Restriction Map of MGE1/YOR232W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

MGE1/YOR232W on chromosome XV from coordinates 774573 to 775259.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.12791

AluI CviJI | SetI | | MwoI | | | TseI | | | |BisI | | | ||BlsI | | | |||CviJI | | | |||| Tsp4CI* | | | |||| | BsiYI* | | | |||| | | BbvI | | | |||| | | |AsuI* | | | |||| | | ||BmgT120I | | | |||| | | |||CviJI | | | |||| | | |||HaeIII | | | |||| | | |||| FokI | | | |||| | | |||| |MaeI | | | |||| | | |||| |BsiYI* | | | |||| | | |||| ||TspDTI | | | |||| | | |||| ||| EcoP15I | | | |||| | | |||| ||| | XmnI | | | |||| | | |||| ||| | | BseGI | | | |||| | | |||| ||| | | | MslI | | | |||| | | |||| ||| | | | | FalI | | | |||| | | |||| ||| | | | | FalI | | | |||| | | |||| ||| | | | | | HgiCI* \ \ \ \\\\ \ \ \\\\ \\\ \ \ \ \ \ \ ATGAGAGCTTTTTCAGCAGCCACCGTTAGGGCCACAACTAGGAAGTCGTTCATCCCAATG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCTCGAAAAAGTCGTCGGTGGCAATCCCGGTGTTGATCCTTCAGCAAGTAGGGTTAC / / / /// / // / / // / / / / | | MwoI ||| Tsp4CI* || | | |FokI | | | MslI | CviJI ||| BsiYI* || | | MaeI | | FalI | AluI ||CviJI || | TspDTI | | FalI SetI ||TseI || BsiYI* | BseGI |BisI |AsuI* EcoP15I BlsI |BbvI XmnI BmgT120I HaeIII CviJI M R A F S A A T V R A T T R K S F I P M * E L F Q Q P P L G P Q L G S R S S Q W E S F F S S H R * G H N * E V V H P N G ----:----|----:----|----:----|----:----|----:----|----:----| X L A K E A A V T L A V V L F D N M G I X S L K K L L W R * P W L * S T T * G L H S S K * C G G N P G C S P L R E D W H MlyI PleI | MaeIII FalI | Tsp45I FalI NlaIV | | HinfI | BccI CviJI \ \ \ \ \ \ \ GCACCAAGAACTCCTTTTGTGACTCCATCATTTACAAAGAATGTAGGCTCAATGAGAAGA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGGTTCTTGAGGAAAACACTGAGGTAGTAAATGTTTCTTACATCCGAGTTACTCTTCT / / // // / / | HgiCI* |PleI |HinfI BccI CviJI NlaIV MlyI |FalI |FalI Tsp45I MaeIII A P R T P F V T P S F T K N V G S M R R H Q E L L L * L H H L Q R M * A Q * E E T K N S F C D S I I Y K E C R L N E K N ----:----|----:----|----:----|----:----|----:----|----:----| A G L V G K T V G D N V F F T P E I L L P V L F E K Q S E M M * L S H L S L S F C W S S R K H S W * K C L I Y A * H S S TspDTI Hpy188I | TfiI SapI MboII | CviJI | HinfI MboII Ksp632I* \ \ \ \ \ \ \ ATGAGATTTTATTCTGATGAAGCCAAAAGTGAAGAATCCAAAGAAAACAATGAAGATTTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCTAAAATAAGACTACTTCGGTTTTCACTTCTTAGGTTTCTTTTGTTACTTCTAAAC / / / / / / MboII Hpy188I CviJI TspDTI | MboII HinfI TfiI M R F Y S D E A K S E E S K E N N E D L * D F I L M K P K V K N P K K T M K I * E I L F * * S Q K * R I Q R K Q * R F D ----:----|----:----|----:----|----:----|----:----|----:----| I L N * E S S A L L S S D L S F L S S K F S I K N Q H L W F H L I W L F C H L N H S K I R I F G F T F F G F F V I F I Q CviJI |BsrI Hpy188I || MseI |MboII || |MwoI || Hpy178III* || || Hin6I BbvII* || | Eco57I || || |GlaI Bce83I* MboII || | Eco57MI || || ||HhaI | HindIII |TspDTI || | | TspEI || || ||FnuDII* | |MboII \\ \\ \ \ \ \\ \\ \\\ \ \\ ACTGAAGAGCAATCAGAAATCAAGAAATTAGAGAGCCAGTTAAGCGCGAAGACTAAAGAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTTCTCGTTAGTCTTTAGTTCTTTAATCTCTCGGTCAATTCGCGCTTCTGATTTCTT // // / / / // / / /// / / |TspDTI |MboII | | | || | | ||| | BbvII* |MboII | | | | || | | ||| | MboII Ksp632I* | | | | || | | ||| | SetI SapI | | | | || | | ||| Bce83I* | | | | || | | ||FnuDII* | | | | || | | ||Hin6I | | | | || | | |GlaI | | | | || | | HhaI | | | | || | MseI | | | | || MwoI | | | | |CviJI | | | | BsrI | | | TspEI | | Hpy178III* | Eco57MI | Eco57I Hpy188I T E E Q S E I K K L E S Q L S A K T K E L K S N Q K S R N * R