Restriction Map of TCB1/YOR086C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

TCB1/YOR086C on chromosome XV from coordinates 486779 to 483219.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.28191

EMBOSS_001 CfrI | BalI BsrI MwoI | CviJI MaeIII | AluI | HaeIII |MboII BaeI | CviJI | |BaeI || BfiI |CviJI CviJI | | SetI \ \\ \\ \ \\ \ \ \ \ ATGGCCAAAGAAGATACTGGGGTAACAGCACCAAAGAAGCCCGAAACAGCCCAAGTAGCT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGGTTTCTTCTATGACCCCATTGTCGTGGTTTCTTCGGGCTTTGTCGGGTTCATCGA / / / / // / / / / / / | CfrI | | |MaeIII BaeI CviJI | | | CviJI HaeIII | | BfiI | | | AluI CviJI | MboII | | SetI BalI BsrI | MwoI CviJI M A K E D T G V T A P K K P E T A Q V A W P K K I L G * Q H Q R S P K Q P K * L G Q R R Y W G N S T K E A R N S P S S * ----:----|----:----|----:----|----:----|----:----|----:----| X A L S S V P T V A G F F G S V A W T A X P W L L Y Q P L L V L S A R F L G L L H G F F I S P Y C C W L L G F C G L Y S TfiI MnlI HinfI SetI | MnlI | BsrI \ \ \ \ \ AACATAAATGGGATAGATAAGTTAGAACCTCCAAAGACGAAAGAGGAAACCGAATCCAGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTATTTACCCTATCTATTCAATCTTGGAGGTTTCTGCTTTCTCCTTTGGCTTAGGTCA / / / // SetI | MnlI |HinfI MnlI |TfiI BsrI N I N G I D K L E P P K T K E E T E S S T * M G * I S * N L Q R R K R K P N P V H K W D R * V R T S K D E R G N R I Q * ----:----|----:----|----:----|----:----|----:----|----:----| L M F P I S L N S G G F V F S S V S D L * C L H S L Y T L V E L S S L P F R I W V Y I P Y I L * F R W L R F L F G F G T BseMII |BspCNI || Hin4II* || | DdeI || | |Hpy188I || | || AciI || | || |BisI || | || ||BlsI || | || |||TauI || | || |||| FatI || | || |||| |MwoI HindIII || | || |||| |CviAII | AluI || | || |||| || NspI | CviJI || | || |||| || NlaIII | | SetI || | || |||| || |MaeI | | | Hpy178III* || | || |||| || |MslI | | | | TspDTI FatI \\ \ \\ \\\\ \\ \\ \ \ \ \ \ \ AAAAGCGTGTCATCTGAGAAGGCGGCACATGCTAGTGATGAAAGCTTCAAGAGAAGTATC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCGCACAGTAGACTCTTCCGCCGTGTACGATCACTACTTTCGAAGTTCTCTTCATAG // / / / //// / /// / / / / // / |BspCNI | | DdeI |||| | ||| MaeI | | | |TspDTI NlaIII BseMII | Hpy188I |||| | ||MslI | | | Hpy178III* Hin4II* |||| | |FatI | | HindIII |||| | CviAII | CviJI |||| NlaIII | AluI |||| NspI SetI |||MwoI ||BisI ||AciI |BlsI TauI K S V S S E K A A H A S D E S F K R S I K A C H L R R R H M L V M K A S R E V S K R V I * E G G T C * * * K L Q E K Y P ----:----|----:----|----:----|----:----|----:----|----:----| L L T D D S F A A C A L S S L K L L L I Y F R T M Q S P P V H * H H F S * S F Y F A H * R L L R C M S T I F A E L S T D CviAII | NlaIII | |HindIII | || AluI BbvII* | || CviJI BseYI | TspEI | || BciVI TspDTI CviJI | MboII | || | SetI | CviJI | GsaI | | MseI \ \\ \ \ \ \ \ \ \ \ \ CATGAAGCTTCTTATGTCGGCTGGAAACAGATTGGTGGCTGGGAAGACAAAGACGAATTA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTACTTCGAAGAATACAGCCGACCTTTGTCTAACCACCGACCCTTCTGTTTCTGCTTAAT ///// / / / / / / // ||||| | | CviJI | BseYI | |MseI ||||| | TspDTI CviJI | TspEI ||||| HindIII GsaI BbvII* ||||CviJI MboII ||||AluI |||BciVI ||SetI |FatI CviAII H E A S Y V G W K Q I G G W E D K D E L M K L L M S A G N R L V A G K T K T N * * S F L C R L E T D W W L G R Q R R I N ----:----|----:----|----:----|----:----|----:----|----:----| W S A E * T P Q F C I P P Q S S L S S N G H L K K H R S S V S Q H S P L C L R I M F S R I D A P F L N T A P F V F V F * BccI TspDTI SetI BetI* |TspEI | MaeI | DdeI Hin4II* |HpaII \\ \ \ \ \ \ \\ ACTTTAGATGATGAATTGATGGATATGACTAGAGAAACCTTCTTAGATAACATCATACCG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAATCTACTACTTAACTACCTATACTGATCTCTTTGGAAGAATCTATTGTAGTATGGC / / / / / / / / | TspEI TspDTI MaeI SetI | Hin4II* HpaII BccI DdeI T L D D E L M D M T R E T F L D N I I P L * M M N * W I * L E K P S * I T S Y R F R * * I D G Y D * R N L L R * H H T G ----:----|----:----|----:----|----:----|----:----|----:----| V K S S S N I S I V L S V K K S L M M G L K L H H I S P Y S * L F R R L Y C * V S * I I F Q H I H S S F G E * I V D Y R BdaI MaeIII CviJI BdaI Tsp45I BsrI | BdaI TsoI |CviJI Tsp4CI* | HphI | BdaI MnlI |Hpy188I \\ \ \ \ \ \ \ \\ GACAGCCTTTACGGTGACTGGTATCATTCGGTAGCCATTTTCTTTATCGGAGGCGTGGCA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTCGGAAATGCCACTGACCATAGTAAGCCATCGGTAAAAGAAATAGCCTCCGCACCGT // / / / / / / / / / / || CviJI | | | HphI | BdaI | | Hpy188I |BdaI | | BsrI | BdaI | TsoI |BdaI | Tsp45I CviJI MnlI BetI* | MaeIII Tsp4CI* D S L Y G D W Y H S V A I F F I G G V A T A F T V T G I I R * P F S L S E A W H Q P L R * L V S F G S H F L Y R R R G I ----:----|----:----|----:----|----:----|----:----|----:----| S L R * P S Q Y * E T A M K K I P P T A P C G K R H S T D N P L W K R * R L R P V A K V T V P I M R Y G N E K D S A H C MwoI BstAPI | SfaNI CviJI | CviRI* PsiI HaeIII TspDTI \ \ \ \ \ TCATTTGCACTTGGTCATTATAAGTTTTCAATGGGGTCGGCCTTTTTTGTCATCGTTATC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAAACGTGAACCAGTAATATTCAAAAGTTACCCCAGCCGGAAAAAACAGTAGCAATAG / / / / / / | | SfaNI PsiI HaeIII TspDTI | CviRI* CviJI BstAPI MwoI S F A L G H Y K F S M G S A F F V I V I H L H L V I I S F Q W G R P F L S S L S I C T W S L * V F N G V G L F C H R Y H ----:----|----:----|----:----|----:----|----:----|----:----| D N A S P * * L N E I P D A K K T M T I M M Q V Q D N Y T K L P T P R K Q * R * * K C K T M I L K * H P R G K K D D N D Hin4I MnlI |SetI SetI |MnlI |NlaIV Hpy178III* \ \\ \\ \ ACTTCATTGTTGTATAGAACCTCTGCTAAAAAATACAGAGGTTCCATAAGAGAGTTAGTC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGTAACAACATATCTTGGAGACGATTTTTTATGTCTCCAAGGTATTCTCTCAATCAG / // / / / SetI |MnlI | | NlaIV MnlI | SetI Hin4I T S L L Y R T S A K K Y R G S I R E L V L H C C I E P L L K N T E V P * E S * S F I V V * N L C * K I Q R F H K R V S P ----:----|----:----|----:----|----:----|----:----|----:----| V E N N Y L V E A L F Y L P E M L S N T * K M T T Y F R Q * F I C L N W L L T L S * Q Q I S G R S F F V S T G Y S L * D MaeI XmnI | AjuI | Hpy166II | |BsiYI* | | Hin4I BsgI | || TspDTI | | | Tsp4CI* Hin4I | TfiI | || | Hin4I | | | | CviRI* Hin4I | HinfI | || | Hin4I \ \ \ \ \ \ \ \ \ \\ \ \ CAGAAAGAGTTCACGGTGCAGAAAGTGGAAAACGACTATGAATCCCTAGAATGGTTGAAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTTTCTCAAGTGCCACGTCTTTCACCTTTTGCTGATACTTAGGGATCTTACCAACTTA / // / / / / / // // // | || | | | Hin4I BsgI || || |Hin4I | || | | | Hin4I || || |Hin4I | || | | CviRI* || || TspDTI | || | Tsp4CI* || |MaeI | || Hpy166II || BsiYI* | |Hin4I |AjuI | XmnI HinfI Hpy178III* TfiI Q K E F T V Q K V E N D Y E S L E W L N R K S S R C R K W K T T M N P * N G * M E R V H G A E S G K R L * I P R M V E C ----:----|----:----|----:----|----:----|----:----|----:----| W F S N V T C F T S F S * S D R S H N F G S L T * P A S L P F R S H I G L I T S L F L E R H L F H F V V I F G * F P Q I TatI |Csp6I ||RsaI ||ScaI ||| AsuI* ||| |AjuI ||| |CviJI Hin4II* ||| |HaeIII | TspEI ||| |BmgT120I | | MseI BsmI ||| ||BsrI TspGWI SetI | | VspI \ \\\ \\\ \ \ \ \ \ GCCTTTTTGGATAAGTACTGGCCCATTTTAGAACCTTCCGTTAGTCAATTAATCGTTCAG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAAAAACCTATTCATGACCGGGTAAAATCTTGGAAGGCAATCAGTTAATTAGCAAGTC / /// //// / / / // BsmI ||| |||| TspGWI SetI | |VspI ||| |||AsuI* | |MseI ||| ||BmgT120I | TspEI ||| |HaeIII Hin4II* ||| |CviJI ||| BsrI ||TatI |Csp6I AjuI ScaI RsaI A F L D K Y W P I L E P S V S Q L I V Q P F W I S T G P F * N L P L V N * S F S L F G * V L A H F R T F R * S I N R S A ----:----|----:----|----:----|----:----|----:----|----:----| A K K S L Y Q G M K S G E T L * N I T * H R K P Y T S A W K L V K R * D I L R E G K Q I L V P G N * F R G N T L * D N L Cac8I | AluI | CviJI CviJI | | SetI | MnlI TfiI ApoI | | |TsoI | | TspDTI HinfI TspEI MboI \ \ \\ \ \ \ \ \ \ CAAGCTAATGAACAAATGGCTACTAATGAGGCGATTCCCAAATTTATTACTCAACTATGG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCGATTACTTGTTTACCGATGATTACTCCGCTAAGGGTTTAAATAATGAGTTGATACC / // /// / / / | |TsoI ||TspDTI HinfI TspEI BstKTI | CviJI |MnlI TfiI ApoI | AluI CviJI Cac8I SetI Q A N E Q M A T N E A I P K F I T Q L W K L M N K W L L M R R F P N L L L N Y G S * * T N G Y * * G D S Q I Y Y S T M D ----:----|----:----|----:----|----:----|----:----|----:----| C A L S C I A V L S A I G L N I V * S H A L * H V F P * * H P S E W I * * E V I L S I F L H S S I L R N G F K N S L * P DpnI |TaqI |ClaI |BstKTI || BinI* XmnI || | HindII | FokI || | Hpy166II | |BbvII* || | | DraIII | || HphI || | | | MseI XcmI | || | MboII \\ \ \ \ \ \ \ \\ \ \ ATCGATGAGTTGACACTTGGTGTTAAACCCCCCAGAGTTGATTTGGTGAAGACTTTCCAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTACTCAACTGTGAACCACAATTTGGGGGGTCTCAACTAAACCACTTCTGAAAGGTT / // / / / / / / / /// | || | | DraIII MseI XcmI | | ||TspRI | || | Hpy166II | | ||BtsI | || | HindII | | |BbvII* | || BinI* | | |MboII | |ClaI | | FokI | |TaqI | HphI | MboI XmnI DpnI I D E L T L G V K P P R V D L V K T F Q S M S * H L V L N P P E L I W * R L S K R * V D T W C * T P Q S * F G E D F P K ----:----|----:----|----:----|----:----|----:----|----:----| I S S N V S P T L G G L T S K T F V K W S R H T S V Q H * V G W L Q N P S S K G D I L Q C K T N F G G S N I Q H L S E L BseGI CviRI* | TspRI | | Hpy188I BsrI BcgI | | | SfaNI | BseRI Hpy178III* BtsI | | | | BccI | |BfiI | MnlI \ \ \ \ \ \ \ \\ \ \ AACACTGCATCCGATGTTGTTGTGATGGACTGGGGTATTTCTTTTACTCCTCACGATTTA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTGACGTAGGCTACAACAACACTACCTGACCCCATAAAGAAAATGAGGAGTGCTAAAT / / / // / / / / / / | | Hpy188I |SfaNI | | BfiI | | MnlI | CviRI* BccI | BseRI | Hpy178III* BseGI BsrI BcgI N T A S D V V V M D W G I S F T P H D L T L H P M L L * W T G V F L L L L T I Y H C I R C C C D G L G Y F F Y S S R F M ----:----|----:----|----:----|----:----|----:----|----:----| F V A D S T T T I S Q P I E K V G * S K F C Q M R H Q Q S P S P Y K K * E E R N V S C G I N N H H V P T N R K S R V I * Hpy188I |BcgI FatI ||TspEI |CviAII ||| MaeII MseI || NlaIII ||| | MseI TspDTI || | DdeI ||| | SetI | CviJI || | EspI* ||| | TaiI TspEI AciI | HaeIII \\ \ \ \\\ \ \ \ \ \ \ TGCGACATGAGTGCTAAGCAAGTCAGAAATTACGTTAATGAATTAGCGGTTGTTAAGGCC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ACGCTGTACTCACGATTCGTTCAGTCTTTAATGCAATTACTTAATCGCCAACAATTCCGG / // / / / / / / / / / / | |FatI EspI* | | | MseI | | | | HaeIII | CviAII DdeI | | MaeII | | | | CviJI NlaIII | TspEI | | | MseI | TaiI | | TspDTI | SetI | AciI Hpy188I TspEI BcgI C D M S A K Q V R N Y V N E L A V V K A A T * V L S K S E I T L M N * R L L R P R H E C * A S Q K L R * * I S G C * G Q ----:----|----:----|----:----|----:----|----:----|----:----| H S M L A L C T L F * T L S N A T T L A I R C S H * A L * F N R * H I L P Q * P A V H T S L L D S I V N I F * R N N L G MwoI | CviJI ApoI | | FatI TspEI | | |CviAII | FokI Hpy188I | | || NlaIII | | HphI BseGI BccI | BsrDI | | || |MaeI \ \ \ \ \ \ \ \ \ \\ \\ AAAATTTTTGGTATCACCATCCCTGTTTCTGTGTCAGACATTGCTTTCAAGGCTCATGCT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAAAAACCATAGTGGTAGGGACAAAGACACAGTCTGTAACGAAAGTTCCGAGTACGA // / / / // / / / // || FokI BseGI BccI |BsrDI MwoI | | |FatI |TspEI Hpy188I | | CviAII |ApoI | NlaIII HphI CviJI K I F G I T I P V S V S D I