Restriction Map of RKI1/YOR095C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RKI1/YOR095C on chromosome XV from coordinates 504328 to 503552.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.12906

EMBOSS_001 TseI CviJI |BisI ||BlsI |||Cfr10I SfaNI TfiI MnlI ||||HpaII | TspEI HinfI SfaNI BbvI \\\\\ \ \ \ \ \ ATGGCTGCCGGTGTCCCAAAAATTGATGCGTTAGAATCTTTGGGCAATCCTTTGGAGGAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGACGGCCACAGGGTTTTTAACTACGCAATCTTAGAAACCCGTTAGGAAACCTCCTA //// // / / / / / |||| |Cfr10I | TspEI HinfI MnlI SfaNI |||| HpaII SfaNI TfiI |||TseI ||BisI |BlsI CviJI M A A G V P K I D A L E S L G N P L E D W L P V S Q K L M R * N L W A I L W R M G C R C P K N * C V R I F G Q S F G G C ----:----|----:----|----:----|----:----|----:----|----:----| X A A P T G F I S A N S D K P L G K S S X P Q R H G L F Q H T L I K P C D K P P H S G T D W F N I R * F R Q A I R Q L I BseGI | MwoI | | TseI | | AluI ApoI | | FokI TspEI | | CviJI | MseI | | |BisI | |AhaIII* | | |SfeI* | || ApoI | | ||BlsI | || TspEI | | ||SetI | || | TspDTI | | |||TseI | || | | MboI | | |||CviRI* | || | | BclI | | ||||BisI | || | | | DpnI | | |||||BlsI MwoI | || | | | |BstKTI | | |||||PstI | BbvI | || | | | || TspEI \ \ \\\\\\ \ \ \ \\ \ \ \ \\ \ GCCAAGAGAGCTGCAGCATACAGAGCAGTTGATGAAAATTTAAAATTTGATGATCACAAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTCTCTCGACGTCGTATGTCTCGTCAACTACTTTTAAATTTTAAACTACTAGTGTTT / / / /////// / / /// / / // / | | | ||||||| MwoI BbvI ||| | | || BclI | | | ||||||TseI ||| | | || MboI | | | |||||SfeI* ||| | | |DpnI | | | |||||BisI ||| | | BstKTI | | | ||||FokI ||| | TspEI | | | ||||BlsI ||| | ApoI | | | |||CviRI* ||| TspDTI | | | |||TseI ||MseI | | | ||BisI |AhaIII* | | | |BlsI TspEI | | | |PstI ApoI | | | CviJI | | | AluI | | SetI | MwoI BseGI BbvI A K R A A A Y R A V D E N L K F D D H K P R E L Q H T E Q L M K I * N L M I T K Q E S C S I Q S S * * K F K I * * S Q N ----:----|----:----|----:----|----:----|----:----|----:----| A L L A A A Y L A T S S F K F N S S * L H W S L Q L M C L L Q H F N L I Q H D C G L S S C C V S C N I F I * F K I I V F Tsp4CI* TspEI | TspRI TspEI SspI \ \ \ \ \ ATTATTGGAATTGGTAGTGGTAGCACAGTGGTTTATGTTGCCGAAAGAATTGGACAATAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TAATAACCTTAACCATCACCATCGTGTCACCAAATACAACGGCTTTCTTAACCTGTTATA / / / / / / TspEI TspEI | Tsp4CI* TspEI SspI TspRI I I G I G S G S T V V Y V A E R I G Q Y L L E L V V V A Q W F M L P K E L D N I Y W N W * W * H S G L C C R K N W T I F ----:----|----:----|----:----|----:----|----:----|----:----| I I P I P L P L V T T * T A S L I P C Y F * Q F Q Y H Y C L P K H Q R F F Q V I N N S N T T T A C H N I N G F S N S L I FatI CviRI* |CviAII || NlaIII || | ApoI ApoI TfiI || | TspEI TspEI BsmI HinfI || | | HgaI TspDTI |TspDTI CviRI* | BsaBI \\ \ \ \ \ \\ \ \ \ TTGCATGACCCTAAATTTTATGAAGTAGCGTCTAAATTCATTTGCATTCCAACAGGATTC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTACTGGGATTTAAAATACTTCATCGCAGATTTAAGTAAACGTAAGGTTGTCCTAAG / // / / / / / / / // | |FatI | | TspDTI | | | CviRI* |BsaBI | CviAII | HgaI | | BsmI HinfI CviRI* TspEI | TspEI TfiI NlaIII ApoI | ApoI TspDTI L H D P K F Y E V A S K F I C I P T G F C M T L N F M K * R L N S F A F Q Q D S A * P * I L * S S V * I H L H S N R I P ----:----|----:----|----:----|----:----|----:----|----:----| K C S G L N * S T A D L N M Q M G V P N N A H G * I K H L L T * I * K C E L L I Q M V R F K I F Y R R F E N A N W C S E Hpy178III* CviRI* CviJI | MmeI |TspEI |NlaIV Tsp4CI* \ \ \\ \\ \ CAATCAAGAAACTTGATTTTGGATAACAAGTTGCAATTAGGCTCCATTGAACAGTATCCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAGTTCTTTGAACTAAAACCTATTGTTCAACGTTAATCCGAGGTAACTTGTCATAGGA / / / / // / | MmeI | | |NlaIV Tsp4CI* Hpy178III* | | CviJI | TspEI CviRI* Q S R N L I L D N K L Q L G S I E Q Y P N Q E T * F W I T S C N * A P L N S I L I K K L D F G * Q V A I R L H * T V S S ----:----|----:----|----:----|----:----|----:----|----:----| W D L F K I K S L L N C N P E M S C Y G G I L F S S K P Y C T A I L S W Q V T D L * S V Q N Q I V L Q L * A G N F L I R ApoI TspEI BseGI | TspDTI | | FokI | | TspEI | | | MseI | | | VspI | | | |TspEI BciVI | | | || MseI | MnlI Tsp4CI* | | | || PacI \ \ \ \ \ \ \\ \ CGCATTGATATAGCGTTTGACGGTGCTGATGAAGTGGATGAGAATTTACAATTAATTAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GCGTAACTATATCGCAAACTGCCACGACTACTTCACCTACTCTTAAATGTTAATTAATTT / / / / / / // /// | MnlI Tsp4CI* | | TspEI || ||SetI BciVI | | ApoI || |MseI | TspDTI || TspEI BseGI |VspI |PacI |MseI TspEI FokI R I D I A F D G A D E V D E N L Q L I K A L I * R L T V L M K W M R I Y N * L K H * Y S V * R C * * S G * E F T I N * R ----:----|----:----|----:----|----:----|----:----|----:----| R M S I A N S P A S S T S S F K C N I L E C Q Y L T Q R H Q H L P H S N V I L * A N I Y R K V T S I F H I L I * L * N F TatI |Csp6I ||RsaI ||ScaI TsoI |||SpeI Hpy178III* ||||MaeI SetI | TspEI ||||| TspDTI SetI \ \ \ \\\\\ \ \ GGTGGTGGTGCTTGTCTATTTCAAGAAAAATTGGTTAGTACTAGTGCTAAAACCTTCATT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCACCACGAACAGATAAAGTTCTTTTTAACCAATCATGATCACGATTTTGGAAGTAA / / / /// // / | | TspEI ||| |SpeI SetI | Hpy178III* ||| TspDTI TsoI ||| MaeI ||TatI |Csp6I ScaI RsaI G G G A C L F Q E K L V S T S A K T F I V V V L V Y F K K N W L V L V L K P S L W W C L S I S R K I G * Y * C * N L H C ----:----|----:----|----:----|----:----|----:----|----:----| P P P A Q R N * S F N T L V L A L V K M L H H H K D I E L F I P * Y * H * F R * T T T S T * K L F F Q N T S T S F G E N Hin4II* | TfiI | HinfI TstI | | Hpy178III* SetI | | | MaeIII BsaXI | | | HphI Tsp45I | MnlI BsrI SetI \ \ \ \ \ \ \ \ \ GTCGTTGCTGATTCAAGAAAAAAGTCACCAAAACATTTAGGTAAGAACTGGAGGCAAGGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCAACGACTAAGTTCTTTTTTCAGTGGTTTTGTAAATCCATTCTTGACCTCCGTTCCA / / / / /// / / / Hin4II* | Hpy178III* Tsp45I ||| MnlI BsrI SetI | HphI MaeIII ||BsaXI HinfI |SetI TfiI TstI V V A D S R K K S P K H L G K N W R Q G S L L I Q E K S