Restriction Map of DCI1/YOR180C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

DCI1/YOR180C on chromosome XV from coordinates 675167 to 674352.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.13598

EMBOSS_001 MseI VspI TspEI MslI | MseI | BstXI | VspI | | TspDTI | BinI* | | |AsuI* | |TspEI | | |AvaII | || MboI | | ||BmgT120I | || | DpnI BslFI | | |||NlaIV | || | |BstKTI \ \ \ \\\\ \ \\ \ \\ ATGAGCAGTCGTGTGTGCTACCATATTAATGGTCCCTTTTTCATAATCAAATTAATTGAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCGTCAGCACACACGATGGTATAATTACCAGGGAAAAAGTATTAGTTTAATTAACTA / / / / // // /// | | | | |AvaII || ||DpnI | | | | |AsuI* || |BstKTI | | | | BmgT120I || TspEI | | | | NlaIV |VspI | | | TspDTI |MseI | | | VspI TspEI | | | MseI BinI* | | MslI | BstXI BslFI M S S R V C Y H I N G P F F I I K L I D * A V V C A T I L M V P F S * S N * L I E Q S C V L P Y * W S L F H N Q I N * S ----:----|----:----|----:----|----:----|----:----|----:----| X L L R T H * W I L P G K K M I L N I S X S C D H T S G Y * H D R K * L * I L Q H A T T H A V M N I T G K E Y D F * N I AccI |BssNAI |Hpy166II MseI || BsrDI | MnlI TaqI || | CviRI* CviRI* \ \ \ \\ \ \ \ CCAAAACATTTGAACTCTTTAACTTTCGAGGATTTTGTATACATTGCACTATTACTGCAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTTGTAAACTTGAGAAATTGAAAGCTCCTAAAACATATGTAACGTGATAATGACGTA / // / // / / MboI |MseI TaqI |AccI CviRI* CviRI* MnlI Hpy166II BssNAI BsrDI P K H L N S L T F E D F V Y I A L L L H Q N I * T L * L S R I L Y T L H Y Y C I K T F E L F N F R G F C I H C T I T A * ----:----|----:----|----:----|----:----|----:----|----:----| G F C K F E K V K S S K T Y M A S N S C D L V N S S K L K R P N Q I C Q V I V A W F M Q V R * S E L I K Y V N C * * Q M AluI CviJI |DdeI TfiI Hpy166II |Bpu10I BspCNI HinfI | Tsp4CI* ||SetI BseRI |BseMII \ \ \ \\\ \ \\ AAGGCAAACGATATTGATTCTGTTTTGTTTACTGTTCTACAAAGCTCAGGCAAGTATTTC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGTTTGCTATAACTAAGACAAAACAAATGACAAGATGTTTCGAGTCCGTTCATAAAG / / / / / // // / HinfI | Tsp4CI* | | |BseRI || MnlI TfiI Hpy166II | | Bpu10I |BseMII | | DdeI BspCNI | CviJI | AluI SetI K A N D I D S V L F T V L Q S S G K Y F R Q T I L I L F C L L F Y K A Q A S I S G K R Y * F C F V Y C S T K L R Q V F L ----:----|----:----|----:----|----:----|----:----|----:----| L A F S I S E T K N V T R C L E P L Y K Y P L R Y Q N Q K T * Q E V F S L C T N L C V I N I R N Q K S N * L A * A L I E MseI |HpaI |HindII |Hpy166II MnlI || AluI MaeII |SecI* || CviJI |MaeIII ||AvaI || |BccI || SetI |||BmeT110I || ||SetI || TaiI ||||Hpy178III* || ||| Esp3I || EcoP15I ||||| SetI || ||| BsmAI || | BplI ||||| MnlI || ||| | CspCI || | BplI \\\\\ \ \\ \\\ \ \ \\ \ \ TCCTCGGGAGGTAAGTTTTCAGCAGTTAACAAGCTAAACGATGGAGACGTTACAAGCGAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAGCCCTCCATTCAAAAGTCGTCAATTGTTCGATTTGCTACCTCTGCAATGTTCGCTT /// / // / / / / / / // // ||| MnlI || | | | | | | || |MaeIII ||SetI || | | | | | | || EcoP15I |Hpy178III* || | | | | | | |BplI |AvaI || | | | | | | |BplI BmeT110I || | | | | | | MaeII SecI* || | | | | | TaiI || | | | | | SetI || | | | | BsmAI || | | | | Esp3I || | | | CspCI || | | BccI || | CviJI || | AluI || SetI |MseI Hpy166II HindII HpaI S S G G K F S A V N K L N D G D V T S E P R E V S F Q Q L T S * T M E T L Q A K L G R * V F S S * Q A K R W R R Y K R S ----:----|----:----|----:----|----:----|----:----|----:----| E E P P L N E A T L L S F S P S T V L S R R P L Y T K L L * C A L R H L R * L R G R S T L K * C N V L * V I S V N C A F BsmAI |CspCI || AluI AluI || CviJI BplI CviJI || | SetI BplI | SetI MslI \\ \ \ \ \ \ \ GTGGAGAAAGTCTCAAAGCTGGTATCTGCTATAAGCTCTCCTAACATATTTGTGGCGAAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTCTTTCAGAGTTTCGACCATAGACGATATTCGAGAGGATTGTATAAACACCGCTTG / / // / / / / | | || BplI | CviJI MslI | | || BplI | AluI | | |BsmAI SetI | | CviJI | | AluI | SetI CspCI V E K V S K L V S A I S S P N I F V A N W R K S Q S W Y L L * A L L T Y L W R T G E S L K A G I C Y K L S * H I C G E R ----:----|----:----|----:----|----:----|----:----|----:----| T S F T E F S T D A I L E G L M N T A F L P S L R L A P I Q * L S E * C I Q P S H L F D * L Q Y R S Y A R R V Y K H R V AsuI* AvaII |BmgT120I ||Cfr10I |||HpaII ||||CfrI ||||| CviJI ||||| HaeIII ||||| |BtgZI ||||| || BsiYI* ||||| || | Hpy188I BsiYI* Hin4I ||||| || | | DdeI CviRI* | SetI Hin4I ||||| || | | BccI \ \ \ \ \\\\\ \\ \ \ \ GCATTTGCAATCCATAAAAAGGTTCTGGTGTGCTGTTTGAATGGACCGGCCATCGGACTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAAACGTTAGGTATTTTTCCAAGACCACACGACAAACTTACCTGGCCGGTAGCCTGAA / / / / // // / / / CviRI* | SetI Hin4I || || | | BccI BsiYI* Hin4I || || | Hpy188I || || | BtgZI || || CfrI || |Cfr10I || |BsiYI* || |HaeIII || |CviJI || HpaII |AvaII |AsuI* BmgT120I A F A I H K K V L V C C L N G P A I G L H L Q S I K R F W C A V * M D R P S D L I C N P * K G S G V L F E W T G H R T * ----:----|----:----|----:----|----:----|----:----|----:----| A N A I W L F T R T H Q K F P G A M P S R M Q L G Y F P E P T S N S H V P W R V C K C D M F L N Q H A T Q I S R G D S K Hin6I |GlaI ||HhaI TfiI ||| Hin4I HinfI ||| Hin4I | MboII ||| | MaeI MaeIII | | Eco57I ||| | | SfaNI Tsp45I Hpy166II | | Eco57MI \\\ \ \ \ \ \ \ \ \ AGCGCATCGCTAGTTGCTCTTTGTGACATTGTTTACTCGCAAAACGATTCAGTATTTCTT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCGTAGCGATCAACGAGAAACACTGTAACAAATGAGCGTTTTGCTAAGTCATAAAGAA //// / / / / // / |||Hin6I MaeI SfaNI | Hpy166II || Eco57MI ||GlaI Tsp45I || Eco57I |Hin4I MaeIII |HinfI |Hin4I |TfiI |HhaI MboII DdeI S A S L V A L C D I V Y S Q N D S V F L A H R * L L F V T L F T R K T I Q Y F F R I A S C S L * H C L L A K R F S I S S ----:----|----:----|----:----|----:----|----:----|----:----| L A D S T A R Q S M T * E C F S E T N R * R M A L Q E K H C Q K S A F R N L I E A C R * N S K T V N N V R L V I * Y K K MseI Hin4II* PsrI MaeIII SetI \ \ \ \ CTTTTTCCCTTCAGCAATCTCGGTTTTGTCGCAGAAGTGGGAACTTCTGTTACCTTAACT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAAAGGGAAGTCGTTAGAGCCAAAACAGCGTCTTCACCCTTGAAGACAATGGAATTGA / / / / / / Hin4II* PsrI | | | PsrI | | MseI | MaeIII SetI L F P F S N L G F V A E V G T S V T L T F F P S A I S V L S Q K W E L L L P * L F S L Q Q S R F C R R S G N F C Y L N S ----:----|----:----|----:----|----:----|----:----|----:----| R K G K L L R P K T A S T P V E T V K V E K E R * C