Restriction Map of KIN4/YOR233W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

KIN4/YOR233W on chromosome XV from coordinates 775846 to 778248.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.30992

XcmI | Tsp4CI* TspRI | | AclI | AsuI* | | MaeII | AvaII | | | SetI | |NlaIV Csp6I | | | TaiI | |BmgT120I |RsaI | | | |MaeIII | || MboII CviJI || SetI | | | |Tsp45I | || Tsp4CI* \ \\ \ \ \ \ \\ \ \\ \ ATGGCTTCTGTACCTAAACGCCATACATACGGTGGCAACGTTGTCACTGATAGGGACCGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGAAGACATGGATTTGCGGTATGTATGCCACCGTTGCAACAGTGACTATCCCTGGCA / // / / / / / / /// CviJI |Csp6I | | | | | Tsp45I ||Tsp4CI* RsaI | | | | | MaeIII ||AvaII SetI | | | | TspRI ||AsuI* | | | MaeII ||MboII | | | AclI |BmgT120I | | TaiI NlaIV | | SetI | Tsp4CI* XcmI M A S V P K R H T Y G G N V V T D R D R W L L Y L N A I H T V A T L S L I G T V G F C T * T P Y I R W Q R C H * * G P S ----:----|----:----|----:----|----:----|----:----|----:----| X A E T G L R W V Y P P L T T V S L S R X P K Q V * V G Y M R H C R Q * Q Y P G H S R Y R F A M C V T A V N D S I P V T BslFI | Ksp632I* | | Hin4I | | Hin4I BseGI Hin4I FatI | | | FokI CviRI* SfaNI Hin4I |CviAII \ \ \ \ \ \ \ \\ CATTCTCTTCAAAGAAACAATGAGATTTTGCATCCTATACATAAAAATCAGCGAAAACAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAGAGAAGTTTCTTTGTTACTCTAAAACGTAGGATATGTATTTTTAGTCGCTTTTGTA // / / / / // / / || | FokI | CviRI* |SfaNI | CviAII || Ksp632I* BseGI Hin4I NlaIII |BslFI Hin4I NspI Hin4I Hin4I H S L Q R N N E I L H P I H K N Q R K H I L F K E T M R F C I L Y I K I S E N M F S S K K Q * D F A S Y T * K S A K T C ----:----|----:----|----:----|----:----|----:----|----:----| * E R * L F L S I K C G I C L F * R F C D N E E F F C H S K A D * V Y F D A F V M R K L S V I L N Q M R Y M F I L S F M NspI NlaIII | SetI | | AsuI* | | AvaII ApoI | | Hpy188I TspEI | | |BmgT120I TaqII | MmeI | | || Hin4II* | NlaIV MnlI | HphI MseI \ \ \\ \ \ \ \ \ \ \ GCTACCTTCGGACCATACATAATCGGTTCCACTTTGGGTGAGGGAGAATTTGGTAAAGTT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CGATGGAAGCCTGGTATGTATTAGCCAAGGTGAAACCCACTCCCTCTTAAACCATTTCAA / / / /// / / / // / | SetI | ||Hin4II* | | MnlI || TspEI FatI | |AvaII | NlaIV || ApoI | |AsuI* TaqII |HphI | BmgT120I MmeI Hpy188I A T F G P Y I I G S T L G E G E F G K V L P S D H T * S V P L W V R E N L V K L Y L R T I H N R F H F G * G R I W * S * ----:----|----:----|----:----|----:----|----:----|----:----| A V K P G Y M I P E V K P S P S N P L T H * R R V M C L R N W K P H P L I Q Y L S G E S W V Y D T G S Q T L S F K T F N AluI BseYI CviJI | SetI | | GsaI | | | AsuI* | | | AvaII MnlI | | | |BmgT120I | MnlI | | | || StyI | | SetI | | | || SecI* | | NlaIV | | | || |BseRI MnlI | | | DdeI | | | || || CviJI |TaqI | | | Bpu10I TspEI \ \ \ \\ \\ \ \\ \ \ \ \ \ AAGCTGGGTTGGACCAAGGCTTCCTCCTCGAACGAGGTTCCTAAGCAAGTGGCAATCAAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGACCCAACCTGGTTCCGAAGGAGGAGCTTGCTCCAAGGATTCGTTCACCGTTAGTTT / / / // // / / / // / / / | | BseYI || |CviJI | | | || NlaIV Bpu10I Hin4I | CviJI || SecI* | | | |MnlI DdeI | AluI || StyI | | | SetI | GsaI |AvaII | | MnlI MseI |AsuI* | TaqI SetI BmgT120I MnlI BseRI K L G W T K A S S S N E V P K Q V A I K S W V G P R L P P R T R F L S K W Q S N A G L D Q G F L L E R G S * A S G N Q I ----:----|----:----|----:----|----:----|----:----|----:----| L S P Q V L A E E E F S T G L C T A I L * A P N S W P K R R S R P E * A L P L * L Q T P G L S G G R V L N R L L H C D F MseI VspI |Hin4I SfaNI AciI |TspEI | MboII TspEI | FnuDII* ||Ksp632I* | |Hpy178III* Hin4I | MseI | | TspEI \\\ \ \\ \ \ \ \ \ \ TTAATTAGAAGAGATACAATCAAGAAAGATGCCGATAAAGAAATTAAAATATACCGCGAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AATTAATCTTCTCTATGTTAGTTCTTTCTACGGCTATTTCTTTAATTTTATATGGCGCTT // / / // / // / || Ksp632I* | || Hin4I |MseI FnuDII* || TspEI | |Hpy178III* TspEI AciI |VspI | SfaNI |MseI MboII TspEI L I R R D T I K K D A D K E I K I Y R E * L E E I Q S R K M P I K K L K Y T A K N * K R Y N Q E R C R * R N * N I P R N ----:----|----:----|----:----|----:----|----:----|----:----| N I L L S V I L F S A S L S I L I Y R S I L * F L Y L * S L H R Y L F * F I G R * N S S I C D L F I G I F F N F Y V A F AsuI* AvaII DraII PpuMI |BmgT120I ||SetI ||| SfeI* ||| | CviRI* ||| | |MboII ||| | ||PstI FokI ||| | |||ApoI | TspRI Eco57I Ksp632I* ||| | |||TspEI MseI | | MseI BseGI Eco57MI |MnlI ||| | |||EcoRI \ \ \ \ \ \ \\ \\\ \ \\\\ ATTAACGCACTGAAGCATTTAACTCATCCTAACATTATCTATTTAGAAGAGGTCCTGCAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTGCGTGACTTCGTAAATTGAGTAGGATTGTAATAGATAAATCTTCTCCAGGACGTC /// / // / / / / /// / / ||TspRI FokI |BseGI Eco57MI | | | ||| | SfeI* |MseI MseI Eco57I | | | ||| CviRI* TspEI | | | ||| MboII | | | ||PstI | | | |PpuMI | | | |DraII | | | |AvaII | | | |AsuI* | | | BmgT120I | | SetI | Ksp632I* MnlI I N A L K H L T H P N I I Y L E E V L Q L T H * S I * L I L T L S I * K R S C R * R T E A F N S S * H Y L F R R G P A E ----:----|----:----|----:----|----:----|----:----|----:----| I L A S F C K V * G L M I * K S S T R C F * R V S A N L E D * C * R N L L P G A N V C Q L M * S M R V N D I * F L D Q L ApoI TspEI TaqI EcoRI AsuII Hin4I MaeI | Hin4I \ \ \ \ \ AATTCGAAATACATTGGAATAGTGCTAGAGTTTGTATCTGGGGGAGAATTCTATAAGTAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGCTTTATGTAACCTTATCACGATCTCAAACATAGACCCCCTCTTAAGATATTCATA / / / / / / | AsuII Hin4I MaeI | EcoRI | TaqI | TspEI EcoRI | ApoI TspEI Hin4I ApoI N S K Y I G I V L E F V S G G E F Y K Y I R N T L E * C * S L Y L G E N S I S I F E I H W N S A R V C I W G R I L * V Y ----:----|----:----|----:----|----:----|----:----|----:----| F E F Y M P I T S S N T D P P S N * L Y S N S I C Q F L A L T Q I Q P L I R Y T I R F V N S Y H * L K Y R P S F E I L I FatI CviRI* |CviAII MseI ||Cac8I TspEI MnlI |MboII ||| SphI | MseI |MaeII || TfiI ||| NspI | VspI || SetI || HinfI ||| CviRI* | |TspEI || TaiI || | BseRI ||| NlaIII | || XcmI \\ \ \\ \ \ \\\ \ \ \\ \ ATTCAACGTAAGAGGAGATTAAAGGAATCTTCTGCATGCAGATTGTTTGCCCAATTAATT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTTGCATTCTCCTCTAATTTCCTTAGAAGACGTACGTCTAACAAACGGGTTAATTAA // / / / / / / /// // / || MaeII | | | HinfI | ||CviRI* || TspEI |TaiI | | | TfiI | ||FatI |XcmI |SetI | | BseRI | |CviAII |VspI MnlI | MseI | Cac8I |MseI MboII CviRI* TspEI NlaIII NspI SphI I Q R K R R L K E S S A C R L F A Q L I F N V R G D * R N L L H A D C L P N * L S T * E E I K G I F C M Q I V C P I N * ----:----|----:----|----:----|----:----|----:----|----:----| I * R L L L N F S D E A H L N N A W N I Y E V Y S S I L P I K Q M C I T Q G I L N L T L P S * L F R R C A S Q K G L * N BslFI |BsrI ||ApoI TspEI CviRI* TspDTI MseI ||TspEI \ \ \ \ \\\ AGTGGGGTCAATTATATGCACTACAAAGGACTTGTTCATAGGGACTTAAAACTGGAAAAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TCACCCCAGTTAATATACGTGATGTTTCCTGAACAAGTATCCCTGAATTTTGACCTTTTA / / / / / / | | TspDTI MseI BsrI BslFI | CviRI* TspEI S G V N Y M H Y K G L V H R D L K L E N V G S I I C T T K D L F I G T * N W K I W G Q L Y A L Q R T C S * G L K T G K F ----:----|----:----|----:----|----:----|----:----|----:----| L P T L * I C * L P S T * L S K F S S F * H P * N Y A S C L V Q E Y P S L V P F T P D I I H V V F S K N M P V * F Q F I TspGWI ApoI | ApoI TspEI | TspEI \ \ \ TTATTATTAGATAAGCACGAAAATTTAGTCATCACGGATTTTGGTTTTGTGAATGAATTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AATAATAATCTATTCGTGCTTTTAAATCAGTAGTGCCTAAAACCAAAACACTTACTTAAA / / / / TspEI TspEI TspGWI TspEI ApoI ApoI ApoI L L L D K H E N L V I T D F G F V N E F Y Y * I S T K I * S S R I L V L * M N F I I R * A R K F S H H G F W F C E * I F ----:----|----:----|----:----|----:----|----:----|----:----| K N N S L C S F K T M V S K P K T F S N N I I L Y A R F N L * * P N Q N Q S H I * * * I L V F I * D D R I K T K H I F K TspDTI | TspEI TseI | | MseI CviRI* | | VspI |BisI | | MboII TspDTI ||BlsI SpeI \ \ \ \ \\\ \ TTTGAAGATAACGAATTAATGAAAACTTCTTGTGGTTCGCCCTGTTATGCAGCACCAGAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTTCTATTGCTTAATTACTTTTGAAGAACACCAAGCGGGACAATACGTCGTGGTCTT / / // / //// TspDTI | |VspI TspDTI |||TseI | |MseI ||BisI | TspEI |BlsI MboII CviRI* F E D N E L M K T S C G S P C Y A A P E L K I T N * * K L L V V R P V M Q H Q N * R * R I N E N F L W F A L L C S T R T ----:----|----:----|----:----|----:----|----:----|----:----| K S S L S N I F V E Q P E G Q * A A G S K Q L Y R I L S F K K H N A R N H L V L K F I V F * H F S R T T R G T I C C W F Csp6I Hin4I |RsaI Hin4I MaeI || StyI NdeI | MwoI BbvI || SecI* | MwoI | | TspDTI \ \\ \ \ \ \ \ \ CTAGTTGTTAGTACCAAGGCATATGAAGCAAGAAAGGCAGATGTTTGGTCGTGTGGTGTT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GATCAACAATCATGGTTCCGTATACTTCGTTCTTTCCGTCTACAAACCAGCACACCACAA /// // / // / / / / ||BbvI || | || | MwoI TspDTI Hin4I |SpeI || | || Hin4I Hin4I MaeI || | || Hin4I || | |NdeI || | MwoI || SecI* || StyI |Csp6I RsaI L V V S T K A Y E A R K A D V W S C G V * L L V P R H M K Q E R Q M F G R V V L S C * Y Q G I * S K K G R C L V V W C Y ----:----|----:----|----:----|----:----|----:----|----:----| S T T L V L A Y S A L F A S T Q D H P T V L Q * Y W P M H L L F P L H K T T H H * N N T G L C I F C S L C I N P R T T N BsaBI |MboI |BseGI || DpnI || |FatI || |BspHI