A S * A R R L K K * R A I R N Q E I R E P V K R E D * R S ----:----|----:----|----:----|----:----|----:----|----:----| V S S C D S I L F N S L W N L A F V L S S Q L A I L F * S I L S G T L R S S * L S F L L * F D L F * L A L * A R L S F F MseI AluI | MboI CviJI | BglII | SetI | XhoII Hpy188I | | Hpy188I | | DpnI | ApoI MaeIII | | | SmlI | | |BstKTI | TspEI Tsp45I \ \ \ \ \ \ \\ \ \ \ GCTTCTGAACTCAAGGACAGATTATTAAGATCTGTGGCAGATTTCAGAAATTTACAACAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGACTTGAGTTCCTGTCTAATAATTCTAGACACCGTCTAAAGTCTTTAAATGTTGTT / / / / / // / / / | | Hpy188I SmlI | || XhoII | TspEI | HindIII | || BglII | ApoI CviJI | || MboI Hpy188I AluI | |DpnI | BstKTI MseI A S E L K D R L L R S V A D F R N L Q Q L L N S R T D Y * D L W Q I S E I Y N K F * T Q G Q I I K I C G R F Q K F T T S ----:----|----:----|----:----|----:----|----:----|----:----| A E S S L S L N N L D T A S K L F K C C L K Q V * P C I I L I Q P L N * F N V V S R F E L V S * * S R H C I E S I * L L Hpy188I | AluI | CviJI | |DdeI | |Bpu10I Hin4II* | ||SetI CviRI* \ \ \\\ \ GTCACAAAGAAGGATATTCAGAAAGCTAAGGACTTTGCTTTACAGAAGTTTGCAAAGGAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTGTTTCTTCCTATAAGTCTTTCGATTCCTGAAACGAAATGTCTTCAAACGTTTCCTA / / / / / / / | Tsp45I | | | Bpu10I CviRI* | MaeIII | | | DdeI Hin4II* | | CviJI | | AluI | SetI Hpy188I V T K K D I Q K A K D F A L Q K F A K D S Q R R I F R K L R T L L Y R S L Q R I H K E G Y S E S * G L C F T E V C K G F ----:----|----:----|----:----|----:----|----:----|----:----| T V F F S I * F A L S K A K C F N A F S L * L S P Y E S L * P S Q K V S T Q L P D C L L I N L F S L V K S * L L K C L I FatI MnlI TfiI |CviAII BsmI HinfI || NlaIII | MseI | SfeI* || | MwoI | |AhaIII* BbvII* \ \ \\ \ \ \ \\ \ TTATTGGAATCTGTAGATAACTTTGGTCATGCTTTGAATGCTTTTAAAGAGGAAGACTTA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AATAACCTTAGACATCTATTGAAACCAGTACGAAACTTACGAAAATTTCTCCTTCTGAAT / / / // / // // | SfeI* | || MwoI || |MseI HinfI | |FatI || AhaIII* TfiI | CviAII |MnlI NlaIII BsmI L L E S V D N F G H A L N A F K E E D L Y W N L * I T L V M L * M L L K R K T Y I G I C R * L W S C F E C F * R G R L T ----:----|----:----|----:----|----:----|----:----|----:----| K N S D T S L K P * A K F A K L S S S K N I P I Q L Y S Q D H K S H K * L P L S * Q F R Y I V K T M S Q I S K F L F V * MboII AccI | StyI |BssNAI | SecI* TspEI |Hpy166II \ \ \ \\ CAAAAGTCCAAGGAAATTAGTGATTTGTATACAGGGGTTAGAATGACAAGAGATGTTTTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTCAGGTTCCTTTAATCACTAAACATATGTCCCCAATCTTACTGTTCTCTACAAAAA / / / // BbvII* SecI* TspEI |AccI MboII StyI Hpy166II BssNAI Q K S K E I S D L Y T G V R M T R D V F K S P R K L V I C I Q G L E * Q E M F L K V Q G N * * F V Y R G * N D K R C F * ----:----|----:----|----:----|----:----|----:----|----:----| C F D L S I L S K Y V P T L I V L S T K V F T W P F * H N T Y L P * F S L L H K L L G L F N T I Q I C P N S H C S I N K BinI* | MboI | | DpnI DdeI Tsp4CI* TspEI | | |BstKTI \ \ \ \ \ \\ GAAAACACCCTAAGAAAGCACGGTATTGAAAAATTAGACCCATTGGGAGAACCATTTGAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTGTGGGATTCTTTCGTGCCATAACTTTTTAATCTGGGTAACCCTCTTGGTAAACTA / / / / // DdeI Tsp4CI* TspEI | |DpnI | BstKTI BinI* E N T L R K H G I E K L D P L G E P F D K T P * E S T V L K N * T H W E N H L I K H P K K A R Y * K I R P I G R T I * S ----:----|----:----|----:----|----:----|----:----|----:----| S F V R L F C P I S F N S G N P S G N S Q F C G L F A R Y Q F I L G M P L V M Q F V G * S L V T N F F * V W Q S F W K I NlaIV |BssKI ||HpaII AclI |||ScrFI MaeII |||CauII* | SetI |||| Csp6I | TaiI |||| |RsaI | |TaqI SetI |||| || Tsp4CI* \ \\ \ \\\\ \\ \ CCAAATAAACACGAAGCAACGTTCGAGTTGCCACAACCTGATAAGGAACCGGGTACTGTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTATTTGTGCTTCGTTGCAAGCTCAACGGTGTTGGACTATTCCTTGGCCCATGACAA / / / / / / / //// MboI | | TaqI SetI | | |||Tsp4CI* | MaeII | | ||Csp6I | AclI | | |RsaI TaiI | | BssKI SetI | CauII* | HpaII | ScrFI NlaIV P N K H E A T F E L P Q P D K E P G T V Q I N T K Q R S S C H N L I R N R V L F K * T R S N V R V A T T * * G T G Y C F ----:----|----:----|----:----|----:----|----:----|----:----| G F L C S A V N S N G C G S L S G P V T D L Y V R L L T R T A V V Q Y P V P Y Q W I F V F C R E L Q W L R I L F R T S N FatI |CviAII || TatI || Bsp1407I || |Csp6I || |NlaIII || || TspEI || ||RsaI | HphI SetI SetI MmeI Hpy188I \\ \\\ \ \ \ \ \ \ TTCCATGTACAACAATTAGGTTTCACCTTGAATGACAGAGTTATCAGACCAGCAAAAGTC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTACATGTTGTTAATCCAAAGTGGAACTTACTGTCTCAATAGTCTGGTCGTTTTCAG / ///// / / / / / / | ||||| | TspEI SetI MmeI Hpy188I Hpy188I | ||||| | SetI | ||||| HphI | ||||Bsp1407I | ||||TatI | |||Csp6I | ||RsaI | |FatI | CviAII NlaIII F H V Q Q L G F T L N D R V I R P A K V S M Y N N * V S P * M T E L S D Q Q K S P C T T I R F H L E * Q S Y Q T S K S R ----:----|----:----|----:----|----:----|----:----|----:----| K W T C C N P K V K F S L T I L G A F T K G H V V I L N * R S H C L * * V L L L E M Y L L * T E G Q I V S N D S W C F D Hpy188I | MseI |TspEI | Ksp632I* \\ \ \ GGAATTGTTAAGGGCGAAGAGAACTAA 670 680 ----:----|----:----|----:-- CCTTAACAATTCCCGCTTCTCTTGATT / / / | | Ksp632I* | MseI TspEI G I V K G E E N * E L L R A K R T X N C * G R R E L X ----:----|----:----|----:-- P I T L P S S F * R F Q * P R L S S S N N L A F L V L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AclI 1 Psp1406I AhaIII* 1 DraI AluI 3 AluBI ApoI 1 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 1 Bce83I* 1 BpuEI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 1 Bpu10I 1 BseGI 1 BstF5I,BtsCI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 2 CauII* 1 BcnI,BpuMI,NciI,AsuC2I Csp6I 2 CviQI,RsaNI CviAII 2 CviJI 8 CviKI-1 CviRI* 1 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 2 MalI Eco57I 1 AcuI Eco57MI 1 EcoP15I 1 FalI 2 FatI 2 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 GlaI 1 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI HindIII 1 HinfI 3 HpaII 1 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 1 Hpy188III Hpy188I 7 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 2 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 MlyI 1 SchI MmeI 1 MnlI 1 MseI 4 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I PleI 1 PpsI RsaI 2 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 1 BseDI,BssECI,BsaJI SetI 7 SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 1 TatI 1 TfiI 2 PfeI TseI 1 ApeKI Tsp45I 2 NmuCI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 6 TasI,Tsp509I,Sse9I XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AciI AcyI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BmeT110I BmtI BplI BsaAI BsaBI BsaXI BseBI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmAI BsmFI Bsp120I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI Bst2UI BstAPI BstEII BstNI BstOI BstXI BtgZI BtrI BtsI Cac8I Cfr10I Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FaqI FauI FseI FspAI GsaI GsuI HaeII HgaI HgiAI* HgiJII* Hin4I HindII HpaI Hpy99I KasI KpnI MauBI McrI* MfeI MluI Mph1103I MroNI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SauI* ScaI SduI SexAI SfaNI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqII TauI TsoI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769