D R N Q R L L P F K Q * R L K K G E A I E T K D C F H S S R N G * S BsrI | ApoI | TspEI MseI PsrI | |BfiI CviRI* NdeI BsrI |AhaIII* \ \ \\ \ \ \ \\ CAAAAACTGGGTATAAATTCTGCAAACGAACATATGATTTTCAGCACACCAGTTCTATTT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTTGACCCATATTTAAGACGTTTGCTTGTATACTAAAAGTCGTGTGGTCAAGATAAA / / / / / / / BsrI | | CviRI* NdeI BsrI AhaIII* | TspEI | ApoI BfiI Q K L G I N S A N E H M I F S T P V L F K N W V * I L Q T N I * F S A H Q F Y L K T G Y K F C K R T Y D F Q H T S S I * ----:----|----:----|----:----|----:----|----:----|----:----| * F S P I F E A F S C I I K L V G T R N E F V P Y L N Q L R V Y S K * C V L E I L F Q T Y I R C V F M H N E A C W N * K MfeI TspEI TspEI Eco57I | PsrI TspEI |PsrI Eco57MI \ \ \ \\ \ AAAGAATTGATAGGAACTATTATTACAAAAAATTATCAATTGACAAATACTGAAACATTC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTAACTATCCTTGATAATAATGTTTTTTAATAGTTAACTGTTTATGACTTTGTAAG / / // / / MseI TspEI |TspEI TspEI Eco57MI PsrI PsrI MfeI Eco57I K E L I G T I I T K N Y Q L T N T E T F K N * * E L L L Q K I I N * Q I L K H S R I D R N Y Y Y K K L S I D K Y * N I Q ----:----|----:----|----:----|----:----|----:----|----:----| L S N I P V I I V F F * * N V F V S V N * L I S L F * * * L F N D I S L Y Q F M F F Q Y S S N N C F I I L Q C I S F C E Hpy188I | TatI ApoI | |Csp6I MboII Hpy178III* TspEI | |Hpy166II | XmnI |TspDTI |Hin4II* CviJI | ||RsaI \ \ \\ \\ \ \ \\\ AATGAAAAAGTTCTTCAGGACATAAAGCAGAATTTAGAAGGGCTTTATCCGAAAAGTGTA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTTTTCAAGAAGTCCTGTATTTCGTCTTAAATCTTCCCGAAATAGGCTTTTCACAT / / / / / / / / /// | XmnI | Hpy178III* | TspEI CviJI Hpy188I ||Csp6I MboII TspDTI | ApoI |RsaI Hin4II* Hpy166II N E K V L Q D I K Q N L E G L Y P K S V M K K F F R T * S R I * K G F I R K V Y * K S S S G H K A E F R R A L S E K C T ----:----|----:----|----:----|----:----|----:----|----:----| L S F T R * S M F C F K S P S * G F L T * H F L E E P C L A S N L L A K D S F H I F F N K L V Y L L I * F P K I R F T Y TspEI HindIII | MaeIII | AluI | | TspDTI | CviJI | | | Tsp4CI* | | SetI MaeI SetI | | | | TspRI | | | TspDTI BsmAI \ \ \ \ \ \ \ \ \ \ \ \ CTAGGTATGAAAGAATTGTTACACAGTGAAATGAAACAGAAGCTTATCAAAGCACAAGCA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GATCCATACTTTCTTAACAATGTGTCACTTTACTTTGTCTTCGAATAGTTTCGTGTTCGT /// / /// / / / / ||MaeI | ||| Tsp4CI* | | HindIII |SetI | ||MaeIII | | TspDTI TatI | |TspRI | CviJI | TspDTI | AluI TspEI SetI L G M K E L L H S E M K Q K L I K A Q A * V * K N C Y T V K * N R S L S K H K Q R Y E R I V T Q * N E T E A Y Q S T S N ----:----|----:----|----:----|----:----|----:----|----:----| S P I F S N N C L S I F C F S I L A C A V L Y S L I T V C H F S V S A * * L V L * T H F F Q * V T F H F L L K D F C L C Cac8I | AciI | |BisI | ||BlsI | |||TauI NlaIV | |||| Cac8I MseI BsrDI | SetI TspGWI | |||| | CviJI |AhaIII* \ \ \ \ \ \\\\ \ \ \\ ATGGAGACTAACGGAACCTTGCCTTTTTGGGCAAGCGGCGAGCCATTCAAAAGATTTAAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTCTGATTGCCTTGGAACGGAAAAACCCGTTCGCCGCTCGGTAAGTTTTCTAAATTT // / / / /// / / // |BsrDI NlaIV TspGWI | ||| | CviJI |MseI BsmAI SetI | ||| Cac8I AhaIII* | ||BisI | ||AciI | |BlsI | TauI Cac8I M E T N G T L P F W A S G E P F K R F K W R L T E P C L F G Q A A S H S K D L N G D * R N L A F L G K R R A I Q K I * T ----:----|----:----|----:----|----:----|----:----|----:----| I S V L P V K G K Q A L P S G N L L N L L P S * R F R A K K P L R R A M * F I * H L S V S G Q R K P C A A L W E F S K F KasI HgiCI* |AcyI |NarI |Hin6I MnlI ||GlaI AluI ||DinI CviJI ||NlaIV | SetI |||HhaI | | Hpy178III* ||||HaeII PsiI \ \ \ \\\\\ \ CAGCTTCAAGAGGGAAACAGGCGCCACAAGTTATAA 790 800 810 ----:----|----:----|----:----|----:- GTCGAAGTTCTCCCTTTGTCCGCGGTGTTCAATATT /// / ///// / ||CviJI Hpy178III* ||||HgiCI* PsiI ||AluI ||||KasI |MnlI |||Hin6I SetI |||NarI |||AcyI ||NlaIV ||DinI ||GlaI |HhaI HaeII Q L Q E G N R R H K L * S F K R E T G A T S Y X A S R G K Q A P Q V I X ----:----|----:----|----:----|----:- C S * S P F L R W L N Y V A E L P F C A G C T I L K L L S V P A V L * L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 1 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 2 DraI AluI 6 AluBI ApoI 2 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BccI 2 BfiI 1 BmrI,BmuI BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmeT110I 1 BmgT120I 2 BplI 2 Bpu10I 1 BseMII 1 BseRI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BspCNI 1 BsrDI 2 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssNAI 1 Bst1107I,BstZ17I BstKTI 1 BstXI 1 BtgZI 1 Cac8I 2 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 1 CviQI,RsaNI CspCI 1 CviJI 9 CviKI-1 CviRI* 4 HpyCH4V DdeI 2 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 1 MalI Eco57I 2 AcuI Eco57MI 2 EcoP15I 1 Esp3I 1 BsmBI GlaI 2 HaeII 1 BstH2I HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 2 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 2 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI Hpy166II 5 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 2 KasI 1 MaeI 2 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 4 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 2 MfeI 1 MunI MnlI 4 MseI 7 Tru1I,Tru9I MslI 2 RseI,SmiMI NarI 1 Mly113I NdeI 1 FauNDI NlaIV 3 BspLI,BmiI,PspN4I PsiI 1 AanI PsrI 2 RsaI 1 AfaI SecI* 1 BseDI,BssECI,BsaJI SetI 12 SfaNI 1 LweI TaiI 1 TaqI 1 TatI 1 TauI 1 TfiI 2 PfeI Tsp45I 1 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 8 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI VspI 2 PshBI,AseI XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BglI BglII BmtI BsaAI BsaBI BsaXI BseBI BseGI BsePI BseSI BseYI BsgI BsiI* BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BssKI Bst2UI BstAPI BstEII BstF5I BstNI BstOI BstSCI BtrI BtsCI BtsI CauII* Cfr9I ClaI CviAII DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EcoRII EcoRV EcoT22I EspI* FalI FatI FauI FnuDII* FokI FseI FspAI GsaI GsuI HgaI HgiAI* HgiJII* HphI Hpy99I KpnI Ksp632I* MauBI McrI* MluI MlyI MmeI Mph1103I MroNI MstI* MvaI MwoI NaeI NcoI NgoMIV NheI NlaIII NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SexAI SfeI* SfiI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaqII TseI TsoI TspMI TstI Tth111I XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769