CviRI* || |BstKTI | BceAI || ||CviAII | |MwoI || ||Hpy178III* Hin4I | ||Cac8I SecI* || ||| FokI Hin4I | ||BsrDI DsaI* || ||| NlaIII \ \ \\\ \ \\ \\\ \ ATTCTTTATGCAATGCTCGCTGGATATTTGCCGTGGGATGACGATCATGAAAATCCAACG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGAAATACGTTACGAGCGACCTATAAACGGCACCCTACTGCTAGTACTTTTAGGTTGC / / / / / // //// // / / | | | Cac8I | || |||| || FokI TspDTI | | | BceAI | || |||| |BspHI | | BsrDI | || |||| |FatI | MwoI | || |||| Hpy178III* CviRI* | || |||| CviAII | || |||MboI | || ||NlaIII | || |DpnI | || BstKTI | |BsaBI | BseGI DsaI* SecI* I L Y A M L A G Y L P W D D D H E N P T F F M Q C S L D I C R G M T I M K I Q R S L C N A R W I F A V G * R S * K S N G ----:----|----:----|----:----|----:----|----:----|----:----| I R * A I S A P Y K G H S S S * S F G V * E K H L A R Q I N A T P H R D H F D L N K I C H E S S I Q R P I V I M F I W R MmeI SetI |TatI | MseI |Tsp4CI* | | ApoI MaeIII |Bsp1407I | | TspEI Tsp45I HphI ||Csp6I | | | MnlI |TspDTI |MaeI |||RsaI | | | | Hpy178III* \\ \\ \\\\ \ \ \ \ \ GGTGACGATATTGCTAGACTGTACAAATACATCACGCAAACACCTCTTAAATTTCCCGAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTGCTATAACGATCTGACATGTTTATGTAGTGCGTTTGTGGAGAATTTAAAGGGCTT / / // / /// / / // / | | || | ||Bsp1407I SetI | || Hpy178III* | | || | ||TatI | |TspEI | | || | |Csp6I | |ApoI | | || | RsaI | MnlI | | || Tsp4CI* MseI | | |MmeI | | MaeI | HphI Tsp45I MaeIII G D D I A R L Y K Y I T Q T P L K F P E V T I L L D C T N T S R K H L L N F P N * R Y C * T V Q I H H A N T S * I S R I ----:----|----:----|----:----|----:----|----:----|----:----| P S S I A L S Y L Y M V C V G R L N G S P H R Y Q * V T C I C * A F V E * I E R T V I N S S Q V F V D R L C R K F K G F Acc65I HgiCI* |Csp6I ||RsaI BseMII DdeI ||BsrI |BspCNI BbvCI ||NlaIV || MnlI Bpu10I ||| KpnI \\ \ \ \\\ \ TATATAACCCCTATTCCAAGAGATTTGCTGAGGCGAATACTGGTACCCAATCCAAGAAGA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| ATATATTGGGGATAAGGTTCTCTAAACGACTCCGCTTATGACCATGGGTTAGGTTCTTCT // / / / /// || MnlI Bpu10I | ||HgiCI* |BspCNI BbvCI | ||Acc65I BseMII DdeI | |Csp6I | NlaIV | RsaI BsrI KpnI Y I T P I P R D L L R R I L V P N P R R I * P L F Q E I C * G E Y W Y P I Q E E Y N P Y S K R F A E A N T G T Q S K K K ----:----|----:----|----:----|----:----|----:----|----:----| Y I V G I G L S K S L R I S T G L G L L I Y L G * E L L N A S A F V P V W D L F I Y G R N W S I Q Q P S Y Q Y G I W S S CviJI | FatI | BspHI FatI | |CviAII |CviAII | |Hpy178III* MboII || NspI | || NlaIII | MboII || NlaIII | || | MnlI \ \ \\ \ \ \\ \ \ AGAATAAACTTACAAACAATAAAAAGGCATGTGTGGTTGAAGCCTCATGAAGCGTTTTTG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTATTTGAATGTTTGTTATTTTTCCGTACACACCAACTTCGGAGTACTTCGCAAAAAC / / / // / / // / / | MboII | |FatI | | || MnlI TspDTI MboII | CviAII | | |BspHI BsmI NlaIII | | |FatI NspI | | Hpy178III* | | CviAII | NlaIII CviJI R I N L Q T I K R H V W L K P H E A F L E * T Y K Q * K G M C G * S L M K R F * N K L T N N K K A C V V E A S * S V F E ----:----|----:----|----:----|----:----|----:----|----:----| L I F K C V I F L C T H N F G * S A N K F F L S V F L L F A H T T S A E H L T K S Y V * L C Y F P M H P Q L R M F R K Q BseGI | Hin4II* | | FokI | | | TspDTI | | | | MaeII | | | | | SetI | | | | | TaiI BsmI | | | | | | Hpy188I TspDTI CviJI | | | | | | | AciI \ \ \ \ \ \ \ \ \ \ AGCATTCAGCCGAACTATTGGGATGAACACTTACAGAAGGAACGTCCGAAACCGCCAAAC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTAAGTCGGCTTGATAACCCTACTTGTGAATGTCTTCCTTGCAGGCTTTGGCGGTTTG / / / / / / / / / / CviJI | | | | | | Hpy188I | BsiYI* | | | | | MaeII AciI | | | | TaiI | | | | SetI | | | FokI | | TspDTI | Hin4II* BseGI S I Q P N Y W D E H L Q K E R P K P P N A F S R T I G M N T Y R R N V R N R Q T H S A E L L G * T L T E G T S E T A K Q ----:----|----:----|----:----|----:----|----:----|----:----| L M * G F * Q S S C K C F S R G F G G F S C E A S S N P H V S V S P V D S V A L A N L R V I P I F V * L L F T R F R W V BsiYI* | MaeIII | Tsp45I | | SetI | | | MaeII | | | | SetI | | | | TaiI Csp6I | | | | PshAI MboII |RsaI | | | | | HphI TspDTI MboII |SfaNI Hin4I \ \ \ \ \ \ \ \ \\ \ AAAGGTGACGTTGGTCGCCACTCAACTTATTCTTCATCAGCATCTTCGTACTCAAAAAGT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCCACTGCAACCAGCGGTGAGTTGAATAAGAAGTAGTCGTAGAAGCATGAGTTTTTCA / / /// / // / // / SetI | ||| HphI |MboII MboII || SfaNI | ||PshAI TspDTI |Csp6I | |MaeII |Hin4I | Tsp45I RsaI | MaeIII TaiI SetI K G D V G R H S T Y S S S A S S Y S K S K V T L V A T Q L I L H Q H L R T Q K V R * R W S P L N L F F I S I F V L K K * ----:----|----:----|----:----|----:----|----:----|----:----| L P S T