGACGAAGATTCAAACAACAAAGATGCAAAGGTCAAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGATGACGTCGTTCACAGTCACTGCTTCTAAGTTTGTTGTTTCTACGTTTCCAGTTC / /// //// / // / // / / | ||| |||TseI TspRI |Tsp45I | |SfaNI | SetI | ||| ||SfeI* |MaeIII | MboII CviRI* | ||| ||BisI BbvI HinfI | ||| |BlsI TfiI | ||| CviRI* | ||PstI | |BccI | BsaXI BsmAI S S T A A S V S D E D S N N K D A K V K H L L Q Q V S V T K I Q T T K M Q R S S I Y C S K C Q * R R F K Q Q R C K G Q V ----:----|----:----|----:----|----:----|----:----|----:----| D D V A A L T L S S S E F L L S A F T L M M * Q L L H * H R L N L C C L H L P * * R S C C T D T V F I * V V F I C L D L HphI MaeIII Tsp45I | MaeIII | Tsp45I BslFI | Tsp4CI* CviJI | HgaI | | TspRI \ \ \ \ \ \ TCCTTTGAACAGGCTTCAACTTCCAATGGTTGCGTCCCAATCACAAAGTTTGTCACTGTC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAAACTTGTCCGAAGTTGAAGGTTACCAACGCAGGGTTAGTGTTTCAAACAGTGACAG / / / // / CviJI | HgaI || Tsp4CI* BslFI || Tsp45I || MaeIII |TspRI HphI S F E Q A S T S N G C V P I T K F V T V P L N R L Q L P M V A S Q S Q S L S L S L * T G F N F Q W L R P N H K V C H C H ----:----|----:----|----:----|----:----|----:----|----:----| D K S C A E V E L P Q T G I V F N T V T T R Q V P K L K W H N R G L * L T Q * Q G K F L S * S G I T A D W D C L K D S D CviJI | SduI | HgiJII* | |BfiI | |MaeIII | || BsrI | || | Csp6I | || | |RsaI | || | ||MaeII | || | |||HphI | || | |||MaeIII | || | |||| SetI MaeII | || | |||| TaiI |HphI | || | |||| | MaeIII |MaeIII | || | |||| | Tsp45I || SetI | || | |||| | Tsp4CI* || TaiI \ \\ \ \\\\ \ \ \\ \ ACCAATGAGCCCGTTACCCAGTACGTTACAGTCACCCCAAATACGACTACACAATACGTT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTACTCGGGCAATGGGTCATGCAATGTCAGTGGGGTTTATGCTGATGTGTTATGCAA / / / / // // / / / // / | | | BfiI || || | | Tsp45I || MaeII | | CviJI || || | | MaeIII |HphI | HgiJII* || || | Tsp4CI* TaiI | SduI || || | MaeIII SetI Tsp45I || || MaeII MaeIII || |Csp6I || |HphI || RsaI || TaiI || SetI |MaeIII BsrI T N E P V T Q Y V T V T P N T T T Q Y V P M S P L P S T L Q S P Q I R L H N T L Q * A R Y P V R Y S H P K Y D Y T I R Y ----:----|----:----|----:----|----:----|----:----|----:----| V L S G T V W Y T V T V G F V V V C Y T * W H A R * G T R * L * G L Y S * V I R G I L G N G L V N C D G W I R S C L V N MaeIII Tsp45I Tsp4CI* | AgeI | BetI* SetI | SgrAI | BssKI | Cfr10I | EcoRII | |HpaII | | ScrFI | || ApaLI | | BseBI | || | CviRI* | | | MaeIII | || | Hpy166II | | | | SetI | || | | SduI | | | | MnlI | || | | BseSI | | | | | MaeII | || | | HgiAI* | | | | | | Csp6I | || | | | TstI | | | | | | |RsaI | || | | | SetI | | | | | | |SetI | || | | | BsaXI | | | | | | |TaiI | || | | | | GsuI | | | | | | ||BsaXI | || | | | | Eco57MI | | | | | | ||| TstI | || | | | | |MaeIII | | | | | | ||| | Csp6I | || | | | | || Hin4II* | | | | | | ||| | |RsaI \ \\ \ \ \ \ \\ \ \ \ \ \ \ \ \\\ \ \\ ACTGTCACCGGTGCACCTTCTGTTACCACTACCTCTCCAGGTAACGTACAATGGTACAAC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGACAGTGGCCACGTGGAAGACAATGGTGATGGAGAGGTCCATTGCATGTTACCATGTTG / / // /// / // / // / / //// // | | || ||| | || SetI || | | |||Csp6I |Csp6I | | || ||| | |MaeIII || | | ||RsaI RsaI | | || ||| | Hin4II* || | | |MaeII | | || ||| Eco57MI || | | MaeIII | | || ||| GsuI || | | BsaXI | | || ||ApaLI || | | TstI | | || ||BsaXI || | TaiI | | || |SetI || | SetI | | || Hpy166II || EcoRII | | || CviRI* || BssKI | | || TstI || MnlI | | |Cfr10I |BseBI | | |HgiAI* |ScrFI | | |SgrAI SetI | | |BetI* | | |BseSI | | |AgeI | | |SduI | | HpaII | Tsp45I | MaeIII Tsp4CI* MaeIII T V T G A P S V T T T S P G N V Q W Y N L S P V H L L L P L P L Q V T Y N G T T C H R C T F C Y H Y L S R * R T M V Q H ----:----|----:----|----:----|----:----|----:----|----:----| V T V P A G E T V V V E G P L T C H Y L * Q * R H V K Q * W * R E L Y R V I T C S D G T C R R N G S G R W T V Y L P V V TspEI | TaqI TaqI | | BsrI \ \ \ \ ACCACTTCGATTACTAATTCGACCAGTTGGTGA 610 620 630 ----:----|----:----|----:----|--- TGGTGAAGCTAATGATTAAGCTGGTCAACCACT / / / TaqI | TaqI | BsrI TspEI T T S I T N S T S W * P L R L L I R P V G X H F D Y * F D Q L V X ----:----|----:----|----:----|--- V V E I V L E V L Q H C W K S * * N S W N T G S R N S I R G T P S # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 1 BspACI,SsiI AgeI 1 AsiGI,BshTI,CspAI,PinAI AluI 2 AluBI ApaLI 1 Alw44I,VneI BbvI 2 BseXI,BstV1I,Lsp1109I BccI 1 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BinI* 1 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BsaXI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseRI 2 BseSI 2 BaeGI,BstSLI BseYI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BspHI 1 CciI,PagI,RcaI BsrI 2 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 1 BtrI 1 BmgBI,AjiI Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 4 CviQI,RsaNI CviAII 2 CviJI 7 CviKI-1 CviRI* 3 HpyCH4V DpnI 1 MalI DrdI 1 AasI,DseDI Eco57I 1 AcuI Eco57MI 2 EcoRII 1 AjnI,Psp6I,PspGI FatI 2 GlaI 1 GsaI 1 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 3 HpyAV Hin6I 1 HinP1I,HspAI HinfI 3 HpaII 1 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 2 Hpy188III Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeII 4 HpyCH4IV MaeIII 12 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 2 MlyI 1 SchI MnlI 10 MseI 1 Tru1I,Tru9I NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I PflMI 1 BasI,AccB7I,Van91I PleI 1 PpsI PstI 1 RsaI 4 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 17 SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SgrAI 1 SplI* 1 Pfl23II,PspLI,BsiWI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 3 TaqII 1 TauI 1 TfiI 2 PfeI TseI 2 ApeKI Tsp45I 6 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 2 TasI,Tsp509I,Sse9I TspRI 2 TscAI TstI 1 XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AflIII AhaIII* AjuI AlfI AloI AlwNI ApaI ApoI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* Bce83I* BceAI BcgI BciVI BclI BdaI BglI BglII BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BseGI BseMII BsePI BsgI BsmI Bsp120I Bsp1407I BspCNI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstF5I BstXI BstZ17I BtgZI BtsCI BtsI Cac8I CauII* Cfr9I CfrI ClaI CspCI DdeI DinI DraII DraIII DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FauI FnuDII* FokI FseI FspAI Hin4I HindII HindIII HpaI Hpy188I KasI KpnI MaeI MauBI McrI* MfeI MluI MmeI Mph1103I MroNI MslI MstI* MwoI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfiI SfoI SgfI SgrDI SmaI SmlI SnaBI SpeI SphI SrfI Sse232I* Sse8387I SspI StuI SwaI TatI TsoI TspGWI TspMI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769