Restriction Map of RPO31/YOR116C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

RPO31/YOR116C on chromosome XV from coordinates 544145 to 539763.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 CviJI | ApoI | TspEI | | BbvI | | | Hin6I | | | |GlaI | | | |Eco47III BsiYI* | | | ||HhaI TspDTI | MseI | | | |||HaeII \ \ \ \ \ \ \\\\ ATGAAGGAAGTCGTTGTAAGTGAAACCCCGAAAAGGATTAAAGGGCTGGAATTTAGCGCT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTCCTTCAGCAACATTCACTTTGGGGCTTTTCCTAATTTCCCGACCTTAAATCGCGA / / / / / ///// TspDTI BsiYI* MseI CviJI | ||||MwoI | |||Hin6I | |||BbvI | ||Eco47III | ||GlaI | |HhaI | HaeII TspEI ApoI M K E V V V S E T P K R I K G L E F S A * R K S L * V K P R K G L K G W N L A L E G S R C K * N P E K D * R A G I * R F ----:----|----:----|----:----|----:----|----:----|----:----| X F S T T T L S V G F L I L P S S N L A X S P L R Q L H F G S F S * L A P I * R H L F D N Y T F G R F P N F P Q F K A S MseI AccI |MwoI |Hpy166II || MwoI || MboII || |Hin6I || | Eco57I || ||GlaI || | Eco57MI || ||Eco47III || | |MboI || |||TseI || | |BglII || |||HhaI || | |XhoII || ||||BisI || | || DpnI || ||||HaeII || | || |BstKTI || |||||BlsI BfiI BsrI Hpy188I || | || || TaqI \\ \\\\\\ \ \ \ \\ \ \\ \\ \ TTAAGCGCTGCCGATATTGTCGCCCAGTCTGAAGTGGAAGTGTCTACAAGAGATCTCTTC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AATTCGCGACGGCTATAACAGCGGGTCAGACTTCACCTTCACAGATGTTCTCTAGAGAAG / //////// / / / // // // / | |||||||TseI BfiI BsrI Hpy188I || || || XhoII | ||||||BisI || || || BglII | |||||BlsI || || || MboI | ||||Hin6I || || |DpnI | |||Eco47III || || BstKTI | |||GlaI || |Eco57MI | ||HhaI || |Eco57I | |HaeII || MboII | MseI |AccI MwoI Hpy166II L S A A D I V A Q S E V E V S T R D L F * A L P I L S P S L K W K C L Q E I S S K R C R Y C R P V * S G S V Y K R S L R ----:----|----:----|----:----|----:----|----:----|----:----| K L A A S I T A W D S T S T D V L S R K K L R Q R Y Q R G T Q L P L T * L L D R * A S G I N D G L R F H F H R C S I E E MboI | DpnI | |BstKTI | || SduI GsuI | || HgiAI* BsiYI* | || | DdeI Eco57MI | || | SauI* MwoI TaqII |BsiYI* Ksp632I* | || | | MwoI Tsp4CI* | BccI ||MboII \ \ \\ \ \ \ \ \ \ \\\ GATTTAGAAAAAGATCGTGCTCCTAAGGCGAACGGTGCTTTAGACCCCAAGATGGGTGTC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAATCTTTTTCTAGCACGAGGATTCCGCTTGCCACGAAATCTGGGGTTCTACCCACAG / / // // / / / / / / // / | Ksp632I* || || | | | Tsp4CI* | | || MboII TaqI || || | | MwoI | | |Eco57MI || || | SauI* | | |BsiYI* || || | DdeI | | |GsuI || || MwoI | | BsiYI* || |HgiAI* | BccI || |SduI TaqII || MboI |DpnI BstKTI D L E K D R A P K A N G A L D P K M G V I * K K I V L L R R T V L * T P R W V S F R K R S C S * G E R C F R P Q D G C L ----:----|----:----|----:----|----:----|----:----|----:----| S K S F S R A G L A F P A K S G L I P T R N L F L D H E * P S R H K L G W S P H I * F F I T S R L R V T S * V G L H T D BceAI | FatI BsmAI | |SfaNI | Ksp632I* | |CviAII | | Hpy178III* | || CfrI | | | CviRI* | || |NlaIII | | | | SetI | || ||BalI | | | | MaeIII | || ||CviJI | | BsrI | MnlI | Tsp45I | || ||HaeIII \ \ \ \ \ \ \ \ \\ \\\ TCTTCCTCCAGTCTTGAATGTGCAACCTGTCACGGCAACTTGGCATCGTGTCATGGCCAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGGAGGTCAGAACTTACACGTTGGACAGTGCCGTTGAACCGTAGCACAGTACCGGTA // / // / / / // /// / || | || | SetI Tsp45I || ||| CfrI || | || CviRI* MaeIII || ||HaeIII || | |Hpy178III* || ||SfaNI || | MnlI || ||CviJI || Ksp632I* || ||BalI |BsmAI || |FatI BsrI || CviAII |NlaIII BceAI S S S S L E C A T C H G N L A S C H G H L P P V L N V Q P V T A T W H R V M A I F L Q S * M C N L S R Q L G I V S W P F ----:----|----:----|----:----|----:----|----:----|----:----| E E E L R S H A V Q * P L K A D H * P W R K R W D Q I H L R D R C S P M T D H G R G G T K F T C G T V A V Q C R T M A M MaeIII Tsp45I AluI | MseI CviJI Csp6I | | TspEI | SetI |RsaI CviJI \ \ \ \ \ \\ \ TTTGGTCACTTAAAATTAGCTTTGCCTGTTTTCCACATTGGGTACTTCAAAGCCACCATT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCAGTGAATTTTAATCGAAACGGACAAAAGGTGTAACCCATGAAGTTTCGGTGGTAA / / / / // / | MseI | CviJI |Csp6I CviJI Tsp45I | AluI RsaI MaeIII TspEI SetI F G H L K L A L P V F H I G Y F K A T I L V T * N * L C L F S T L G T S K P P F W S L K I S F A C F P H W V L Q S H H S ----:----|----:----|----:----|----:----|----:----|----:----| K P * K F N A K G T K W M P Y K L A V M N Q D S L I L K A Q K G C Q T S * L W W K T V * F * S Q R N E V N P V E F G G N CviRI* | PsrI PsrI | | SetI Tsp4CI* | Hpy188I \ \ \ \ \ \ CAAATACTGCAAGGTATCTGTAAAAACTGTTCTGCCATATTGTTATCAGAAACAGATAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTATGACGTTCCATAGACATTTTTGACAAGACGGTATAACAATAGTCTTTGTCTATTT / / / / / / / | | SetI Tsp4CI* PsrI Hpy188I BcgI | CviRI* PsrI Q I L Q G I C K N C S A I L L S E T D K K Y C K V S V K T V L P Y C Y Q K Q I K N T A R Y L * K L F C H I V I R N R * K ----:----|----:----|----:----|----:----|----:----|----:----| * I S C P I Q L F Q E A M N N D S V S L E F V A L Y R Y F S N Q W I T I L F L Y L Y Q L T D T F V T R G Y Q * * F C I F Hpy99I |BssKI |EcoRII || ScrFI || BseBI FatI || TspDTI MaeII CviRI* || | BcgI | SetI BcgI |CviAII || | | TspEI | TaiI | TspEI || NlaIII || | | | MseI | | AjuI \ \ \\ \ \\ \ \ \ \ \ \ \ AGACAATTTTTGCATGAACTTCGTCGTCCAGGCGTAGATAATTTAAGACGTATGGGTATA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGTTAAAAACGTACTTGAAGCAGCAGGTCCGCATCTATTAAATTCTGCATACCCATAT / / // / / / // / / / / | | |FatI | | | |BcgI | | | MaeII | | | | | | EcoRII | | | AjuI | | | | | | BssKI | | TaiI | | | | | BseBI | | SetI | | | | | ScrFI | MseI | | | | TspDTI TspEI | | | Hpy99I | | CviAII | CviRI* | NlaIII TspEI R Q F L H E L R R P G V D N L R R M G I D N F C M N F V V Q A * I I * D V W V Y T I F A * T S S S R R R * F K T Y G Y I ----:----|----:----|----:----|----:----|----:----|----:----| L C N K C S S R R G P T S L K L R I P I F V I K A H V E D D L R L Y N L V Y P Y S L K Q M F K T T W A Y I I * S T H T Y AsuI* AvaII AjuI EcoP15I MboII | Hin4II* | SduI |BmgT120I | | AlfI CviRI* | HgiAI* || MboII | | AlfI SetI | MslI | | MseI \\ \ \ \ \ \ \ \ \ \ \ TTGAAGAAGATTTTGGACCAATGTAAAAAGCAAAGAAGGTGTCTGCATTGTGGTGCTCTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTCTTCTAAAACCTGGTTACATTTTTCGTTTCTTCCACAGACGTAACACCACGAGAA / // / / / / / / / / | || AjuI | | SetI | | | EcoP15I | |AvaII | AlfI | | HgiAI* | |AsuI* | AlfI | | SduI | BmgT120I Hin4II* | MslI | MboII CviRI* MboII L K K I L D Q C K K Q R R C L H C G A L * R R F W T N V K S K E G V C I V V L L E E D F G P M * K A K K V S A L W C S * ----:----|----:----|----:----|----:----|----:----|----:----| N F F I K S W H L F C L L H R C Q P A R I S S S K P G I Y F A F F T D A N H H E Q L L N Q V L T F L L S P T Q M T T S K AlfI AlfI |BbvI |Hpy178III* || CviJI || |AciI || |BisI || ||BlsI MwoI || |||TseI | CviJI || |||TauI | |AciI || |||NspBII* | |BisI || ||||BisI | ||BlsI FatI || |||||BlsI | |||TauI |CviAII || |||||| MwoI | |||FnuDII* || MboII \\ \\\\\\ \ \ \\\\ \\ \ AATGGTGTCGTGAAAAAAGCCGCTGCTGGTGCTGGTTCAGCCGCGTTGAAGATTATCCAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTACCACAGCACTTTTTTCGGCGACGACCACGACCAAGTCGGCGCAACTTCTAATAGGTA / / / / /////// / //// / // MseI AlfI | BbvI ||||||MwoI MwoI |||FnuDII* | |CviAII AlfI | ||||||TseI |||AciI | MboII | |||||BisI ||BisI NlaIII | ||||BlsI |BlsI | |||NspBII* CviJI | |||AciI TauI | ||BisI | |BlsI | CviJI | TauI Hpy178III* N G V V K K A A A G A G S A A L K I I H M V S * K K P L L V L V Q P R * R L S M W C R E K S R C W C W F S R V E D Y P * ----:----|----:----|----:----|----:----|----:----|----:----| L P T T F F A A A P A P E A A N F I I W * H