P R W E V * E E D A D E Y E F L C L H R Q D G S L K N K M L M K T S L F F T V N T A V * S I R * * C R R V * F T MlyI PleI |HinfI || SalI || Hin4I || |TaqI || |AccI || ||HindII || ||Hpy166II || |||HinfI || |||| XbaI || |||| PleI || |||| |MaeI BsmAI MseI || |||| |MlyI | AluI |TspEI || |||| |Hpy178III* TaqI | CviJI \\ \\ \\\\ \\ \ \ \ AGGGATAGAAACTCTTTAATTATAGAGTCGACTCTAGAGCAACATCGAATGTCTCCACAG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCTATCTTTGAGAAATTAATATCTCAGCTGAGATCTCGTTGTAGCTTACAGAGGTGTC / // // //// // // / / / | || || |||| || |XbaI TaqI | BsmAI | || || |||| || Hpy178III* | CviJI | || || |||| || MaeI | AluI | || || |||| |PleI SetI | || || |||| |MlyI | || || |||| HinfI | || || |||SalI | || || ||AccI | || || ||TaqI | || || |Hpy166II | || || |HindII | || || HinfI | || |PleI | || MlyI | |Hin4I | TspEI MseI R D R N S L I I E S T L E Q H R M S P Q G I E T L * L * S R L * S N I E C L H S G * K L F N Y R V D S R A T S N V S T A ----:----|----:----|----:----|----:----|----:----|----:----| L S L F E K I I S D V R S C C R I D G C Y P Y F S K L * L T S E L A V D F T E V P I S V R * N Y L R S * L L M S H R W L EcoP15I SetI | BsrI Cac8I HphI SfaNI | NlaIV MseI \ \ \ \ \ \ CTTGCGACCAGCAGACCAGCATCACCAACATTCTCTACTGGTTCCAAAGTGGTGTTAAAC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GAACGCTGGTCGTCTGGTCGTAGTGGTTGTAAGAGATGACCAAGGTTTCACCACAATTTG / / / /// / Cac8I HphI SfaNI ||NlaIV MseI |EcoP15I BsrI L A T S R P A S P T F S T G S K V V L N L R P A D Q H H Q H S L L V P K W C * T C D Q Q T S I T N I L Y W F Q S G V K R ----:----|----:----|----:----|----:----|----:----|----:----| S A V L L G A D G V N E V P E L T T N F A Q S W C V L M V L M R * Q N W L P T L K R G A S W C * W C E R S T G F H H * V Cac8I | Csp6I | |RsaI | ||SpeI | |||MaeI | |||| BspMI | |||| | CviRI* FatI | |||| | | BaeI |CviAII | |||| | | |FatI || NlaIII | |||| | | ||CviAII || | TfiI | |||| | | ||| CviRI* || | HinfI TspDTI | |||| | | ||| NlaIII \\ \ \ \ \ \\\\ \ \ \\\ \ GATACGAAAAATGACATGAAAGAATCTAATATAAATGGCGAGCGTACTAGTGCATCATGC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTATGCTTTTTACTGTACTTTCTTAGATTATATTTACCGCTCGCATGATCACGTAGTACG / // / / / // // / // /// | |FatI | TspDTI | || || | || ||SetI | CviAII HinfI | || || | || |CviRI* NlaIII TfiI | || || | || |FatI | || || | || CviAII | || || | |NlaIII | || || | BspMI | || || CviRI* | || |SpeI | || MaeI | || BaeI | |Csp6I | RsaI Cac8I D T K N D M K E S N I N G E R T S A S C I R K M T * K N L I * M A S V L V H H A Y E K * H E R I * Y K W R A Y * C I M Q ----:----|----:----|----:----|----:----|----:----|----:----| S V F F S M F S D L I F P S R V L A D H R Y S F H C S L I * Y L H R A Y * H M M I R F I V H F F R I Y I A L T S T C * A SfaNI | Csp6I | |RsaI | |SetI | ||Hpy166II | ||| AflIII | ||| | MaeII | ||| | |PmaCI | ||| | |BsaAI | ||| | || SetI | ||| | || TaiI | ||| | || Hin4II* FokI | ||| | || |TfiI CfrI | AluI | ||| | || |HinfI BaeI | CviJI | ||| | || || TaqI | CviJI | |MaeI | ||| | || || AsuII | HaeIII BceAI | ||SetI \ \\\ \ \\ \\ \ \ \ \ \ \\\ AGGTACACACGTGATTCGAAGGGCAACGGCCAGACCCAAATAGAACAAGTATCAGCTAGA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TCCATGTGTGCACTAAGCTTCCCGTTGCCGGTCTGGGTTTATCTTGTTCATAGTCGATCT // / // / / / / / / / / / || | || | | BaeI | CfrI BceAI | | MaeI || | || | AsuII HaeIII | CviJI || | || | TaqI CviJI | AluI || | || HinfI | FokI || | || TfiI SetI || | |Hin4II* || | |AflIII || | |MaeII || | BsaAI || | PmaCI || TaiI || SetI |Hpy166II |SfaNI |Csp6I RsaI R Y T R D S K G N G Q T Q I E Q V S A R G T H V I R R A T A R P K * N K Y Q L D V H T * F E G Q R P D P N R T S I S * T ----:----|----:----|----:----|----:----|----:----|----:----| L Y V R S E F P L P W V W I S C T D A L C T C V H N S P C R G S G F L V L I L * P V C T I R L A V A L G L Y F L Y * S S BslFI MlyI |BssKI PleI |SecI* McrI* |EcoRII MnlI | AciI || ScrFI BseGI | FnuDII* || BseBI | Hpy178III* | | HinfI || | CviJI | | TaqII FauI | | | MaeIII || | |NlaIV \ \ \ \ \ \ \ \ \\ \ \\ CACTCATCCAGAGGCAATAAGCACACATCGGTCGCGGGACTCGTAACAATCCCTGGCTCC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GTGAGTAGGTCTCCGTTATTCGTGTGTAGCCAGCGCCCTGAGCATTGTTAGGGACCGAGG // / / // /// / / / //// |MnlI | TaqII || ||| AciI HinfI MaeIII |||NlaIV BseGI Hpy178III* || ||FnuDII* ||EcoRII || |PleI ||BssKI || MlyI ||CviJI |McrI* |SecI* FauI BslFI BseBI ScrFI H S S R G N K H T S V A G L V T I P G S T H P E A I S T H R S R D S * Q S L A P L I Q R Q * A H I G R G T R N N P W L P ----:----|----:----|----:----|----:----|----:----|----:----| C E D L P L L C V D T A P S T V I G P E V S M W L C Y A C M P R P V R L L G Q S V * G S A I L V C R D R S E Y C D R A G BseMII |BccI |BspCNI ||HindIII ||| AluI ||| CviJI ||| | SetI ||| | | DdeI ||| | | |MwoI ||| | | || FatI ||| | | || |CviAII ||| | | || || NspI ||| | | || || NlaIII CviRI* ||| | | || || | TfiI CviRI* | BsmI ||| | | || || | HinfI \ \ \ \\\ \ \ \\ \\ \ \ CCCACAACTGCAAGAACAAGGAATGCACCATCATCAAAGCTTACTGAGCATGTAAAAGAT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTGTTGACGTTCTTGTTCCTTACGTGGTAGTAGTTTCGAATGACTCGTACATTTTCTA / / // / / // // // CviRI* CviRI* || | | |MwoI || |FatI BsmI || | | | || CviAII || | | | |NlaIII || | | | |NspI || | | | DdeI || | | HindIII || | CviJI || | AluI || BccI || SetI |BspCNI BseMII P T T A R T R N A P S S K L T E H V K D P Q L Q E Q G M H H H Q S L L S M * K I H N C K N K E C T I I K A Y * A C K R F ----:----|----:----|----:----|----:----|----:----|----:----| G V V A L V L F A G D D F S V S C T F S G W L Q L F L S H V M M L A * Q A H L L G C S C S C P I C W * * L K S L M Y F I Hpy188I | HindIII | | AluI | | CviJI | | | SetI | | | | MnlI | | | | | DdeI | | | | | | Hpy178III* | | | | | | | ApoI | | | | | | | TspEI | | | | | | | EcoRI | | | | | | | | BspCNI MaeII | | | | | | | | |BseMII |PmaCI | | | | | | | | || Tsp4CI* |BsaAI | | | | | | | | || | BstXI || SetI MaeI | | | | | | | | || | | TspEI || TaiI \ \ \ \ \ \ \ \ \ \\ \ \ \ \\ \ TCTAGTCAGACAAGCTTTACTCAGGAGGAATTCCACCGTATTGGTAATTATCACGTGCCT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AGATCAGTCTGTTCGAAATGAGTCCTCCTTAAGGTGGCATAACCATTAATAGTGCACGGA / / / / / // // // / / / // | | | | | |MnlI || || Tsp4CI* | | |MaeII | | | | | | || || BstXI | | BsaAI | | | | | | || |BseMII | | PmaCI | | | | | | || |EcoRI | TaiI | | | | | | || |TspEI | SetI | | | | | | || |ApoI TspEI | | | | | | || BspCNI | | | | | | |Hpy178III* | | | | | | DdeI | | | | | HindIII | | | | CviJI | | | | AluI | | | SetI | | Hpy188I | MaeI HinfI TfiI S S Q T S F T Q E E F H R I G N Y H V P L V R Q A L L R R N S T V L V I I T C L * S D K L Y S G G I P P Y W * L S R A S ----:----|----:----|----:----|----:----|----:----|----:----| E L * V L K V * S S N W R I P L * * T G N * D S L S * E P P I G G Y Q Y N D R A R T L C A K S L L F E V T N T I I V H R AccI MlyI |Hpy166II PleI ||MnlI |PfoI AciI ||| StyI |BssKI SecI* ||| AvrII |EcoRII DsaI* ||| SecI* || ScrFI BspCNI ||| |MaeI || BseBI |BseMII ||| |TspDTI || | HinfI ||AciI ||| ||SetI || | | DdeI ||FnuDII* ||| ||| CviJI || | | |Tth111I ||NspBII* ||| ||| HaeIII || | | || MaeIII |||SacII \\\ \\\ \ \\ \ \ \\ \ \\\\ CGCAGTAGACCTAGGCCAACTTCATATTATCCTGGACTCAGTCGTAACACCGCGGATAAT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GCGTCATCTGGATCCGGTTGAAGTATAATAGGACCTGAGTCAGCATTGTGGCGCCTATTA /// /// // / / /// // // / ||| ||HaeIII || | | ||DdeI || || DsaI* ||| ||CviJI || | | |Tth111I || || SecI* ||| |SecI* || | | HinfI || || AciI ||| |AvrII || | EcoRII || |NspBII* ||| |StyI || | BssKI || |FnuDII* ||| MaeI || | PfoI || |AciI ||TspDTI || BseBI || SacII |AccI || ScrFI |BseMII |SetI |PleI BspCNI Hpy166II MlyI MaeIII MnlI R S R P R P T S Y Y P G L S R N T A D N A V D L G Q L H I I L D S V V T P R I I Q * T * A N F I L S W T Q S * H R G * * ----:----|----:----|----:----|----:----|----:----|----:----| R L L G L G V E Y * G P S L R L V A S L E C Y V * A L K M N D Q V * D Y C R P Y A T S R P W S * I I R S E T T V G R I I SfaNI | SetI TaqI | |HindII AciI BsrI AsuII | |Hpy166II \ \ \ \ \\ AGTTTAGCGGATATTCCAGTAAATAAGTTGGGTTCGAATGGTAGGTTGACAGATGCCAAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAATCGCCTATAAGGTCATTTATTCAACCCAAGCTTACCATCCAACTGTCTACGGTTT / / / / // AciI BsrI AsuII | |Hpy166II TaqI | |HindII | SfaNI SetI S L A D I P V N K L G S N G R L T D A K V * R I F Q * I S W V R M V G * Q M P K F S G Y S S K * V G F E W * V D R C Q R ----:----|----:----|----:----|----:----|----:----|----:----| L K A S I G T F L N P E F P L N V S A L Y N L P Y E L L Y T P N S H Y T S L H W T * R I N W Y I L Q T R I T P Q C I G F BssKI | HpaII | ScrFI | CauII* | | Acc65I | | HgiCI* | | |Csp6I | | ||RsaI | | ||NlaIV AluI | | ||| KpnI CviJI | | ||| |Tsp4CI* | SetI TspEI \ \ \\\ \\ \ \ \ GACCCGGTACCGTTGAACGCAATACACGATACCAACAAAGCTACAATCTCCAACAATTCC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGGCCATGGCAACTTGCGTTATGTGCTATGGTTGTTTCGATGTTAGAGGTTGTTAAGG ////// / / / |||||Tsp4CI* | CviJI TspEI |||||HgiCI* | AluI |||||Acc65I SetI ||||Csp6I |||NlaIV |||RsaI ||BssKI |HpaII |KpnI CauII* ScrFI D P V P L N A I H D T N K A T I S N N S T R Y R * T Q Y T I P T K L Q S P T I P P G T V E R N T R Y Q Q S Y N L Q Q F H ----:----|----:----|----:----|----:----|----:----|----:----| S G T G N F A I C S V L L A V I E L