H Q N I * V R T G G K V R C * F K K K V T K T F R * E L E A R C ----:----|----:----|----:----|----:----|----:----|----:----| T T A S E L F F D G F C K P L F Q L C P Q R Q Q N L F F T V L V N L Y S S S A L D N S I * S F L * W F M * T L V P P L T GsuI Eco57MI MnlI | TspEI | MaeII | |BsaXI | Hin4II* | || TstI | |BsaAI Hpy178III* | || | Csp6I | || SetI | MboI | || | |RsaI | || TaiI | | DpnI MfeI | || | || SetI | || |MnlI | | |BstKTI TspEI \ \\ \ \\ \ \ \\ \\ \ \ \\ \ GTTCCCATTGAAATTGTACCTTCCTCATACGTGAGGGTCAAGAATGATCTATTAGAACAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGGGTAACTTTAACATGGAAGGAGTATGCACTCCCAGTTCTTACTAGATAATCTTGTT / / / // / / /// / // / | BsaXI | |Csp6I | | ||MnlI | || MboI | TstI | RsaI | | |MaeII | |DpnI Eco57MI | SetI | | BsaAI | BstKTI GsuI TspEI | Hin4II* Hpy178III* | TaiI | SetI MnlI V P I E I V P S S Y V R V K N D L L E Q F P L K L Y L P H T * G S R M I Y * N N S H * N C T F L I R E G Q E * S I R T I ----:----|----:----|----:----|----:----|----:----|----:----| T G M S I T G E E Y T L T L F S R N S C H E W Q F Q V K R M R S P * S H D I L V N G N F N Y R G * V H P D L I I * * F L AsuI* FatI AvaII CviRI* DraII |CviAII PpuMI ||Cac8I HindII |BmgT120I ||| SphI Hpy166II ||SetI ||| NspI | MnlI SetI |||AlwNI ||| NlaIII | Hpy188I |BspMI |||| MaeIII \\\ \ \ \ \\ \\\\ \ TTGCATGCTGAAAAAGTTGACATCAGACAAGGAGGTTCTGCTAAAGCAGGTCCTGTTGTA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTACGACTTTTTCAACTGTAGTCTGTTCCTCCAAGACGATTTCGTCCAGGACAACAT // /// / / / / / / // || ||FatI | Hpy188I SetI BspMI | | |PpuMI || |CviAII | MnlI | | |DraII || Cac8I Hpy166II | | |AvaII |CviRI* HindII | | |AsuI* |NlaIII | | BmgT120I |NspI | AlwNI |SphI SetI TspEI MfeI L H A E K V D I R Q G G S A K A G P V V C M L K K L T S D K E V L L K Q V L L * A C * K S * H Q T R R F C * S R S C C N ----:----|----:----|----:----|----:----|----:----|----:----| N C A S F T S M L C P P E A L A P G T T I A H Q F L Q C * V L L N Q * L L D Q Q Q M S F F N V D S L S T R S F C T R N Y ApoI TspEI | BinI* | | MboI | | Hpy188I | | |HphI TaqI | | ||DpnI TspDTI SfaNI ClaI AciI | | |||BstKTI TspEI \ \ \ \ \ \ \\\\ \ ACTGACAATAATAACTTCATTATCGATGCGGATTTCGGTGAAATTTCCGATCCAAGAAAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTGTTATTATTGAAGTAATAGCTACGCCTAAAGCCACTTTAAAGGCTAGGTTCTTTT / / / / / // //// / | TspDTI SfaNI ClaI AciI || |||| MboI MaeIII TaqI || |||DpnI || ||BstKTI || |HphI || Hpy188I |TspEI |ApoI BinI* T D N N N F I I D A D F G E I S D P R K L T I I T S L S M R I S V K F P I Q E N * Q * * L H Y R C G F R * N F R S K K I ----:----|----:----|----:----|----:----|----:----|----:----| V S L L L K M I S A S K P S I E S G L F L Q C Y Y S * * R H P N R H F K R D L F S V I I V E N D I R I E T F N G I W S F TspDTI CviRI* Tsp4CI* | SetI TaqI \ \ \ \ \ TTGCATAGAGAAATCAAACTGTTAGTGGGCGTGGTGGAAACAGGTTTATTCATCGACAAC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTATCTCTTTAGTTTGACAATCACCCGCACCACCTTTGTCCAAATAAGTAGCTGTTG // / / / / |CviRI* Tsp4CI* | SetI