H R S F L R Q Q H Q N L R T S S * G I T D H F F G S S T S T * G R Q L N D M AciI | BsrBI | | Hpy178III* NlaIII SetI | | | TaqII Hin4II* \ \ \ \ \ \ \ GATACATTTCGTTGGGTAGGTAAAAAGTCCGCTCCTGAAAAGGATATTTGGGTGGGAGAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTATGTAAAGCAACCCATCCATTTTTCAGGCGAGGACTTTTCCTATAAACCCACCCTCTT / / / // / FatI SetI | |TaqII Hin4II* | Hpy178III* BsrBI AciI D T F R W V G K K S A P E K D I W V G E I H F V G * V K S P L L K R I F G W E N Y I S L G R * K V R S * K G Y L G G R M ----:----|----:----|----:----|----:----|----:----|----:----| S V N R Q T P L F D A G S F S I Q T P S H Y M E N P L Y F T R E Q F P Y K P P L I C K T P Y T F L G S R F L I N P H S F AclI MaeII Hpy178III* | SetI | MaeI | TaiI \ \ \ \ TGGAAGGAAGTTCTTGCTCATAATCCAGAACTAGAGCGTTATGTGAAACGTTGTATGGAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTTCCTTCAAGAACGAGTATTAGGTCTTGATCTCGCAATACACTTTGCAACATACCTA / / / / | MaeI | MaeII Hpy178III* | AclI TaiI SetI W K E V L A H N P E L E R Y V K R C M D G R K F L L I I Q N * S V M * N V V W M E G S S C S * S R T R A L C E T L Y G * ----:----|----:----|----:----|----:----|----:----|----:----| H F S T R A * L G S S S R * T F R Q I S I S P L E Q E Y D L V L A N H S V N Y P P L F N K S M I W F * L T I H F T T H I BseGI |MseI ||SwaI BbvI ||BsaBI TspRI SfeI* TseI ||AhaIII* | MseI TspEI | CviRI* AluI ||| FokI | |AhaIII* | MseI | | PstI CviJI \\\ \ \ \\ \ \ \ \ \ \ GATTTAAATCCACTGAAAACTTTAAATCTTTTCAAGCAAATTAAGTCTGCAGATTGTGAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAATTTAGGTGACTTTTGAAATTTAGAAAAGTTCGTTTAATTCAGACGTCTAACACTC / // / / // // / / / / / | || TspRI FokI |MseI || | | SfeI* | CviJI | |MseI AhaIII* || | | BbvI | AluI | AhaIII* || | CviRI* SetI | BsaBI || PstI | SwaI |MseI BseGI TspEI D L N P L K T L N L F K Q I K S A D C E I * I H * K L * I F S S K L S L Q I V S F K S T E N F K S F Q A N * V C R L * A ----:----|----:----|----:----|----:----|----:----|----:----| S K F G S F V K F R K L C I L D A S Q S H N L D V S F K L D K * A F * T Q L N H I * I W Q F S * I K E L L N L R C I T L BisI AccI |BlsI |BsmAI |SetI CviRI* |Hpy166II ||SfaNI | Tsp4CI* || MnlI NdeI \\\ \ \ \\ \ \ CTGCTTGGTATAGATGCAACAGTTCCCTCTGGTAGACCAGAGACTTACATATGGAGATAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GACGAACCATATCTACGTTGTCAAGGGAGACCATCTGGTCTCTGAATGTATACCTCTATA /// / / / // / / ||| SfaNI | Tsp4CI* || BsmAI NdeI ||TseI CviRI* |MnlI |BisI |AccI BlsI Hpy166II L L G I D A T V P S G R P E T Y I W R Y C L V * M Q Q F P L V D Q R L T Y G D I A W Y R C N S S L W * T R D L H M E I F ----:----|----:----|----:----|----:----|----:----|----:----| S S P I S A V T G E P L G S V * M H L Y A A Q Y L H L L E R Q Y V L S K C I S I Q K T Y I C C N G R T S W L S V Y P S I GsuI Eco57MI MnlI | Hin4II* BarI |TspGWI | | MlyI SetI || StuI | | PleI FauI || CviJI | | | CviRI* BetI* || HaeIII | | | | BarI AciI |HpaII || | SfaNI | | | | | HinfI \ \\ \\ \ \ \ \ \ \ \ \ TTACCCGCACCTCCGGTTTGTATAAGGCCTTCCGTTATGATGCAAGACTCTCCAGCATCT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AATGGGCGTGGAGGCCAAACATATTCCGGAAGGCAATACTACGTTCTGAGAGGTCGTAGA // /// / / / / //// / |SetI ||| TspGWI | | | |||CviRI* HinfI AciI ||| MnlI | | | ||PleI BarI ||BetI* | | | |MlyI |HpaII | | | BarI FauI | | Hin4II* | Eco57MI | SfaNI | GsuI HaeIII CviJI StuI L P A P P V C I R P S V M M Q D S P A S Y P H L R F V * G L P L * C K T L Q H L T R T S G L Y K A F R Y D A R L S S I * ----:----|----:----|----:----|----:----|----:----|----:----| K G A G G T Q I L G E T I I C S E G A D N V R V E P K Y L A K R * S A L S E L M * G C R R N T Y P R G N H H L V R W C R MboII | Tsp4CI* TspGWI | | HindIII | Tth111I | | | AluI | | FalI | | | CviJI | | FalI SfaNI | | | | SetI | | | MseI \ \ \ \ \ \ \ \ \ \ AACGAAGATGACTTGACAGTAAAGCTTACGGAAATAGTTTGGACTTCGTCTTTAATCAAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTTCTACTGAACTGTCATTTCGAATGCCTTTATCAAACCTGAAGCAGAAATTAGTTT / / / / / / / // / SfaNI | | | | HindIII | |Tth111I MseI | | | CviJI | FalI | | | AluI | FalI | | SetI TspGWI | Tsp4CI* MboII N E D D L T V K L T E I V W T S S L I K T K M T * Q * S L R K * F G L R L * S K R R * L D S K A Y G N S L D F V F N Q S ----:----|----:----|----:----|----:----|----:----|----:----| L S S S K V T F S V S I T Q V E D K I L * R L H S S L L A * P F L K S K T K L * V F I V Q C Y L K R F Y N P S R R * D F CviJI FalI Cfr10I FalI |HpaII | MseI || Hpy178III* | | BccI \\ \ \ \ \ GCCGGTCTTGACAAGGGTATTTCCATTAACAATATGATGGAACATTGGGATTACTTACAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCCAGAACTGTTCCCATAAAGGTAATTGTTATACTACCTTGTAACCCTAATGAATGTT / // / / / / | || | FalI | BccI | || | FalI MseI | || Hpy178III* | |Cfr10I | HpaII CviJI A G L D K G I S I N N M M E H W D Y L Q P V L T R V F P L T I * W N I G I T Y N R S * Q G Y F H * Q Y D G T L G L L T T ----:----|----:----|----:----|----:----|----:----|----:----| A P R S L P I E M L L I I S C Q S * K C L R D Q C P Y K W * C Y S P V N P N S V G T K V L T N G N V I H H F M P I V * L Tsp4CI* | CviRI* | | TatI | | Bsp1407I | | |Csp6I | | ||RsaI | | |||BsrDI | | |||| MlyI | | |||| PleI | | |||| | DdeI | | |||| | | Hpy188I | | |||| | | |HinfI | | |||| | | || DdeI | | |||| | | || |Tth111I | | |||| | | || || SfaNI | | |||| | | || || | BspCNI | | |||| | | || || | |BseMII | | |||| | | || || | || BspCNI | | |||| | | || || | || |BseMII | | |||| | | || || | || ||FokI | | |||| | | || || | || ||| TspDTI | | |||| | | || || | || ||| | BssKI | | |||| | | || || | || ||| | SexAI | | |||| | | || || | || ||| | EcoRII | | |||| | | || || | || ||| | | ScrFI | | |||| | | || || | || ||| | | BseBI | | |||| | | || || | || ||| | | | SetI | | |||| | | || || | || ||| | | | |BseGI | | |||| | | || || | || ||| | | | |BtgZI \ \ \\\\ \ \ \\ \\ \ \\ \\\ \ \ \ \\ CTGACTGTTGCAATGTACATCAACTCAGACTCAGTCAATCCTGCGATGCTACCAGGTTCA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GACTGACAACGTTACATGTAGTTGAGTCTGAGTCAGTTAGGACGCTACGATGGTCCAAGT / / //// // // /// // / // / / // / | | |||| || || ||| || | || | | || EcoRII | | |||| || || ||| || | || | | || SexAI | | |||| || || ||| || | || | | || BssKI | | |||| || || ||| || | || | | || BseGI | | |||| || || ||| || | || | | |BseBI | | |||| || || ||| || | || | | |ScrFI | | |||| || || ||| || | || | | SetI | | |||| || || ||| || | || | FokI | | |||| || || ||| || | || TspDTI | | |||| || || ||| || | |BseMII | | |||| || || ||| || | BspCNI | | |||| || || ||| || SfaNI | | |||| || || ||| |BseMII | | |||| || || ||| BspCNI | | |||| || || ||DdeI | | |||| || || |Tth111I | | |||| || || HinfI | | |||| || |DdeI | | |||| || Hpy188I | | |||| |PleI | | |||| MlyI | | |||Bsp1407I | | |||TatI | | ||Csp6I | | |RsaI | | BsrDI | CviRI* Tsp4CI* L T V A M Y I N S D S V N P A M L P G S * L L Q C T S T Q T Q S I L R C Y Q V H D C C N V H Q L R L S Q S C D A T R F I ----:----|----:----|----:----|----:----|----:----|----:----| S V T A I Y M L E S E T L G A I S G P E V S Q Q L T C * S L S L * D Q S A V L N Q S N C H V D V * V * D I R R H * W T * AciI |BisI MnlI ||BlsI |EciI |||AciI |TspEI |||TauI || BsiYI* Hpy166II \\\\ \\ \ \ TCCAATGGCGGCGGAAAAGTGAAACCAATTAGAGGGTTCTGCCAAAGACTAAAGGGTAAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTACCGCCGCCTTTTCACTTTGGTTAATCTCCCAAGACGGTTTCTGATTTCCCATTT / /// / / / / / BtgZI ||| AciI | | TspEI Hpy166II ||BisI | BsiYI* ||AciI EciI |BlsI MnlI TauI S N G G G K V K P I R G F C Q R L K G K P M A A E K * N Q L E G S A K D * R V N Q W R R K S E T N * R V L P K T K G * T ----:----|----:----|----:----|----:----|----:----|----:----| D L P P P F T F G I L P N Q W L S F P L M W H R R F L S V L * L T R