L E L G P V T S R L V R Y W C L * L R W C N V R Y R Q V C Y V I G V F S C D G V I G Hin4II* | BbvI | | MmeI | | |Hpy188I | | || AsuI* | | || AvaII | | || |BmgT120I | | || ||SetI | | || |||HpaII | | || |||| TseI | | || |||| CviJI | | || |||| |BisI | | || |||| ||BlsI | | || |||| |||CviRI* | | || |||| |||| BfiI BsrI XcmI \ \ \\ \\\\ \\\\ \ \ \ ATTATGCTATTATCAGAAGGTCCGGCTGCAAAGACTTCCCCAGTAGATTACCATTATGCT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TAATACGATAATAGTCTTCCAGGCCGACGTTTCTGAAGGGGTCATCTAATGGTAATACGA / / / // // ///// / / / | | | || || ||||| BfiI BsrI XcmI | | | || || ||||CviRI* | | | || || ||||TseI | | | || || |||BisI | | | || || ||BlsI | | | || || |CviJI | | | || || HpaII | | | || |AvaII | | | || |AsuI* | | | || BmgT120I | | | |SetI | | | BbvI | | Hpy188I | MmeI Hin4II* I M L L S E G P A A K T S P V D Y H Y A L C Y Y Q K V R L Q R L P Q * I T I M L Y A I I R R S G C K D F P S R L P L C Y ----:----|----:----|----:----|----:----|----:----|----:----| M I S N D S P G A A F V E G T S * W * A W * A I I L L D P Q L S K G L L N G N H N H * * * F T R S C L S G W Y I V M I S FatI NcoI StyI SecI* DsaI* BseMII |CviAII |BspCNI AsuI* || MaeIII || MnlI TspEI AvaII || Tsp45I || |HphI SetI | MseI DraII MseI || NlaIII || || DdeI | TaqI | VspI PpuMI \ \\ \ \\ \\ \ \ \ \ \ \ ATTGGCGACTTAAACCATGGTGACAAACCCATAACTGAGGTTATCGACAAAATTAATAAG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TAACCGCTGAATTTGGTACCACTGTTTGGGTATTGACTCCAATAGCTGTTTTAATTATTC / / // // // // / // | | || || |HphI |DdeI TaqI |VspI | | || || MnlI SetI |MseI | | || |BspCNI TspEI | | || Tsp45I | | || MaeIII | | || BseMII | | |DsaI* | | |SecI* | | |StyI | | |NcoI | | |FatI | | CviAII | NlaIII MseI I G D L N H G D K P I T E V I D K I N K L A T * T M V T N P * L R L S T K L I R W R L K P W * Q T H N * G Y R Q N * * G ----:----|----:----|----:----|----:----|----:----|----:----| I P S K F W P S L G M V S T I S L I L L * Q R S L G H H C V W L Q P * R C F * Y N A V * V M T V F G Y S L N D V F N I L AvaI XhoI TseI SmlI |BisI |TaqI ||BlsI |BmeT110I |||AluI ||Hpy178III* |||CviJI ||| MnlI |||PvuII ||| | BplI BmgT120I |||NspBII* BbvI ||| | BplI Csp6I | SetI |||| SetI |Hin4I ||| | |TaqI SfaNI |RsaI \ \ \\\\ \ \\ \\\ \ \\ \ \\ GACCTTACTCATAAAGCAGCTGAAAATGGTTTTCCTCGAGAGAGCATCGACCCAGAGAGT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGAATGAGTATTTCGTCGACTTTTACCAAAAGGAGCTCTCTCGTAGCTGGGTCTCTCA /// /// / / // / / / // / ||PpuMI ||| Hin4I BbvI || | MnlI TaqI || RsaI ||DraII ||NspBII* || BplI || SetI ||AvaII ||PvuII || BplI |SfaNI ||AsuI* ||CviJI |Hpy178III* Hin4I |BmgT120I ||TseI |SmlI SetI ||AluI |XhoI |BisI |AvaI BlsI BmeT110I SetI TaqI D L T H K A A E N G F P R E S I D P E S T L L I K Q L K M V F L E R A S T Q R V P Y S * S S * K W F S S R E H R P R E Y ----:----|----:----|----:----|----:----|----:----|----:----| S R V * L A A S F P K G R S L M S G S L P G * E Y L L Q F H N E E L S C R G L S V K S M F C S F I T K R S L A D V W L T BsaBI |MboI || DpnI || |FatI || |BstKTI || ||CviAII || ||| NlaIII MnlI || ||| | TfiI | MaeIII || ||| | HinfI Hin4I | | BplI || ||| | MboII | SetI | | BplI || ||| | |TspDTI \ \ \ \ \ \\ \\\ \ \\ ACCTCAACGATATTAGTTACGAAAGAACCCACTAACTCCACCGATGAAGATCATGTAGAA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TGGAGTTGCTATAATCAATGCTTTCTTGGGTGATTGAGGTGGCTACTTCTAGTACATCTT / / / / / //// // / Csp6I | BplI MaeIII | |||| || TspDTI | BplI | |||| || MboII MnlI | |||| |FatI | |||| CviAII | |||MboI | ||NlaIII | |DpnI | BstKTI BsaBI T S T I L V T K E P T N S T D E D H V E P Q R Y * L R K N P L T P P M K I M * N L N D I S Y E R T H * L H R * R S C R I ----:----|----:----|----:----|----:----|----:----|----:----| V E V I N T V F S G V L E V S S S * T S Y R L S I L * S L V W * S W R H L D H L G * R Y * N R F F G S V G G I F I M Y F BspCNI DdeI |BseMII | AluI ||MboII GsuI | CviJI |||CfrI Eco57MI | PvuII |||| BalI | Ksp632I* | NspBII* |||| CviJI | | MboII HgaI | | SetI |||| HaeIII | | |Hpy188I | Hpy188I \ \ \ \\\\ \ \ \ \\ \ \ TCTCAGCTGGAGAATGTTGGCCACTCTTCTAATAAATCAGACGCTTCTTCTGATAAAGAT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGTCGACCTCTTACAACCGGTGAGAAGATTATTTAGTCTGCGAAGAAGACTATTTCTA / /// // / / / / / // / / | ||| || | | | | | |Hpy188I | HgaI | ||| || | | | | | MboII Hpy188I | ||| || | | | | Ksp632I* | ||| || | | | Eco57MI | ||| || | | | GsuI | ||| || | | CfrI | ||| || | HaeIII | ||| || | CviJI | ||| || | BalI | ||| || MboII | ||| |BseMII | ||| BspCNI | ||NspBII* | ||PvuII | ||CviJI | ||AluI | |DdeI | SetI HinfI TfiI S Q L E N V G H S S N K S D A S S D K D L S W R M L A T L L I N Q T L L L I K I S A G E C W P L F * * I