TaqI TspEI TspDTI L H R E I K L L V G V V E T G L F I D N C I E K S N C * W A W W K Q V Y S S T T A * R N Q T V S G R G G N R F I H R Q R ----:----|----:----|----:----|----:----|----:----|----:----| N C L S I L S N T P T T S V P K N M S L I A Y L F * V T L P R P P F L N I * R C Q M S F D F Q * H A H H F C T * E D V V MwoI Hpy188I | CviJI TspEI | Tsp4CI* MaeIII \ \ \ \ \ \ GCTTCAAAAGCCTACTTCGGTAATTCTGACGGTAGTGTTGAAGTTACCGAAAAGTGA 730 740 750 760 770 ----:----|----:----|----:----|----:----|----:----|----:-- CGAAGTTTTCGGATGAAGCCATTAAGACTGCCATCACAACTTCAATGGCTTTTCACT / / // / / MwoI CviJI || Tsp4CI* MaeIII |Hpy188I TspEI A S K A Y F G N S D G S V E V T E K * L Q K P T S V I L T V V L K L P K S X F K S L L R * F * R * C * S Y R K V X ----:----|----:----|----:----|----:----|----:----|----:-- A E F A * K P L E S P L T S T V S F H R K L L R S R Y N Q R Y H Q L * R F T S * F G V E T I R V T T N F N G F L S # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AhaIII* 1 DraI AluI 1 AluBI AlwNI 1 CaiI ApoI 6 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BciVI 1 BfuI BclI 1 FbaI,Ksp22I BinI* 1 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 1 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BsaXI 1 BseGI 2 BstF5I,BtsCI BsmI 1 BsaMI,Mva1269I,PctI BspMI 1 BfuAI,Acc36I,BveI BsrI 1 BseNI,Bse1I,BsrSI BstKTI 3 Cac8I 1 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 2 CviQI,RsaNI CviAII 2 CviJI 4 CviKI-1 CviRI* 6 HpyCH4V DpnI 3 MalI DraII 1 EcoO109I Eco57MI 1 FatI 2 FokI 2 GsuI 1 BpmI HgaI 1 CseI Hin4II* 2 HpyAV HindII 1 HincII HinfI 3 HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 3 MaeI 1 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 3 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MfeI 1 MunI MmeI 1 MnlI 6 MseI 3 Tru1I,Tru9I MwoI 3 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PacI 1 PpuMI 1 Psp5II,PspPPI PstI 1 RsaI 2 AfaI ScaI 1 BmcAI,AssI,ZrmI SetI 10 SfaNI 3 LweI SfeI* 1 BstSFI,SfcI,BfmI SpeI 1 BcuI,AhlI SphI 1 PaeI,BbuI SspI 1 TaiI 1 TaqI 2 TatI 1 TfiI 3 PfeI TseI 3 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 18 TasI,Tsp509I,Sse9I TspRI 1 TscAI TstI 1 VspI 1 PshBI,AseI # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI Bce83I* BceAI BcgI BdaI BetI* BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BseBI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr9I CfrI CspCI DdeI DinI DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GlaI GsaI HaeII HaeIII HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin6I HindIII HinP1I HpaI Hpy99I HspAI KasI KpnI Ksp632I* MauBI MboII McrI* MluI MlyI Mph1103I MroNI MslI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PasI PflMI PfoI PleI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SchI ScrFI SduI SecI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SplI* SrfI Sse232I* Sse8387I StuI StyD4I StyI SwaI TaqII TauI TspGWI TspMI Tth111I XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769