G F V L P Y G I A A S F H F W N S P E A L S * L T F TaqI SetI | TfiI | HinfI TspEI TaqI Tsp4CI* \ \ \ \ \ CAAGGTCGATTCAGGGGTAATTTGTCTGGTAAGCGTGTCGATTTTTCTGGTAGAACTGTT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCCAGCTAAGTCCCCATTAAACAGACCATTCGCACAGCTAAAAAGACCATCTTGACAA / / / / / / SetI | HinfI TspEI TaqI Tsp4CI* | TfiI TaqI Q G R F R G N L S G K R V D F S G R T V K V D S G V I C L V S V S I F L V E L L R S I Q G * F V W * A C R F F W * N C Y ----:----|----:----|----:----|----:----|----:----|----:----| C P R N L P L K D P L R T S K E P L V T V L D I * P Y N T Q Y A H R N K Q Y F Q L T S E P T I Q R T L T D I K R T S S N BetI* BspMII* |HpaII |Hpy178III* || AsuI* || AvaII MboI || |BmgT120I MnlI | DpnI || ||NlaIV |BslFI SetI | |BstKTI CviRI* \\ \\\ \\ \ \ \\ \ ATTTCTCCGGACCCAAACTTGTCCATTGACGAGGTTGCTGTCCCAGATCGTGTTGCAAAA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGAGGCCTGGGTTTGAACAGGTAACTGCTCCAACGACAGGGTCTAGCACAACGTTTT //// / / / // / / |||AvaII MnlI | SetI || MboI CviRI* |||AsuI* BslFI |DpnI ||BmgT120I BstKTI ||NlaIV |BspMII* |BetI* Hpy178III* HpaII I S P D P N L S I D E V A V P D R V A K F L R T Q T C P L T R L L S Q I V L Q K F S G P K L V H * R G C C P R S C C K S ----:----|----:----|----:----|----:----|----:----|----:----| I E G S G F K D M S S T A T G S R T A F * K E P G L S T W Q R P Q Q G L D H Q L N R R V W V Q G N V L N S D W I T N C F Hpy178III* | MaeII | | SetI TspEI | | TaiI | MseI | | | Hpy178III* | VspI | | | | BciVI | |TspEI | | | | |MaeIII | || Hin4I | | | | || SetI SetI TspEI | || Hin4I \ \ \ \ \\ \ \ \ \ \\ \ GTCTTGACGTATCCCGAAAAGGTAACAAGGTATAATAGACATAAATTACAAGAATTAATT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAACTGCATAGGGCTTTTCCATTGTTCCATATTATCTGTATTTAATGTTCTTAATTAA // / / / // / / // / || MaeII | BciVI |SetI TspEI | || TspEI |TaiI | SetI MaeIII | |VspI |SetI Hpy178III* | |MseI Hpy178III* | TspEI Hin4I Hin4I V L T Y P E K V T R Y N R H K L Q E L I S * R I P K R * Q G I I D I N Y K N * L L D V S R K G N K V * * T * I T R I N C ----:----|----:----|----:----|----:----|----:----|----:----| T K V Y G S F T V L Y L L C L N C S N I L R S T D R F P L L T Y Y V Y I V L I L D Q R I G F L Y C P I I S M F * L F * N FokI | AsuI* | AvaII | |BmgT120I | ||NlaIV | ||| Eam1105I | ||| | BseGI | ||| | | BssKI | ||| | | EcoRII | ||| | | |SecI* | ||| | | ||ScrFI | ||| | | ||BseBI | ||| | | |||BsiYI* Hin4I | ||| | | |||| BccI Hin4I SfaNI CviRI* \ \\\ \ \ \\\\ \ \ \ \ GTAAATGGACCCAATGTCCATCCTGGGGCGAACTATTTACTGAAAAGAAACGAAGATGCA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CATTTACCTGGGTTACAGGTAGGACCCCGCTTGATAAATGACTTTTCTTTGCTTCTACGT // / / / / // / / || | | | | |BccI SfaNI CviRI* || | | | | EcoRII || | | | | Hin4I || | | | | Hin4I || | | | | BssKI || | | | | SecI* || | | | BseBI || | | | ScrFI || | | BsiYI* || | BseGI || Eam1105I |AvaII |AsuI* BmgT120I NlaIV FokI V N G P N V H P G A N Y L L K R N E D A * M D P M S I L G R T I Y * K E T K M Q K W T Q C P S W G E L F T E K K R R C K ----:----|----:----|----:----|----:----|----:----|----:----| T F P G L T W G P A F * K S F L F S S A Q L H V W H G D Q P S S N V S F F R L H Y I S G I D M R P R V I * Q F S V F I C CviJI DdeI MboI | ApoI |SetI | DpnI | TspEI TspEI MboII || MboII | |BstKTI HphI | |TspDTI |TsoI \ \\ \ \ \\ \ \ \\ \\ AGAAGAAACCTAAGATATGGTGATCGTATGAAGTTAGCCAAAAATTTACAAATTGGTGAT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTCTTTGGATTCTATACCACTAGCATACTTCAATCGGTTTTTAAATGTTTAACCACTA / / / // / / / / / / / | SetI MboII || MboI HphI | | | TsoI TspEI MboII DdeI |DpnI | | TspEI BstKTI | | ApoI | TspDTI CviJI R R N L R Y G D R M K L A K N L Q I G D E E T * D M V I V * S * P K I Y K L V M K K P K I W * S Y E V S Q K F T N W * C ----:----|----:----|----:----|----:----|----:----|----:----| L L F R L Y P S R I F N A L F K C I P S L F F G L I H H D Y S T L W F N V F Q H S S V * S I T I T H L * G F I * L N T I Tsp4CI* |BbvII* || MboII || | AsuI* TaqI || | AvaII Tsp4CI* | HphI || | |BmgT120I | HindII BccI | Hpy99I || | || HphI | Hpy166II CviRI* \ \ \\ \ \\ \ \ \ \ GTCGTCGAAAGACATTTAGAAGACGGTGATGTGGTCCTATTCAACCGTCAACCATCTTTG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCAGCTTTCTGTAAATCTTCTGCCACTACACCAGGATAAGTTGGCAGTTGGTAGAAAC / // / / // / / / | |TaqI | | |AvaII | Hpy166II CviRI* | HphI | | |AsuI* | HindII Hpy99I | | |HphI Tsp4CI* | | BmgT120I | BbvII* | MboII Tsp4CI* V V E R H L E D G D V V L F N R Q P S L S S K D I * K T V M W S Y S T V N H L C R R K T F R R R * C G P I Q P S T I F A ----:----|----:----|----:----|----:----|----:----|----:----| T T S L C K S S P S T T R N L R * G D K H R R F V N L L R H H P G I * G D V M K D D F S M * F V T I H D * E V T L W R Q DdeI | TfiI StyI TspEI | HinfI SecI* SetI MseI \ \ \ \ \ \ CATAGATTATCAATTTTATCGCATTATGCTAAGATTCGTCCTTGGAGAACCTTTAGATTA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GTATCTAATAGTTAAAATAGCGTAATACGATTCTAAGCAGGAACCTCTTGGAAATCTAAT / / / / / / / BccI TspEI | HinfI | SetI MseI | TfiI SecI* DdeI StyI H R L S I L S H Y A K I R P W R T F R L I D Y Q F Y R I M L R F V L G E P L D * * I I N F I A L C * D S S L E N L * I K ----:----|----:----|----:----|----:----|----:----|----:----| C L N D I K D C * A L I R G Q L V K L N A Y I I L K I A N H * S E D K S F R * I M S * * N * R M I S L N T R P S G K S * CviRI* MaeIII | TspDTI Tsp45I ApoI FatI | | SetI Hpy99I TspEI CviRI* | | | PsiI TaqI Tsp4CI* |HphI |CviAII \ \ \ \ \ \ \\ \\ AATGAATGTGTTTGCACACCTTATAACGCTGACTTCGACGGTGACGAAATGAATTTGCAT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTACACAAACGTGTGGAATATTGCGACTGAAGCTGCCACTGCTTTACTTAAACGTA // / / / / / / / / / / || SetI PsiI | | | | | | | CviAII |TspDTI | | | | | | CviRI* CviRI* | | | | | | NlaIII | | | | | | NspI | | | | | TspEI | | | | | ApoI | | | | HphI | | | Tsp45I | | | MaeIII | | Tsp4CI* | TaqI Hpy99I N E C V C T P Y N A D F D G D E M N L H M N V F A H L I T L T S T V T K * I C M * M C L H T L * R * L R R * R N E F A C ----:----|----:----|----:----|----:----|----:----|----:----| F S H T Q V G * L A S K S P S S I F K C L H I H K C V K Y R Q S R R H R F S N A I F T N A C R I V S V E V T V F H I Q M CviJI |BsiI* || MboII || CviRI* || | AluI || | CviJI NspI || | | SetI NlaIII || | | |TaqII | TspDTI || | | || TspEI | | Ksp632I* || | | || | MseI | | |MnlI || | | || | | BsgI \ \ \\ \\ \ \ \\ \ \ \ GTTCCACAAACCGAAGAGGCTCGTGCAGAAGCTATCAATTTAATGGGTGTGAAAAATAAC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGGTGTTTGGCTTCTCCGAGCACGTCTTCGATAGTTAAATTACCCACACTTTTTATTG // / / / // / // / / || | | | || | |TaqII | BsgI || | | | || | CviJI | MseI || | | | || | AluI TspEI || | | | || SetI || | | | |CviRI* || | | | MboII || | | | BsiI* || | | CviJI || | Ksp632I* || MnlI |TspDTI FatI V P Q T E E A R A E A I N L M G V K N N F H K P K R L V Q K L S I * W V * K I T S T N R R G S C R S Y Q F N G C E K * L ----:----|----:----|----:----|----:----|----:----|----:----| T G C V S S A R A S A I L K I P T F F L H E V F R L P E H L L * * N L P H S F Y N W L G F L S T C F S D I * H T H F I V DdeI |SetI || EcoNI || | BsiYI* || | | SetI || | | |Hpy166II || | | || Bce83I* || | | || |SetI || | | || || HphI || | | || || | AciI || | | || || | |BisI || | | || || | ||BlsI || | | || || | |||TauI || | | || || | |||CviJI || | | || || | |||| TspDTI || | | || || | |||| | SmlI || | | || || | |||| | | Hpy178III* MseI || | | || || | |||| | | | TspDTI BsrI \ \\ \ \ \\ \\ \ \\\\ \ \ \ \ \ TTATTAACACCTAAGTCAGGTGAACCTATTATTGCGGCTACTCAAGATTTCATAACTGGT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AATAATTGTGGATTCAGTCCACTTGGATAATAACGCCGATGAGTTCTAAAGTATTGACCA / / /// / /// / //// / / / | SetI ||| SetI ||| | |||TspDTI | TspDTI BsrI MseI ||EcoNI ||| | |||CviJI Hpy178III* |DdeI ||| | ||BisI SmlI BsiYI* ||| | ||AciI ||| | |BlsI ||| | TauI ||| HphI ||Bce83I* |SetI Hpy166II L L T P K S G E P I I A A T Q D F I T G Y * H L S Q V N L L L R L L K I S * L V I N T * V R * T Y Y C G Y S R F H N W F ----:----|----:----|----:----|----:----|----:----|----:----| K N V G L D P S G I I A A V * S K M V P S I L V * T L H V * * Q P * E L N * L Q * * C R L * T F R N N R S S L I E Y S T MboI TfiI | DpnI MseI HinfI | |BstKTI MseI \ \ \ \\ \ TCATATTTAATATCACATAAGGATTCTTTCTATGATCGTGCTACATTAACTCAACTATTG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AGTATAAATTATAGTGTATTCCTAAGAAAGATACTAGCACGATGTAATTGAGTTGATAAC / / // / / MseI HinfI || MboI MseI TfiI |DpnI BstKTI S Y L I S H K D S F Y D R A T L T Q L L H I * Y H I R I L S M I V L H * L N Y C I F N I T * G F F L * S C Y I N S T I V ----:----|----:----|----:----|----:----|----:----|----:----| E Y K I D C L S E K * S R A V N V * S N N M N L I V Y P N K R H D H * M L E V I * I * Y * M L I R E I I T S C * S L * Q FatI MnlI BspHI |CviAII Hpy188I |Hpy178III* | Tsp4CI* SduI || NlaIII | | TaqI HgiAI* SetI || | Tsp4CI* \ \ \ \ \ \\ \ \ TCTATGATGTCTGACGGTATCGAGCACTTTGACATACCACCTCCTGCTATCATGAAACCG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AGATACTACAGACTGCCATAGCTCGTGAAACTGTATGGTGGAGGACGATAGTACTTTGGC / / / / // // / | | HgiAI* SetI || || Tsp4CI* | | TaqI || |BspHI | | SduI || |FatI | Tsp4CI* || Hpy178III* Hpy188I || CviAII |NlaIII MnlI S M M S D G I E H F D I P P P A I M K P L * C L T V S S T L T Y H L L L S * N R Y D V * R Y R A L * H T T S C Y H E T V ----:----|----:----|----:----|----:----|----:----|----:----| D I I D S P I S C K S M G G G A I M F G T * S T Q R Y R A S Q C V V E Q * * S V R H H R V T D L V K V Y W R R S D H F R TspDTI | AsuI* | AvaII | |BmgT120I | ||AgeI | ||BetI* | ||Cfr10I | |||HpaII TspEI | |||| Hpy166II AjuI |BfiI \ \\\\ \ \ \\ TATTACTTATGGACCGGTAAACAAGTTTTTTCACTTTTGATAAAACCAAATCACAATTCC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| ATAATGAATACCTGGCCATTTGTTCAAAAAAGTGAAAACTATTTTGGTTTAGTGTTAAGG / // // / / / // TspDTI || || Hpy166II AjuI | |BsrI || |Cfr10I | TspEI || |BetI* BfiI || |AgeI || HpaII |AvaII |AsuI* BmgT120I Y Y L W T G K Q V F S L L I K P N H N S I T Y G P V N K F F H F * * N Q I T I P L L M D R * T S F F T F D K T K S Q F P ----:----|----:----|----:----|----:----|----:----|----:----| Y * K H V P L C T K E S K I F G F * L E T N S I S R Y V L K K V K S L V L D C N I V * P G T F L N K * K Q Y F W I V I G FnuDII* AjuI | BslFI BsrI | DdeI | | HgaI MboII MnlI \ \ \ \ \ \ \ \ CCAGTTGTGATAAACTTAGACGCGAAGAACAAAGTCTTTGTCCCTCCAAAATCAAAATCC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCAACACTATTTGAATCTGCGCTTCTTGTTTCAGAAACAGGGAGGTTTTAGTTTTAGG / / / / / / / AjuI | | | | MboII MnlI | | | HgaI | | BslFI | FnuDII* DdeI P V V I N L D A K N K V F V P P K S K S Q L * * T * T R R T K S L S L Q N Q N P S C D K L R R E E Q S L C P S K I K I P ----:----|----:----|----:----|----:----|----:----|----:----| G T T I F K S A F F L T K T G G F D F D G L Q S L S L R S S C L R Q G E L I L I W N H Y V * V R L V F D K D R W F * F G ApoI MaeIII TspDTI TspEI TspEI Tsp45I | Hpy99I | MnlI CviJI | MseI \ \ \ \ \ \ \ \ CTACCAAATGAAATGTCACAAAACGACGGGTTTGTAATTATTAGAGGCTCTCAAATTTTA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| GATGGTTTACTTTACAGTGTTTTGCTGCCCAAACATTAATAATCTCCGAGAGTTTAAAAT / / / / / / / / | | Hpy99I | TspEI CviJI | MseI | TspDTI MnlI TspEI Tsp45I ApoI MaeIII L P N E M S Q N D G F V I I R G S Q I L Y Q M K C H K T T G L * L L E A L K F * T K * N V T K R R V C N Y * R L S N F K ----:----|----:----|----:----|----:----|----:----|----:----| R G F S I D C F S P N T I I L P E * I K G V L H F T V F R R T Q L * * L S E F K * W I F H * L V V P K Y N N S A R L N * BccI HphI BccI HphI MaeI SetI | BsmI \ \ \ \ \ \ AGTGGGGTGATGGACAAGTCTGTTCTAGGTGATGGTAAGAAGCATTCTGTGTTTTATACG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TCACCCCACTACCTGTTCAGACAAGATCCACTACCATTCTTCGTAAGACACAAAATATGC / / // // BccI HphI |MaeI |BsmI SetI HphI BccI S G V M D K S V L G D G K K H S V F Y T V G * W T S L F * V M V R S I L C F I R W G D G Q V C S R * W * E A F C V L Y D ----:----|----:----|----:----|----:----|----:----|----:----| L P T I S L D T R P S P L F C E T N * V L H P S P C T Q E L H H Y S A N Q T K Y T P H H V L R N * T I T L L M R H K I R CviJI |AciI |BisI AsuI* ||BlsI |CviJI ||BceAI |HaeIII |||TauI MseI |BmgT120I |||| MwoI TspDTI \ \\ \\\\ \ \ ATATTAAGAGATTACGGCCCACAAGAAGCCGCTAATGCTATGAATAGAATGGCAAAACTA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TATAATTCTCTAATGCCGGGTGTTCTTCGGCGATTACGATACTTATCTTACCGTTTTGAT / /// ///// / MseI ||AsuI* ||||BceAI TspDTI |BmgT120I |||MwoI HaeIII |||AciI CviJI ||BisI |BlsI CviJI TauI I L R D Y G P Q E A A N A M N R M A K L Y * E I T A H K K P L M L * I E W Q N Y I K R L R P T R S R * C Y E * N G K T M ----:----|----:----|----:----|----:----|----:----|----:----| I N L S * P G C S A A L A I F L I A F S S I L L N R G V L L R * H * S Y F P L V Y * S I V A W L F G S I S H I S H C F * SetI | DdeI | | MnlI MseI MaeIII MaeI | | | SetI EcoP15I VspI Tsp45I SetI \ \ \ \ \ \ \ \ \ TGTGCTAGGTTCTTAGGTAATAGAGGGTTTTCTATTGGTATTAATGATGTCACACCTGCT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| ACACGATCCAAGAATCCATTATCTCCCAAAAGATAACCATAATTACTACAGTGTGGACGA // // / / / |MaeI |DdeI EcoP15I VspI Tsp45I SetI |MnlI MseI MaeIII SetI SetI C A R F L G N R G F S I G I N D V T P A V L G S * V I E G F L L V L M M S H L L C * V L R * * R V F Y W Y * * C H T C * ----:----|----:----|----:----|----:----|----:----|----:----| H A L N K P L L P N E I P I L S T V G A I H * T R L Y Y L T K * Q Y * H H * V Q T S P E * T I S P K R N T N I I D C R S SpeI |MaeI || TaqI MslI || | MboII | MaeIII AarI || | |TspEI | Tsp45I BspMI Hin4II* || | || CviRI* | | TspEI \ \ \\ \ \\ \ \ \ \ GATGATTTGAAGCAAAAGAAGGAAGAACTAGTCGAAATTGCATACCATAAGTGTGACGAA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTAAACTTCGTTTTCTTCCTTCTTGATCAGCTTTAACGTATGGTATTCACACTGCTT / / // // // / / | Hin4II* || |TaqI |CviRI* MslI Tsp45I BspMI || MboII TspEI MaeIII AarI |SpeI MaeI D D L K Q K K E E L V E I A Y H K C D E M I * S K R R K N * S K L H T I S V T N * F E A K E G R T S R N C I P * V * R I ----:----|----:----|----:----|----:----|----:----|----:----| S S K F C F F S S S T S I A Y W L H S S Q H N S A F S P L V L R F Q M G Y T H R I I Q L L L L F F * D F N C V M L T V F BssKI SexAI MboI EcoRII BclI | ScrFI | DpnI SetI | BseBI BsrDI | |BstKTI |TspEI HphI | |SetI CviRI* | AjuI \ \\ \\ \ \ \\ \ \ \ TTGATCACATTATTCAATAAAGGTGAATTAGAAACACAACCTGGTTGCAATGAAGAACAA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAGTGTAATAAGTTATTTCCACTTAATCTTTGTGTTGGACCAACGTTACTTCTTGTT /// / / / / / / / / / / ||| BclI SetI | HphI | | | | | AjuI ||| MboI TspEI | | | | BsrDI ||DpnI | | | CviRI* |BstKTI | | EcoRII TspEI | | SexAI | | BssKI | BseBI | ScrFI SetI L I T L F N K G E L E T Q P G C N E E Q * S H Y S I K V N * K H N L V A M K N K D H I I Q * R * I R N T T W L Q * R T N ----:----|----:----|----:----|----:----|----:----|----:----| N I V N N L L P S N S V C G P Q L S S C I S * M I * Y L H I L F V V Q N C H L V Q D C * E I F T F * F C L R T A I F F L MboII |TspDTI || AluI || CviJI || |DdeI || ||SetI CviJI AjuI Hpy188I MboII \\ \\\ \ \ \ \ ACATTGGAAGCTAAGATTGGTGGGCTTCTATCTAAAGTCAGAGAAGAAGTTGGTGATGTT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAACCTTCGATTCTAACCACCCGAAGATAGATTTCAGTCTCTTCTTCAACCACTACAA / / / / / / / / | | | DdeI | AjuI Hpy188I