R R F F * * R * ----:----|----:----|----:----|----:----|----:----|----:----| D * S S F T P W E E L L D S A E E S L S I E A P S H Q G S K * Y I L R K K Q Y L R L Q L I N A V R R I F * V S R R I F I TspDTI | SetI | | AluI | | CviJI | | | SetI | | | |FatI | | | ||FokI | | | ||CviAII MboI | | | ||| NlaIII BglII | | | ||| | TatI XhoII | | | ||| | |Csp6I | DpnI | | | ||| | ||RsaI | |BstKTI | | | ||| | ||| BseGI MseI \ \\ \ \ \ \\\ \ \\\ \ \ AGTAAAAAGATCTACGAAAAAAAAAGGTTCAGCTTCATGTCGTTGTACTCATCCTTAAAT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTTTTCTAGATGCTTTTTTTTTCCAAGTCGAAGTACAGCAACATGAGTAGGAATTTA // / / / / / / /// /// / || XhoII | SetI | | | ||FokI ||TatI MseI || BglII TspDTI | | | |FatI |Csp6I || MboI | | | CviAII |BseGI |DpnI | | NlaIII RsaI BstKTI | CviJI | AluI SetI S K K I Y E K K R F S F M S L Y S S L N V K R S T K K K G S A S C R C T H P * M * K D L R K K K V Q L H V V V L I L K W ----:----|----:----|----:----|----:----|----:----|----:----| L L F I * S F F L N L K M D N Y E D K F Y Y F S R R F F F T * S * T T T S M R L T F L D V F F F P E A E H R Q V * G * I BinI* | Hpy178III* Csp6I | | MboI |RsaI | | XhoII || SetI | | | DpnI || | BsiYI* | | | |BstKTI || | | MnlI | | | || Tsp4CI* || | | | CviRI* MnlI | | | || | TspRI || | | | |TspDTI | XbaI | | | || | |TfiI || | | | ||BsmI | |MaeI | | | || | |HinfI || | | | ||| SetI | |Hpy178III* \ \ \ \\ \ \\ \\ \ \ \ \\\ \ \ \\ GGTTCAAGATCCACTGTTGAATCTCGTACCTCAAAAGGGAATGCACCTCCTGTTTCATCT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAGTTCTAGGTGACAACTTAGAGCATGGAGTTTTCCCTTACGTGGAGGACAAAGTAGA / /// / / / // / / /// / | ||| | Tsp4CI* | || | | ||SetI MnlI | ||| XhoII | || | | |CviRI* | ||| MboI | || | | |BsmI | ||TspRI | || | | TspDTI | ||DpnI | || | MnlI | |BstKTI | || BsiYI* | Hpy178III* | |Csp6I BinI* | RsaI | SetI HinfI TfiI G S R S T V E S R T S K G N A P P V S S V Q D P L L N L V P Q K G M H L L F H L F K I H C * I S Y L K R E C T S C F I * ----:----|----:----|----:----|----:----|----:----|----:----| P E L D V T S D R V E F P F A G G T E D H N L I W Q Q I E Y R L L S H V E Q K M T * S G S N F R T G * F P I C R R N * R MaeII BspCNI |BsaAI |MaeIII DdeI |BseMII Hpy178III* | TseI || SetI | BccI | |BisI || TaiI | | TaqI MaeIII MseI | ||BlsI || BbvI \ \ \ \ \ \ \\\ \\ \ AGAAATCCATCAGGACAATCGAATAGAAGTAACATTAAAATAACTCAGCAGCAACCACGT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTAGGTAGTCCTGTTAGCTTATCTTCATTGTAATTTTATTGAGTCGTCGTTGGTGCA // / / / / / / /// // // |XbaI | BccI TaqI | MseI | ||| || |MaeII Hpy178III* Hpy178III* MaeIII | ||| || BsaAI MaeI | ||| |BseMII | ||| |TaiI | ||| |SetI | ||| BspCNI | ||TseI | |BisI | BlsI DdeI R N P S G Q S N R S N I K I T Q Q Q P R E I H Q D N R I E V T L K * L S S N H V K S I R T I E * K * H * N N S A A T T * ----:----|----:----|----:----|----:----|----:----|----:----| L F G D P C D F L L L M L I V * C C G R * F D M L V I S Y F Y C * F L E A A V V S I W * S L R I S T V N F Y S L L L W T Hpy178III* | MmeI SetI | | TspEI | Hpy188I | | | MseI | | EcoP15I | | | VspI BsmAI \ \ \ \ \ \ \ \ AACCTTTCCGACAGAGTTCCAAATCCCGATAAGAAAATTAATGATAATAGAATAAGAGAC 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGAAAGGCTGTCTCAAGGTTTAGGGCTATTCTTTTAATTACTATTATCTTATTCTCTG / // / / / / // / | || Hpy188I EcoP15I | MmeI |VspI BsmAI | |BbvI Hpy178III* |MseI | MaeIII TspEI SetI N L S D R V P N P D K K I N D N R I R D T F P T E F Q I P I R K L M I I E * E T P F R Q S S K S R * E N * * * * N K R Q ----:----|----:----|----:----|----:----|----:----|----:----| L R E S L T G F G S L F I L S L L I L S Y G K R C L E L D R Y S F * H Y Y F L L V K G V S N W I G I L F N I I I S Y S V TfiI HinfI | Hin4II* MaeI | |PfoI |SetI | |BssKI || AluI | ||HpaII SetI || CviJI | |||ScrFI | Csp6I || | SetI | |||CauII* | |RsaI CviJI \\ \ \ \ \\\\ \ \\ \ AACGCACCTAGCTATGCTGAAAGCGAGAATCCGGGAAGGTCTGTACGGGCTTCTGTTATG 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCGTGGATCGATACGACTTTCGCTCTTAGGCCCTTCCAGACATGCCCGAAGACAATAC / /// / / / // // / | ||CviJI | | | |SetI || CviJI | ||AluI | | | BssKI |Csp6I | |MaeI | | | PfoI RsaI | SetI | | CauII* SetI | | HpaII | | ScrFI | HinfI | TfiI Hin4II* N A P S Y A E S E N P G R S V R A S V M T H L A M L K A R I R E G L Y G L L L W R T * L C * K R E S G K V C T G F C Y G ----:----|----:----|----:----|----:----|----:----|----:----| L A G L * A S L S F G P L D T R A E T I C R V * S H Q F R S D P F T Q V P K Q * V C R A I S F A L I R S P R Y P S R N H TaqI ClaI |MboI || DpnI || |PvuI || |McrI* || |MboII || |BstKTI || || Hpy188I HindII || || | TaqI TaqI Hpy166II || || |TspEI Hin4II* MnlI TspDTI \ \\ \\ \\ \ \ \ GTGTCAACACTACGAGAAGAAAATCGATCGGAATTGTCGAATGAAGGGAATAATGTCGAG 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CACAGTTGTGATGCTCTTCTTTTAGCTAGCCTTAACAGCTTACTTCCCTTATTACAGCTC / // / // / / / / Hpy166II || | || TaqI | | TaqI HindII || | |Hin4II* | TspDTI || | TspEI MnlI || Hpy188I || MboI |MboII |DpnI BstKTI McrI* ClaI TaqI PvuI V S T L R E E N R S E L S N E G N N V E C Q H Y E K K I D R N C R M K G I M S R V N T T R R K S I G I V E * R E * C R G ----:----|----:----|----:----|----:----|----:----|----:----| T D V S R S S F R D S N D F S P F L T S P T L V V L L F D I P I T S H L S Y H R H * C * S F F I S R F Q R I F P I I D L SetI MnlI | Hpy188I | FatI | |ApoI | |CviAII | |TspEI | ||BdaI BdaI | || XmnI | ||BdaI BdaI | || | Hin4II* | ||| NlaIII \ \ \\ \ \ \ \\\ \ GCACAGACTTCAACAGCAAGAAAGGTTCTGAATTTTTTCAAAAGAAGGAGCATGAGGGTT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGTCTGAAGTTGTCGTTCTTTCCAAGACTTAAAAAAGTTTTCTTCCTCGTACTCCCAA / / / / / / / // BdaI SetI | | Hin4II* | | |FatI BdaI | TspEI | | CviAII | XmnI | NlaIII | ApoI | BdaI Hpy188I | BdaI MnlI A Q T S T A R K V L N F F K R R S M R V H R L Q Q Q E R F * I F S K E G A * G F T D F N S K K G S E F F Q K K E H E G L ----:----|----:----|----:----|----:----|----:----|----:----| A C V E V A L F T R F K K L L L L M L T P V S K L L L F P E S N K * F F S C S P C L S * C C S L N Q I K E F S P A H P N TGA --- ACT * X X --- Q K S # Enzymes that cut Frequency Isoschizomers Acc65I 2 Asp718I AccI 2 FblI,XmiI AciI 6 BspACI,SsiI AclI 1 Psp1406I AflIII 1 AluI 10 AluBI ApoI 9 AcsI,XapI AsuI* 6 Cfr13I,PspPI,Sau96I,AspS9I AsuII 3 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 6 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BaeI 1 BalI 1 MlsI,MluNI,MscI,Msp20I BbvCI 1 BbvI 4 BseXI,BstV1I,Lsp1109I BccI 2 BceAI 2 BdaI 2 BfiI 1 BmrI,BmuI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmeT110I 1 BmgT120I 6 BplI 2 Bpu10I 2 BsaAI 3 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 7 BseRI 2 BseYI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 3 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 7 BspHI 2 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 5 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstKTI 5 BstXI 1 Cac8I 4 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I CfrI 2 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 12 CviQI,RsaNI CviAII 12 CviJI 20 CviKI-1 CviRI* 13 HpyCH4V DdeI 8 BstDEI,HpyF3I DpnI 5 MalI DraII 2 EcoO109I DsaI* 3 BtgI,BstDSI Eco57I 1 AcuI Eco57MI 2 EcoP15I 2 EcoRI 3 EcoRII 2 AjnI,Psp6I,PspGI FatI 12 FauI 1 SmuI FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 GsaI 1 GsuI 1 BpmI HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I Hin4I 8 Hin4II* 7 HpyAV HindII 3 HincII HindIII 2 HinfI 11 HpaII 3 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 12 Hpy188III Hpy188I 9 KpnI 2 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 10 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 9 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 13 McrI* 2 BsiEI,BstMCI,Bsh1285I MlyI 4 SchI MmeI 4 MnlI 19 MseI 17 Tru1I,Tru9I MwoI 4 HpyF10VI,BstMWI NcoI 1 Bsp19I NdeI 1 FauNDI NlaIII 12 Hin1II,Hsp92II,FaeI NlaIV 7 BspLI,BmiI,PspN4I NspBII* 3 MspA1I NspI 4 BstNSI,XceI PfoI 2 PleI 4 PpsI PmaCI 2 BbrPI,Eco72I,AcvI,PmlI,PspCI PpuMI 2 Psp5II,PspPPI PshAI 1 BstPAI,BoxI PstI 1 PvuI 1 MvrI,Ple19I,BpvUI PvuII 2 RsaI 12 AfaI SacII 1 KspI,Cfr42I,Sfr303I,SgrBI,SstII SalI 1 ScrFI 4 BmrFI,MspR9I,Bme1390I SecI* 7 BseDI,BssECI,BsaJI SetI 37 SfaNI 7 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI SpeI 2 BcuI,AhlI SphI 1 PaeI,BbuI StyI 4 Eco130I,EcoT14I,ErhI,BssT1I TaiI 7 TaqI 13 TaqII 2 TatI 2 TfiI 7 PfeI TseI 4 ApeKI Tsp45I 4 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 14 TspEI 23 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 5 PshBI,AseI XbaI 2 XcmI 3 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AcyI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI BamHI BarI BbvII* Bce83I* BcgI BciVI BclI BetI* BglI BmtI BsaXI BsePI BseSI BsgI BsiI* Bsp120I BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtrI BtsI Cfr10I Cfr9I CspCI DinI DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FseI FspAI GlaI HaeII HgiAI* HgiJII* HhaI Hin6I HinP1I HpaI Hpy99I HspAI KasI MauBI MfeI MluI Mph1103I MroNI MslI MstI* NaeI NarI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PasI PflMI PmeI PpiI PsiI PspOMI PspXI PsrI RsrII SacI SanDI SapI SauI* ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TauI TsoI TspMI TstI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769