MboII | | CviJI CviJI | | AluI | SetI TspDTI MboII T L E A K I G G L L S K V R E E V G D V H W K L R L V G F Y L K S E K K L V M F I G S * D W W A S I * S Q R R S W * C L ----:----|----:----|----:----|----:----|----:----|----:----| V N S A L I P P S R D L T L S S T P S T F M P L * S Q H A E I * L * L L L Q H H C Q F S L N T P K * R F D S F F N T I N TspEI | TspDTI | | CviRI* | | | BsmI | | | |TsoI HphI | | | || MseI |MseI | | | || VspI |VspI TspEI | | | || |TspEI CviJI \\ \ \ \ \ \\ \\ \ TGTATTAATGAATTAGATAATTGGAATGCACCATTAATTATGGCTACTTGTGGTTCTAAA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| ACATAATTACTTAATCTATTAACCTTACGTGGTAATTAATACCGATGAACACCAAGATTT / / / // // / / / / | VspI TspEI |TspEI |TsoI | | CviJI SetI | MseI TspDTI CviRI* | TspEI HphI BsmI VspI MseI C I N E L D N W N A P L I M A T C G S K V L M N * I I G M H H * L W L L V V L K Y * * I R * L E C T I N Y G Y L W F * R ----:----|----:----|----:----|----:----|----:----|----:----| Q I L S N S L Q F A G N I I A V Q P E L K Y * H I L Y N S H V M L * P * K H N * T N I F * I I P I C W * N H S S T T R F HindII SetI Hpy166II NlaIV MseI BccI CviJI | TspEI \ \ \ \ \ \ GGTTCCACATTAAATGTTTCACAGATGGTGGCTGTCGTTGGTCAACAAATTATTTCTGGT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAGGTGTAATTTACAAAGTGTCTACCACCGACAGCAACCAGTTGTTTAATAAAGACCA / / / / / / NlaIV MseI BccI CviJI | TspEI Hpy166II HindII G S T L N V S Q M V A V V G Q Q I I S G V P H * M F H R W W L S L V N K L F L V F H I K C F T D G G C R W S T N Y F W * ----:----|----:----|----:----|----:----|----:----|----:----| P E V N F T E C I T A T T P * C I I E P L N W M L H K V S P P Q R Q D V F * K Q T G C * I N * L H H S D N T L L N N R T BccI | BetI* | BspMII* | |HpaII | |Hpy178III* | || BseGI | || | Hpy178III* | || | | MboI | || | | |FokI ApoI | || | | ||DpnI TspEI | || | | |||BstKTI EcoRI | || | | |||| MaeIII | TaqI | || | | |||| | AciI | AsuII \ \\ \ \ \\\\ \ \ \ \ AATCGTGTTCCGGATGGTTTTCAAGATCGTTCGTTACCGCATTTCCCCAAGAATTCGAAA 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGCACAAGGCCTACCAAAAGTTCTAGCAAGCAATGGCGTAAAGGGGTTCTTAAGCTTT / // / /// // / / / / | || BseGI ||| |FokI | AciI | AsuII | |BspMII* ||| MboI MaeIII | TaqI | |BetI* ||DpnI EcoRI | Hpy178III* |BstKTI TspEI | HpaII Hpy178III* ApoI BccI N R V P D G F Q D R S L P H F P K N S K I V F R M V F K I V R Y R I S P R I R K S C S G W F S R S F V T A F P Q E F E N ----:----|----:----|----:----|----:----|----:----|----:----| L R T G S P K * S R E N G C K G L F E F Y D H E P H N E L D N T V A N G W S N S I T N R I T K L I T R * R M E G L I R F FalI CviJI FalI ApoI | FalI ApoI | SetI TspEI | FalI TspEI \ \ \ \ \ \ ACACCCCAATCCAAAGGTTTTGTAAGAAATTCTTTCTTTTCAGGCTTATCTCCCCCAGAA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGGGGTTAGGTTTCCAAAACATTCTTTAAGAAAGAAAAGTCCGAATAGAGGGGGTCTT / / / / / | SetI TspEI | CviJI FalI ApoI FalI FalI FalI T P Q S K G F V R N S F F S G L S P P E H P N P K V L * E I L S F Q A Y L P Q N T P I Q R F C K K F F L F R L I S P R I ----:----|----:----|----:----|----:----|----:----|----:----| V G W D L P K T L F E K K E P K D G G S F V G I W L N Q L F N K R K L S I E G L C G L G F T K Y S I R E K * A * R G W F HindII Hpy166II | AluI | CviJI | PvuII FatI Hin4II* | NspBII* BsmAI |CviAII | Hpy178III* | | SetI |TsoI || NlaIII | | SetI | | | MseI |AciI \\ \ \ \ \ \ \ \ \ \\ TTTCTGTTCCATGCTATTTCGGGTCGTGAAGGTTTAGTTGACACAGCTGTTAAAACCGCA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGACAAGGTACGATAAAGCCCAGCACTTCCAAATCAACTGTGTCGACAATTTTGGCGT / / // / / / / / / / / // TspEI | |FatI | | SetI | | | | | |BsmAI ApoI | CviAII | Hpy178III* | | | | | AciI NlaIII Hin4II* | | | | TsoI | | | MseI | | NspBII* | | PvuII | | CviJI | | AluI | SetI Hpy166II HindII F L F H A I S G R E G L V D T A V K T A F C S M L F R V V K V * L T Q L L K P Q S V P C Y F G S * R F S * H S C * N R R ----:----|----:----|----:----|----:----|----:----|----:----| N R N W A I E P R S P K T S V A T L V A I E T G H * K P D H L N L Q C L Q * F R K Q E M S N R T T F T * N V C S N F G C AlwNI | MaeIII | | BsrI | | | FatI | | | AflIII | | | BspLU11I* | | | |CviAII MboI | | | || NspI BglII | | | || NlaIII XhoII | | | || | BsmAI |TspDTI | | | || | | MseI ||DpnI | | | || | | VspI |||BstKTI MboII \ \ \ \\ \ \ \ \\\\ \ GAGACTGGTTACATGTCTCGTAGATTAATGAAGTCTTTAGAAGATCTTTCTTGTCAGTAT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTGACCAATGTACAGAGCATCTAATTACTTCAGAAATCTTCTAGAAAGAACAGTCATA / / // // / / / // / / / AlwNI | || || | VspI | || | MboII Eco57MI | || || | MseI | || XhoII Eco57I | || || BsmAI | || BglII | || |BspLU11I* | || MboI | || |AflIII | |DpnI | || |FatI | BstKTI | || CviAII TspDTI | |MaeIII | NlaIII | NspI BsrI E T G Y M S R R L M K S L E D L S C Q Y R L V T C L V D * * S L * K I F L V S M D W L H V S * I N E V F R R S F L S V * ----:----|----:----|----:----|----:----|----:----|----:----| S V P * M D R L N I F D K S S R E Q * Y L S Q N C T E Y I L S T K L L D K K D T L S T V H R T S * H L R * F I K R T L I Eco57I Eco57MI TspEI | DrdI | MmeI MaeIII | | Tsp4CI* | | XcmI Tsp45I | | | Hpy188I CviJI Tsp4CI* | | | NdeI | BinI* \ \ \ \ \ \ \ \ \ \ \ \ GACAATACGGTCAGAACTTCAGCCAACGGTATCGTCCAATTCACATATGGTGGTGACGGG 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTATGCCAGTCTTGAAGTCGGTTGCCATAGCAGGTTAAGTGTATACCACCACTGCCC / / / / / / // / / / | | Hpy188I | Tsp4CI* | |XcmI NdeI | BinI* | Tsp4CI* CviJI | TspEI Tsp45I DrdI MmeI MaeIII D N T V R T S A N G I V Q F T Y G G D G T I R S E L Q P T V S S N S H M V V T G Q Y G Q N F S Q R Y R P I H I W W * R V ----:----|----:----|----:----|----:----|----:----|----:----| S L V T L V E A L P I T W N V Y P P S P H C Y P * F K L W R Y R G I * M H H H R V I R D S S * G V T D D L E C I T T V P MboI BamHI XhoII |HphI ||DpnI SetI ||NlaIV | CviRI* |||BstKTI | | AgeI AsuI* |||| Hpy178III* | | BetI* AvaII |||| |BinI* | | Cfr10I |NlaIV |||| || Hin4II* | | |HpaII |BmgT120I |||| || | MnlI | | || TspEI || FatI \\\\ \\ \ \ \ \ \\ \ \\ \ TTGGATCCTCTGGAAATGGAAGGTAATGCACAACCGGTCAATTTCAATAGAAGTTGGGAC 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTAGGAGACCTTTACCTTCCATTACGTGTTGGCCAGTTAAAGTTATCTTCAACCCTG /// / / / / / // / /// ||| | | | SetI CviRI* || TspEI ||NlaIII ||| | | MnlI |Cfr10I ||AvaII ||| | Hpy178III* |BetI* ||AsuI* ||| | Hin4II* |AgeI |BmgT120I ||| | BinI* HpaII NlaIV ||| XhoII ||| BamHI ||| MboI ||NlaIV ||DpnI |BstKTI HphI L D P L E M E G N A Q P V N F N R S W D W I L W K W K V M H N R S I S I E V G T G S S G N G R * C T T G Q F Q * K L G P ----:----|----:----|----:----|----:----|----:----|----:----| N S G R S I S P L A C G T L K L L L Q S T P D E P F P L Y H V V P * N * Y F N P Q I R Q F H F T I C L R D I E I S T P V CviAII | CviRI* | NlaIII | | EcoT22I BsiYI* | | | BslFI | CviJI CviRI* | | | | SspI MseI | | TsoI |TspEI \ \ \ \ \ \ \ \ \ \\ CATGCATACAATATTACTTTTAATAACCAAGATAAGGGCTTACTACCCTATGCAATTATG 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| GTACGTATGTTATAATGAAAATTATTGGTTCTATTCCCGAATGATGGGATACGTTAATAC /// / / / / / / / ||CviRI* | BslFI MseI BsiYI* CviJI | TspEI ||FatI SspI TsoI CviRI* |CviAII EcoT22I H A Y N I T F N N Q D K G L L P Y A I M M H T I L L L I T K I R A Y Y P M Q L W C I Q Y Y F * * P R * G L T T L C N Y G ----:----|----:----|----:----|----:----|----:----|----:----| W A Y L I V K L L W S L P K S G * A I I G H M C Y * K * Y G L Y P S V V R H L * M C V I N S K I V L I L A * * G I C N H BsaXI AsuI* AvaII Hpy188I |BmgT120I | BsaXI CviRI* SspI ||MnlI SetI | |TstI \ \ \\\ \ \ \\ GAAACTGCAAACGAAATATTAGGACCATTGGAGGAAAGGTTGGTCAGATATGATAATAGT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGACGTTTGCTTTATAATCCTGGTAACCTCCTTTCCAACCAGTCTATACTATTATCA / / / /// / / // CviRI* | | ||AvaII SetI | |BsaXI | | ||AsuI* | TstI | | |BmgT120I Hpy188I | | MnlI | BsaXI SspI E T A N E I L G P L E E R L V R Y D N S K L Q T K Y * D H W R K G W S D M I I V N C K R N I R T I G G K V G Q I * * * W ----:----|----:----|----:----|----:----|----:----|----:----| S V A F S I N P G N S S L N T L Y S L L P F Q L R F I L V M P P F T P * I H Y Y F S C V F Y * S W Q L F P Q D S I I I T MboI TstI SfaNI |BbvII* | DpnI || MboII | |BstKTI BseGI FokI || | AciI | || BinI* \ \ \\ \ \ \ \\ \ GGATGTTTAGTGAAAAGGGAAGACTTGAATAAAGCGGAATATGTGGATCAGTATGATGCC 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| CCTACAAATCACTTTTCCCTTCTGAACTTATTTCGCCTTATACACCTAGTCATACTACGG / / / / / // / / BseGI | TstI | AciI || | BinI* FokI BbvII* || SfaNI MboII || MboI |DpnI BstKTI G C L V K R E D L N K A E Y V D Q Y D A D V * * K G K T * I K R N M W I S M M P M F S E K G R L E * S G I C G S V * C R ----:----|----:----|----:----|----:----|----:----|----:----| P H K T F L S S K F L A S Y T S * Y S A H I N L S F P L S S Y L P I H P D T H H S T * H F P F V Q I F R F I H I L I I G SmlI AflII |MseI MseI CviJI || NmeAIII VspI TsoI | TspEI \\ \ \ \ \ \ GAGAGAGATTTTTACCATTCCTTAAGAGAATATATTAATGGCAAAGCAACTGCTTTGGCT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTCTCTAAAAATGGTAAGGAATTCTCTTATATAATTACCGTTTCGTTGACGAAACCGA / // / / / | |AflII VspI TsoI CviJI | |SmlI MseI | MseI NmeAIII E R D F Y H S L R E Y I N G K A T A L A R E I F T I P * E N I L M A K Q L L W L E R F L P F L K R I Y * W Q S N C F G * ----:----|----:----|----:----|----:----|----:----|----:----| S L S K * W E K L S Y I L P L A V A K A R S L N K G N R L L I Y * H C L L Q K P L S I K V M G * S F I N I A F C S S Q S BssKI EcoRII SetI |SecI* StuI | CviRI* ||ScrFI CviJI | | MnlI MseI ||BseBI HaeIII | | | TspEI \ \\\ \ \ \ \ \ AATTTAAGAAAGTCCAGGGGAATGTTAGGCCTATTAGAACCTCCTGCAAAAGAATTACAA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAATTCTTTCAGGTCCCCTTACAATCCGGATAATCTTGGAGGACGTTTTCTTAATGTT / / / / / / / / / / | MseI | EcoRII HaeIII SetI | MnlI | SetI TspEI | BssKI CviJI CviRI* TspEI | SecI* StuI BseBI ScrFI N L R K S R G M L G L L E P P A K E L Q I * E S P G E C * A Y * N L L Q K N Y K F K K V Q G N V R P I R T S C K R I T R ----:----|----:----|----:----|----:----|----:----|----:----| L K L F D L P I N P R N S G G A F S N C * N L F T W P F T L G I L V E Q L L I V I * S L G P S H * A * * F R R C F F * L BinI* | SetI | | MboI | | | DpnI | | | |BstKTI | | | ||Hpy178III* | | | ||| XmnI | | | ||| |Tsp4CI* | | | ||| || Hpy178III* | | | ||| || | TspDTI | | | ||| || | | MseI CviJI \ \ \ \\\ \\ \ \ \ \ GGTATTGATCCAGATGAAACCGTTCCTGATAATGTTAAAACATCTGTAAGCCAACTTTAT 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAACTAGGTCTACTTTGGCAAGGACTATTACAATTTTGTAGACATTCGGTTGAAATA / // / / / / / / | || | | | | MseI CviJI | || | | | Hpy178III* | || | | | TspDTI | || | | Tsp4CI* | || | | XmnI | || | Hpy178III* | || MboI | |DpnI | BstKTI BinI* G I D P D E T V P D N V K T S V S Q L Y V L I Q M K P F L I M L K H L * A N F I Y * S R * N R S * * C * N I C K P T L * ----:----|----:----|----:----|----:----|----:----|----:----| P I S G S S V T G S L T L V D T L W S * L Y Q D L H F R E Q Y H * F M Q L G V K T N I W I F G N R I I N F C R Y A L K I TfiI HinfI TspRI HphI TspEI \ \ \ \ AGAATCAGTGAAAAATCGGTGAGAAAGTTTTTAGAAATTGCTCTTTTCAAATATCGTAAG 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTAGTCACTTTTTAGCCACTCTTTCAAAAATCTTTAACGAGAAAAGTTTATAGCATTC / / / / | HinfI HphI TspEI | TfiI TspRI R I S E K S V R K F L E I A L F K Y R K E S V K N R * E S F * K L L F S N I V R N Q * K I G E K V F R N C S F Q I S * G ----:----|----:----|----:----|----:----|----:----|----:----| L I L S F D T L F N K S I A R K L Y R L Y F * H F I P S F T K L F Q E K * I D Y S D T F F R H S L K * F N S K E F I T L BsrI NlaIV |BssKI |CviJI |EcoRII || ScrFI Hpy166II || BseBI | BssKI || | Csp6I | SexAI || | |RsaI MwoI | EcoRII || | |SetI GsuI SduI | | ScrFI || | ||AlwNI Eco57MI MwoI HgiAI* | | BseBI \\ \ \\\ \ \ \ \ \ \ GCAAGACTGGAGCCAGGTACTGCTATTGGTGCTATTGGTGCTCAATCCATTGGTGAACCA 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTCTGACCTCGGTCCATGACGATAACCACGATAACCACGAGTTAGGTAACCACTTGGT / // ////// // / / / // | || |||||Csp6I |Eco57MI | HgiAI* | |BseBI | || ||||RsaI |GsuI | SduI | |ScrFI | || |||EcoRII MwoI MwoI | SetI | || |||BssKI Hpy166II | || ||AlwNI | || |BseBI | || |ScrFI | || SetI | |CviJI | NlaIV BsrI A R L E P G T A I G A I G A Q S I G E P Q D W S Q V L L L V L L V L N P L V N Q K T G A R Y C Y W C Y W C S I H W * T R ----:----|----:----|----:----|----:----|----:----|----:----| A L S S G P V A I P A I P A * D M P S G P L V P A L Y Q * Q H * Q H E I W Q H V C S Q L W T S S N T S N T S L G N T F W AarI SetI BspMI BbvII* | MboII | | CviRI* | | | SetI | | | |MwoI Csp6I | | | || CviJI |RsaI | | | || | FatI |SetI | | | || | |CviAII ||HphI | | | || | || NlaIII ||Hpy166II TspDTI | | | || | || | MaeIII \\\ \ \ \ \ \\ \ \\ \ \ GGTACACAAATGACATTGAAGACCTTTCATTTTGCAGGTGTGGCTTCCATGAATGTTACA 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGTGTTTACTGTAACTTCTGGAAAGTAAAACGTCCACACCGAAGGTACTTACAATGT /// / / / // / / / // / ||Hpy166II TspDTI SetI | || MwoI | | |FatI MaeIII ||Csp6I | |SetI | | CviAII |HphI | CviRI* | NlaIII |RsaI BbvII* CviJI EcoRII MboII SexAI BspMI BssKI AarI G T Q M T L K T F H F A G V A S M N V T V H K * H * R P F I L Q V W L P * M L H Y T N D I E D L S F C R C G F H E C Y I ----:----|----:----|----:----|----:----|----:----|----:----| P V C I V N F V K * K A P T A E M F T V L Y V F S M S S R E N Q L H P K W S H * T C L H C Q L G K M K C T H S G H I N C TspDTI MnlI StyI | SetI | TspEI SecI* SetI SetI \ \ \ \ \ \ \ TTAGGTGTTCCTCGTATCAAAGAAATTATCAATGCTTCCAAGGTCATTTCTACACCTATT 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| AATCCACAAGGAGCATAGTTTCTTTAATAGTTACGAAGGTTCCAGTAAAGATGTGGATAA / / / / / / TspDTI MnlI TspEI | SecI* SetI SetI | StyI SetI L G V P R I K E I I N A S K V I S T P I * V F L V S K K L S M L P R S F L H L L R C S S Y Q R N Y Q C F Q G H F Y T Y Y ----:----|----:----|----:----|----:----|----:----|----:----| N P T G R I L S I I L A E L T M E V G I M L H E E Y * L F * * H K W P * K * V * * T N R T D F F N D I S G L D N R C R N TseI CviJI |BisI ||BlsI ||| MaeI ||| | TspDTI PsiI BbvI ||| | | MseI SetI \ \ \\\ \ \ \ \ ATAAATGCTGTATTAGTAAATGATAACGATGAAAGGGCTGCTAGGGTTGTTAAAGGTAGA 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTACGACATAATCATTTACTATTGCTACTTTCCCGACGATCCCAACAATTTCCATCT / / //// // // PsiI BbvI |||| |MaeI |SetI |||| TspDTI MseI |||TseI ||BisI |BlsI CviJI I N A V L V N D N D E R A A R V V K G R * M L Y * * M I T M K G L L G L L K V E K C C I S K * * R * K G C * G C * R * S ----:----|----:----|----:----|----:----|----:----|----:----| I F A T N T F S L S S L A A L T T L P L * L H Q I L L H Y R H F P Q * P Q * L Y Y I S Y * Y I I V I F P S S P N N F T S TspRI | Hpy188I | | MaeII | | | SetI | | | TaiI | | | | AluI Hin4I | | | | CviJI Hin4I TspDTI BtsI | | | | | SetI | Hpy166II | Eam1105I \ \ \ \ \ \ \ \ \ \ \ GTGGAAAAGACACTGCTATCTGACGTAGCTTTCTATGTCCAAGATGTTTACAAAGACAAC 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTTTTCTGTGACGATAGACTGCATCGAAAGATACAGGTTCTACAAATGTTTCTGTTG / / / // / / / / / TspRI | | || CviJI Hin4I | | Eam1105I BtsI | | || AluI Hin4I | TspDTI | | |SetI Hpy166II | | MaeII | TaiI | SetI Hpy188I V E K T L L S D V A F Y V Q D V Y K D N W K R H C Y L T * L S M S K M F T K T T G K D T A I * R S F L C P R C L Q R Q L ----:----|----:----|----:----|----:----|----:----|----:----| T S F V S S D S T A K * T W S T * L S L L P F S V A I Q R L K R H G L H K C L C H F L C Q * R V Y S E I D L I N V F V V Csp6I Hin4I |RsaI MfeI HindII MslI Hin4I |SetI TspEI Hpy166II \ \ \\ \ \ TTGTCTTTCATTCAAGTGCGTATTGATTTAGGTACGATTGATAAACTACAATTGGAGTTG 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| AACAGAAAGTAAGTTCACGCATAACTAAATCCATGCTAACTATTTGATGTTAACCTCAAC / / // / / Hin4I | |Csp6I TspEI Hpy166II Hin4I | RsaI MfeI HindII MslI SetI L S F I Q V R I D L G T I D K L Q L E L C L S F K C V L I * V R L I N Y N W S * V F H S S A Y * F R Y D * * T T I G V D ----:----|----:----|----:----|----:----|----:----|----:----| K D K M * T R I S K P V I S L S C N S N S T K * E L A Y Q N L Y S Q Y V V I P T Q R E N L H T N I * T R N I F * L Q L Q BssKI EcoRII EcoRV |SecI* | AciI ||ScrFI | FnuDII* ||BseBI TspEI CviJI | | MboII ||| CviJI | TsoI | Hpy188I \ \ \ \\\ \ \ \ \ \ ACCATAGAAGATATCGCGGTTGCTATAACCAGGGCTTCTAAATTGAAAATACAAGCCTCT 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTATCTTCTATAGCGCCAACGATATTGGTCCCGAAGATTTAACTTTTATGTTCGGAGA / / / / // / / / / | | MboII | |CviJI | TspEI | Hpy188I | | AciI | EcoRII TsoI CviJI | FnuDII* | BssKI EcoRV | SecI* BseBI ScrFI T I E D I A V A I T R A S K L K I Q A S P * K I S R L L * P G L L N * K Y K P L H R R Y R G C Y N Q G F * I E N T S L * ----:----|----:----|----:----|----:----|----:----|----:----| V M S S I A T A I V L A E L N F I C A E S W L L Y R P Q * L W P K * I S F V L R G Y F I D R N S Y G P S R F Q F Y L G R MboI | DpnI | |TaqI MaeII | |BstKTI | SetI MnlI | || TspEI | TaiI Csp6I | SspI | || | CviRI* | | Hin4II* |RsaI \ \ \ \\ \ \ \ \ \ \\ GATGTCAATATTATTGGTAAAGATCGAATTGCAATCAACGTATTCCCAGAAGGGTACAAA 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| CTACAGTTATAATAACCATTTCTAGCTTAACGTTAGTTGCATAAGGGTCTTCCCATGTTT / / // // // / / / // | SspI || || || | | Hin4II* |Csp6I MnlI || || || | MaeII RsaI || || || TaiI || || || SetI || || |CviRI* || || TspEI || |TaqI || MboI |DpnI BstKTI D V N I I G K D R I A I N V F P E G Y K M S I L L V K I E L Q S T Y S Q K G T K C Q Y Y W * R S N C N Q R I P R R V Q S ----:----|----:----|----:----|----:----|----:----|----:----| S T L I I P L S R I A I L T N G S P Y L Q H * Y * Q Y L D F Q L * R I G L L T C I D I N N T F I S N C D V Y E W F P V F TaqI ClaI | EcoRV CviRI* \ \ \ GCAAAATCGATATCTACATCTGCGAAAGAACCAAGTGAGAATGATGTTTTTTACCGAATG 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTTAGCTATAGATGTAGACGCTTTCTTGGTTCACTCTTACTACAAAAAATGGCTTAC / / / | EcoRV CviRI* ClaI BsmI TaqI A K S I S T S A K E P S E N D V F Y R M Q N R Y L H L R K N Q V R M M F F T E C K I D I Y I C E R T K * E * C F L P N A ----:----|----:----|----:----|----:----|----:----|----:----| A F D I D V D A F S G L S F S T K * R I L L I S I * M Q S L V L H S H H K K G F C F R Y R C R R F F W T L I I N K V S H BsmI | MaeIII | Tsp4CI* | | MaeII | | | SetI | | | TaiI | | | | Hpy99I | | | | | Hin6I | | | | | |GlaI SetI | | | | | ||HhaI |Hpy166II | | | | | ||| Hpy178III* MseI || SetI BsiI* \ \ \ \ \ \\\ \ \ \\ \ \ CAACAGTTACGTCGTGCGCTTCCTGATGTTGTTGTTAAAGGTTTACCTGATATTTCTCGT 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTCAATGCAGCACGCGAAGGACTACAACAACAATTTCCAAATGGACTATAAAGAGCA / //// /// / // // / | |||| ||Hin6I Hpy178III* |SetI |SetI BsiI* | |||| |GlaI MseI Hpy166II | |||| HhaI | |||MaeII | ||MaeIII | |Hpy99I | TaiI | SetI Tsp4CI* Q Q L R R A L P D V V V K G L P D I S R N S Y V V R F L M L L L K V Y L I F L V T V T S C A S * C C C * R F T * Y F S C ----:----|----:----|----:----|----:----|----:----|----:----| C C N R R A S G S T T T L P K G S I E R A V T V D H A E Q H Q Q * L N V Q Y K E L L * T T R K R I N N N F T * R I N R T MseI VspI | SspI | | Hpy178III* | | |NruI BtgZI | | |FnuDII* | TspEI CviJI | | || MnlI | | BceAI MaeIII HaeIII AciI | | || MwoI | | |Hin4II* | SetI | Cac8I \ \ \ \\ \ \ \ \\ \ \ \ \ GCGGTTATTAATATTCGCGATGACGGCAAGAGGGAATTATTGGTTGAAGGTTACGGCCTG 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| CGCCAATAATTATAAGCGCTACTGCCGTTCTCCCTTAATAACCAACTTCCAATGCCGGAC / / / // / / / // / / / / / AciI | SspI || | MnlI | || BceAI SetI | | Cac8I VspI || MwoI | |Hin4II* | HaeIII MseI |Hpy178III* | TspEI | CviJI FnuDII* BtgZI MaeIII NruI A V I N I R D D G K R E L L V E G Y G L R L L I F A M T A R G N Y W L K V T A C G Y * Y S R * R Q E G I I G * R L R P A ----:----|----:----|----:----|----:----|----:----|----:----| A T I L I R S S P L L S N N T S P * P R H P * * Y E R H R C S P I I P Q L N R G R N N I N A I V A L P F * Q N F T V A Q BceAI | BccI | TatI | Bsp1407I FatI | |Csp6I XbaI |CviAII | |Hpy166II |MaeI || NlaIII | ||RsaI |Hpy178III* || | TspGWI \ \\\ \\ \\ \ \ CGAGATGTGATGTGTACAGATGGTGTCATTGGTTCTAGAACTACAACTAACCATGTTTTA 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| GCTCTACACTACACATGTCTACCACAGTAACCAAGATCTTGATGTTGATTGGTACAAAAT / //// // / // / | |||Bsp1407I |XbaI | || TspGWI | |||TatI Hpy178III* | |FatI | ||Csp6I MaeI | CviAII | |RsaI NlaIII | Hpy166II | BccI BceAI R D V M C T D G V I G S R T T T N H V L E M * C V Q M V S L V L E L Q L T M F * R C D V Y R W C H W F * N Y N * P C F R ----:----|----:----|----:----|----:----|----:----|----:----| R S T I H V S P T M P E L V V V L W T K A L H S T Y L H H * Q N * F * L * G H K S I H H T C I T D N T R S S C S V M N * TseI AluI CviJI |BisI ||BlsI ||SetI TspEI TsoI BbvI TaqI |||CviRI* | MseI \ \ \ \\\\ \ \ GAAGTCTTTTCCGTTTTGGGTATCGAAGCTGCAAGATATAGCATTATTAGAGAAATTAAC 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCAGAAAAGGCAAAACCCATAGCTTCGACGTTCTATATCGTAATAATCTCTTTAATTG / / // //// // TsoI BbvI || |||CviRI* |MseI || |||TseI TspEI || ||BisI || |BlsI || CviJI || AluI |SetI TaqI E V F S V L G I E A A R Y S I I R E I N K S F P F W V S K L Q D I A L L E K L T S L F R F G Y R S C K I * H Y * R N * L ----:----|----:----|----:----|----:----|----:----|----:----| S T K E T K P I S A A L Y L M I L S I L L L R K R K P Y R L Q L I Y C * * L F * F D K G N Q T D F S C S I A N N S F N V FatI |CviAII || NlaIII || | Hin4I || | | Tsp4CI* || | | | BinI* || | | | |TstI || | | | || TaqI || | | | || |MboI || | | | || || DpnI || | | | || || |BstKTI || | | | || || || MaeII || | | | || || || |BtrI || | | | || || || || SetI SetI || | | | || || || || TaiI Hin4I |TstI \\ \ \ \ \\ \\ \\ \\ \ \ \\ TATACCATGAGTAATCACGGTATGAGTGTCGATCCACGTCATATCCAACTATTAGGTGAT 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| ATATGGTACTCATTAGTGCCATACTCACAGCTAGGTGCAGTATAGGTTGATAATCCACTA / /// / / / // // // / / | ||Hin4I | TstI | || || || Hin4I TstI | |FatI Tsp4CI* | || || |MaeII SetI | CviAII | || || BtrI NlaIII | || |TaiI | || |SetI | || MboI | |DpnI | BstKTI | TaqI BinI* Y T M S N H G M S V D P R H I Q L L G D I P * V I T V * V S I H V I S N Y * V M Y H E * S R Y E C R S T S Y P T I R * C ----:----|----:----|----:----|----:----|----:----|----:----| * V M L L * P I L T S G R * I W S N P S S Y W S Y D R Y S H R D V D Y G V I L H I G H T I V T H T D I W T M D L * * T I HphI MlyI | MmeI HphI MnlI PleI \ \ \ \ \ GTGATGACATATAAGGGTGAAGTGTTGGGTATTACAAGATTTGGTTTGAGTAAAATGAGG 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| CACTACTGTATATTCCCACTTCACAACCCATAATGTTCTAAACCAAACTCATTTTACTCC // / / // |MmeI HphI MnlI |PleI HphI MlyI V M T Y K G E V L G I T R F G L S K M R * * H I R V K C W V L Q D L V * V K * G D D I * G * S V G Y Y K I W F E * N E G ----:----|----:----|----:----|----:----|----:----|----:----| T I V Y L P S T N P I V L N P K L L I L H S S M Y P H L T P Y * L I Q N S Y F S H H C I L T F H Q T N C S K T Q T F H P TseI CviRI* |BisI |BslFI ||BlsI |||NheI |||AluI |||CviJI ||||MaeI |||||SetI |||||Cac8I |||||| BmtI |||||| CviJI AciI |||||| | BbvI |BisI |||||| | | TaqI ||BlsI |||||| | | AsuII |||TauI |||||| | | | MnlI |||CviJI HinfI |||||| | | | | Hin4II* SfaNI TaqI |||HaeIII \ \\\\\\ \ \ \ \ \ \ \ \\\\ GACTCTGTTTTGCAGCTAGCCTCCTTCGAAAAGACAACTGACCATTTATTCGATGCGGCC 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAGACAAAACGTCGATCGGAGGAAGCTTTTCTGTTGACTGGTAAATAAGCTACGCCGG / //// /// // / / / //// HinfI |||| ||CviJI || Hin4II* SfaNI | |||HaeIII |||| ||NheI |MnlI | |||CviJI |||| |MaeI AsuII | ||BisI |||| BslFI BbvI | ||AciI |||| Cac8I TaqI | |BlsI |||CviJI | TauI |||TseI TaqI |||AluI |||BmtI ||BisI |BlsI |SetI CviRI* D S V L Q L A S F E K T T D H L F D A A T L F C S * P P S K R Q L T I Y S M R P L C F A A S L L R K D N * P F I R C G L ----:----|----:----|----:----|----:----|----:----|----:----| S E T K C S A E K S F V V S W K N S A A P S Q K A A L R R R F S L Q G N I R H P V R N Q L * G G E F L C S V M * E I R G Hin4II* | TspDTI | | HgaI SetI Hpy188I \ \ \ \ \ TTTTATATGAAAAAGGACGCTGTTGAAGGTGTTTCTGAATGTATTATTTTGGGTCAAACG 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| AAAATATACTTTTTCCTGCGACAACTTCCACAAAGACTTACATAATAAAACCCAGTTTGC / / / / / | | | HgaI Hpy188I | | SetI | TspDTI Hin4II* F Y M K K D A V E G V S E C I I L G Q T F I * K R T L L K V F L N V L F W V K R L Y E K G R C * R C F * M Y Y F G S N D ----:----|----:----|----:----|----:----|----:----|----:----| K * I F F S A T S P T E S H I I K P * V R K Y S F P R Q Q L H K Q I Y * K P D F K I H F L V S N F T N R F T N N Q T L R TaqI BsaBI |MboI || DpnI || |PvuI || |McrI* || |BstKTI || || Acc65I || || HgiCI* || || |Csp6I || || ||RsaI || || ||NlaIV || || |||AgeI || || |||BetI* || || |||Cfr10I || || ||||KpnI Hpy188I || || ||||HpaII | MboI || || ||||| NlaIV Csp6I | XhoII || || ||||| | MseI |RsaI | | DpnI || || ||||| | |AhaIII* MseI |SetI | | |BstKTI \\ \\ \\\\\ \ \\ \ \\ \ \ \\ ATGTCGATCGGTACCGGTTCCTTTAAAGTTGTTAAAGGTACTAATATATCTGAAAAGGAT 4270 4280 4290 4300 4310 4320 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGCTAGCCATGGCCAAGGAAATTTCAACAATTTCCATGATTATATAGACTTTTCCTA / // // /// /// // // // / // | || || ||| ||NlaIV |MseI || |Csp6I Hpy188I |DpnI | || || ||| |Cfr10I AhaIII* || RsaI BstKTI | || || ||| |BetI* |SetI | || || ||| |AgeI MseI | || || ||| HpaII | || || ||HgiCI* | || || ||Acc65I | || || |Csp6I | || || NlaIV | || || RsaI | || |KpnI | || MboI | |DpnI | BstKTI | McrI* | TaqI | PvuI BsaBI M S I G T G S F K V V K G T N I S E K D C R S V P V P L K L L K V L I Y L K R I V D R Y R F L * S C * R Y * Y I * K G S ----:----|----:----|----:----|----:----|----:----|----:----| I D I P V P E K L T T L P V L I D S F S S T S R Y R N R * L Q * L Y * Y I Q F P H R D T G T G K F N N F T S I Y R F L I TseI |BisI ||BlsI |||AluI |||CviJI |||| SetI NlaIV |||| |MseI BinI* |||| ||AhaIII* | DdeI MnlI |||| ||| MwoI | Bpu10I BtgZI |BsmAI |||| ||| | BbvI \ \ \ \\ \\\\ \\\ \ \ CTGGTTCCTAAGCGATGTCTATTTGAAAGTCTCTCAAATGAGGCAGCTTTAAAAGCGAAC 4330 4340 4350 4360 4370 4380 ----:----|----:----|----:----|----:----|----:----|----:----| GACCAAGGATTCGCTACAGATAAACTTTCAGAGAGTTTACTCCGTCGAAATTTTCGCTTG / // / // / /// /// / | || Bpu10I |MnlI BsmAI ||| ||MseI BbvI | || DdeI BtgZI ||| |AhaIII* | |BinI* ||| MwoI | NlaIV ||CviJI XhoII ||TseI MboI ||AluI |BisI BlsI SetI L V P K R C L F E S L S N E A A L K A N W F L S D V Y L K V S Q M R Q L * K R T G S * A M S I * K S L K * G S F K S E L ----:----|----:----|----:----|----:----|----:----|----:----| R T G L R H R N S L R E F S A A K F A F D P E * A I D I Q F D R L H P L K L L S Q N R L S T * K F T E * I L C S * F R V TAA --- ATT * X X --- * S L # Enzymes that cut Frequency Isoschizomers AarI 2 Acc65I 1 Asp718I AccI 2 FblI,XmiI AciI 14 BspACI,SsiI AclI 1 Psp1406I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 1 AgeI 3 AsiGI,BshTI,CspAI,PinAI AhaIII* 4 DraI AjuI 3 AlfI 2 AluI 10 AluBI AlwNI 2 CaiI ApoI 7 AcsI,XapI AsuI* 8 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 7 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 1 BarI 1 BbvI 7 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 9 Bce83I* 1 BpuEI BceAI 4 BcgI 1 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BetI* 6 BsaWI BfiI 2 BmrI,BmuI BglII 2 BinI* 6 AlwI,BspPI,AclWI BisI 13 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 13 BmgT120I 8 BmtI 1 BspOI Bpu10I 1 BsaBI 2 Bse8I,BseJI BsaXI 1 BseBI 8 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 2 BsgI 1 BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 7 Bsc4I,BseLI,BslI,AfiI BslFI 4 BsmFI,FaqI BsmAI 5 Alw26I,BstMAI BsmI 3 BsaMI,Mva1269I,PctI Bsp1407I 2 BsrGI,BstAUI BspCNI 2 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 2 BfuAI,Acc36I,BveI BspMII* 2 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 1 AccBSI,MbiI BsrDI 2 BseMI,Bse3DI BsrI 6 BseNI,Bse1I,BsrSI BssKI 8 BstSCI,StyD4I BstKTI 15 BtgZI 3 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 2 BstC8I Cfr10I 4 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 9 CviQI,RsaNI CviAII 11 CviJI 40 CviKI-1 CviRI* 27 HpyCH4V DdeI 10 BstDEI,HpyF3I DpnI 15 MalI DrdI 1 AasI,DseDI Eam1105I 2 AspEI,BmeRI,DriI,AhdI EciI 1 Eco47III 2 Aor51HI,AfeI Eco57I 2 AcuI Eco57MI 5 EcoNI 1 BstENI,XagI EcoP15I 2 EcoRI 1 EcoRII 8 AjnI,Psp6I,PspGI EcoRV 2 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 4 FatI 11 FauI 1 SmuI FnuDII* 4 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 5 GlaI 3 GsuI 3 BpmI HaeII 2 BstH2I HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 4 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 3 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 10 HpyAV Hin6I 3 HinP1I,HspAI HindII 4 HincII HindIII 1 HinfI 7 HpaII 7 HapII,BsiSI,MspI HphI 14 AsuHPI Hpy166II 14 Hpy8I Hpy178III* 19 Hpy188III Hpy188I 11 Hpy99I 5 KpnI 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 7 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 13 MboI 15 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 18 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 3 SchI MmeI 2 MnlI 19 MseI 36 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 12 HpyF10VI,BstMWI NdeI 2 FauNDI NheI 1 AsuNHI NlaIII 11 Hin1II,Hsp92II,FaeI NlaIV 9 BspLI,BmiI,PspN4I NmeAIII 1 NruI 1 BtuMI,Bsp68I NspBII* 2 MspA1I NspI 2 BstNSI,XceI PleI 3 PpsI PsiI 2 AanI PsrI 1 PstI 1 PvuI 1 MvrI,Ple19I,BpvUI PvuII 1 RsaI 9 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 8 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 5 BseDI,BssECI,BsaJI SetI 62 SexAI 3 MabI SfaNI 8 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 2 SmoI SpeI 1 BcuI,AhlI SspI 4 StuI 2 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 7 TaqI 15 TaqII 3 TatI 2 TauI 6 TfiI 4 PfeI TseI 7 ApeKI TsoI 7 Tsp45I 7 NmuCI Tsp4CI* 16 HpyCH4III,TaaI,Bst4CI TspDTI 20 TspEI 40 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 3 TscAI TstI 2 Tth111I 2 PflFI,PsyI,AspI VspI 7 PshBI,AseI XbaI 1 XcmI 1 XhoII 4 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI AcyI AloI ApaI ApaLI AscI AvaI AvrII BaeI BbvCI BdaI BglI BmeT110I BplI BsaAI BsePI BseRI BseSI BseYI Bsp120I BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I CauII* Cfr9I CspCI DinI DraII DraIII DsaI* Ecl136II Eco31I EcoICRI EgeI EheI Esp3I EspI* FseI FspAI GsaI HgiJII* HpaI KasI MauBI MluI MroNI MstI* NaeI NarI NcoI NgoMIV NotI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI RsrII SacI SacII SalI SanDI SapI ScaI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I TspMI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769