A F K A H A K F L V S P S L F L C Q T L L S R L M L N F W Y H H P C F C V R H C F Q G S C * ----:----|----:----|----:----|----:----|----:----|----:----| L I K P I V M G T E T D S M A K L A * A W F K Q Y * W G Q K Q T L C Q K * P E H F N K T D G D R N R H * V N S E L S M S FatI |CviAII || Hin4II* || |NlaIII AluI || ||TaqI CviJI TspEI || ||| MnlI Hin4II* ApoI | MlyI || ||| | Tsp4CI* | SetI TspEI | PleI HinfI || ||| | | MseI | |AlwNI \ \ \ \ \\ \\\ \ \ \ \ \\ AGAGTGAAATTCAAATTGATGACTCCCTTCCCTCATGTCGAAACTGTTAATATCCAGCTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCACTTTAAGTTTAACTACTGAGGGAAGGGAGTACAGCTTTGACAATTATAGGTCGAT / / /// / / /// / / / /// MaeI | ||TspEI HinfI | ||| | | MseI ||AlwNI | |PleI | ||| | Tsp4CI* ||CviJI | MlyI | ||| MnlI ||AluI TspEI | ||| TaqI |Hin4II* ApoI | ||FatI SetI | |CviAII | Hin4II* NlaIII R V K F K L M T P F P H V E T V N I Q L E * N S N * * L P S L M S K L L I S S Y S E I Q I D D S L P S C R N C * Y P A T ----:----|----:----|----:----|----:----|----:----|----:----| L T F N L N I V G K G * T S V T L I W S * L S I * I S S E R G E H R F Q * Y G A S H F E F Q H S G E R M D F S N I D L * CfrI XmaIII* | CviJI SetI Eco57I | HaeIII MfeI NlaIV Eco57MI | |MboII TspEI | Hpy178III* | BceAI SetI | |McrI* |BccI \ \ \ \ \ \ \\ \\ CTGAAGGTTCCTGATTTTGATTTTGTTGCTACCTTATTCGGCCGTTCCATCTTCAATTGG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GACTTCCAAGGACTAAAACTAAAACAACGATGGAATAAGCCGGCAAGGTAGAAGTTAACC / / / / / / // / / / | | | Eco57MI | SetI || XmaIII* | TspEI | | | Eco57I BceAI || CfrI | MfeI | | Hpy178III* |HaeIII BccI | NlaIV |CviJI SetI |MboII McrI* L K V P D F D F V A T L F G R S I F N W * R F L I L I L L L P Y S A V P S S I G E G S * F * F C C Y L I R P F H L Q L G ----:----|----:----|----:----|----:----|----:----|----:----| S F T G S K S K T A V K N P R E M K L Q V S P E Q N Q N Q Q * R I R G N W R * N Q L N R I K I K N S G * E A T G D E I P AluI CviJI | SetI | | BssKI | | SecI* | | EcoRII | | | ScrFI | | | BseBI CfrI | | | | StuI | BalI ApoI | | | | CviJI | CviJI TspEI | | | | HaeIII BccI | HaeIII XcmI \ \ \ \ \ \ \ \ \ \ GAAATTTTAGCTATCCCAGGCCTTATGACACTAATACAAAAGATGGCCAAGAAATATATG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAAAATCGATAGGGTCCGGAATACTGTGATTATGTTTTCTACCGGTTCTTTATATAC / / / /// / / / / | | CviJI ||EcoRII BccI | CfrI XcmI | | AluI ||HaeIII HaeIII | SetI ||BssKI CviJI TspEI ||CviJI BalI ApoI ||StuI |SecI* BseBI ScrFI E I L A I P G L M T L I Q K M A K K Y M K F * L S Q A L * H * Y K R W P R N I W N F S Y P R P Y D T N T K D G Q E I Y G ----:----|----:----|----:----|----:----|----:----|----:----| S I K A I G P R I V S I C F I A L F Y I P F K L * G L G * S V L V F S P W S I Y F N * S D W A K H C * Y L L H G L F I H AsuI* AvaII |NlaIV MfeI |BmgT120I MaeIII SetI MnlI TspEI NlaIV \\ \ \ \ \ \ GGTCCAATCTTGTTACCTCCATTTTCTTTACAATTGAACATTCCACAACTCTTATCTGGT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGGTTAGAACAATGGAGGTAAAAGAAATGTTAACTTGTAAGGTGTTGAGAATAGACCA /// / / / / / ||AvaII | MaeIII MnlI TspEI NlaIV ||AsuI* SetI MfeI |BmgT120I NlaIV G P I L L P P F S L Q L N I P Q L L S G V Q S C Y L H F L Y N * T F H N S Y L V S N L V T S I F F T I E H S T T L I W F ----:----|----:----|----:----|----:----|----:----|----:----| P G I K N G G N E K C N F M G C S K D P P D L R T V E M K K V I S C E V V R I Q T W D Q * R W K R * L Q V N W L E * R T CviJI | MboII | |MaeII | || Csp6I | || |RsaI | || |SetI MmeI Tsp4CI* CviRI* | || |TaiI \ \ \ \ \\ \\ TCCAACTTGTCCATTGGTATATTAGAAATAACTGTCAAAAATGCAAAGGGGCTAAAACGT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTGAACAGGTAACCATATAATCTTTATTGACAGTTTTTACGTTTCCCCGATTTTGCA / / / / // // MmeI Tsp4CI* CviRI* | || |RsaI | || |SetI | || MaeII | |TaiI | |SetI | MboII CviJI S N L S I G I L E I T V K N A K G L K R P T C P L V Y * K * L S K M Q R G * N V Q L V H W Y I R N N C Q K C K G A K T Y ----:----|----:----|----:----|----:----|----:----|----:----| E L K D M P I N S I V T L F A F P S F R N W S T W Q Y I L F L Q * F H L P A L V G V Q G N T Y * F Y S D F I C L P * F T TaqI SetI AsuII | TaqI | ApoI | | Ksp632I* TfiI | TspEI | | | MnlI HinfI TaqI | | MseI \ \ \ \ \ \ \ \ \ ACCTCTTCGATATTGAACGAATCAATCGACCCTTACTTATCTTTCGAATTTAACGATATA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TGGAGAAGCTATAACTTGCTTAGTTAGCTGGGAATGAATAGAAAGCTTAAATTGCTATAT / / // / / / / / Csp6I | |Ksp632I* HinfI TaqI | | MseI | MnlI TfiI | TspEI TaqI | ApoI AsuII TaqI T S S I L N E S I D P Y L S F E F N D I P L R Y * T N Q S T L T Y L S N L T I Y L F D I E R I N R P L L I F R I * R Y I ----:----|----:----|----:----|----:----|----:----|----:----| V E E I N F S D I S G * K D K S N L S I Y R K S I S R I L R G K S I K R I * R Y G R R Y Q V F * D V R V * R E F K V I Y BsmAI |Tsp4CI* BsiYI* Csp6I \\ \ \ TCTATTGCCAAGACAAGAACCGTAAGAGACACATTGAACCCCGTTTGGGACGAAACTCTG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AGATAACGGTTCTGTTCTTGGCATTCTCTGTGTAACTTGGGGCAAACCCTGCTTTGAGAC / / / | BsmAI BsiYI* Tsp4CI* S I A K T R T V R D T L N P V W D E T L L L P R Q E P * E T H * T P F G T K L C Y C Q D K N R K R H I E P R L G R N S V ----:----|----:----|----:----|----:----|----:----|----:----| D I A L V L V T L S V N F G T Q S S V R I * Q W S L F R L L C M S G R K P R F E R N G L C S G Y S V C Q V G N P V F S Q RsaI BslFI |MaeII Cac8I || SetI | CviRI* || TaiI MseI TspRI | | Hin4II* \\ \ \ \ \ \ \ TACGTCTTGTTAAACTCATTCACTGACCCCTTGACCATTAGTGTTTATGATAAGCGTGCA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCAGAACAATTTGAGTAAGTGACTGGGGAACTGGTAATCACAAATACTATTCGCACGT // // / / / // || |BslFI MseI TspRI | |Hin4II* || MaeII | CviRI* |Csp6I Cac8I RsaI TaiI SetI Y V L L N S F T D P L T I S V Y D K R A T S C * T H S L T P * P L V F M I S V Q R L V K L I H * P L D H * C L * * A C K ----:----|----:----|----:----|----:----|----:----|----:----| Y T K N F E N V S G K V M L T * S L R A T R R T L S M * Q G R S W * H K H Y A H V D Q * V * E S V G Q G N T N I I L T C StyI AvrII ApoI TatI FatI SecI* TspEI |Csp6I |CviAII TspEI |MaeI EcoRI ||RsaI || NlaIII \ \\ \ \\\ \\ \ AAATTGAAGGATAAAGTCCTAGGCAGAATTCAGTACAACTTGAATACTTTACATGATAAA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAACTTCCTATTTCAGGATCCGTCTTAAGTCATGTTGAACTTATGAAATGTACTATTT / // / /// / // TspEI |SecI* | ||TatI | |FatI |AvrII | |Csp6I | CviAII |StyI | RsaI NlaIII MaeI EcoRI TspEI ApoI K L K D K V L G R I Q Y N L N T L H D K N * R I K S * A E F S T T * I L Y M I K I E G * S P R Q N S V Q L E Y F T * * N ----:----|----:----|----:----|----:----|----:----|----:----| F N F S L T R P L I * Y L K F V K C S L L I S P Y L G L C F E T C S S Y K V H Y F Q L I F D * A S N L V V Q I S * M I F AluI AgeI CviJI BetI* |DdeI BspCNI Cfr10I ||SetI MseI |BseMII |HpaII TspEI \\\ \ \\ \\ \ ACCACGCAAAGAAACTTGAAAGCTCAGTTTTTAAGAAACTCTAAACCGGTTGGGGAATTG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTGCGTTTCTTTGAACTTTCGAGTCAAAAATTCTTTGAGATTTGGCCAACCCCTTAAC / / / /// // / | | DdeI ||BseMII |Cfr10I TspEI | CviJI |BspCNI |BetI* | AluI MseI |AgeI SetI HpaII T T Q R N L K A Q F L R N S K P V G E L P R K E T * K L S F * E T L N R L G N * H A K K L E S S V F K K L * T G W G I D ----:----|----:----|----:----|----:----|----:----|----:----| V V C L F K F A * N K L F E L G T P S N F W A F F S S L E T K L F S * V P Q P I G R L S V Q F S L K * S V R F R N P F Q MboI XhoII | MnlI MboII | DpnI |MseI BccI | BseGI || TfiI MboII | |BstKTI || HinfI Ksp632I* | HpaII | || BinI* \\ \ \ \ \ \ \\ \ ACTTTTGATTTAAGATTCTTCCCAACTTTAGAAGAGAAAAAGTTGCCGGATGGATCTGTG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAAACTAAATTCTAAGAAGGGTTGAAATCTTCTCTTTTTCAACGGCCTACCTAGACAC / / / / / / / /// / | MseI HinfI Ksp632I* | | | ||| XhoII MboII TfiI | | | ||| MboI | | | ||DpnI | | | |BstKTI | | | |MnlI | | | BseGI | | HpaII | BccI MboII T F D L R F F P T L E E K K L P D G S V L L I * D S S Q L * K R K S C R M D L W F * F K I L P N F R R E K V A G W I C G ----:----|----:----|----:----|----:----|----:----|----:----| V K S K L N K G V K S S F F N G S P D T S K Q N L I R G L K L L S F T A P H I Q S K I * S E E W S * F L F L Q R I S R H BetI* Hin4II* SetI FokI |HpaII BsrI |TaqI | MboII \ \\ \ \\ \ \ GAGGAACTACCGGATTTGAATACTGGTATTGCTAAAGTTGTGGTCGAAGAAGGTTCTCGT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTTGATGGCCTAAACTTATGACCATAACGATTTCAACACCAGCTTCTTCCAAGAGCA / / // / / / / / | FokI |BetI* BsrI | | SetI MboII BinI* HpaII | TaqI Hin4II* E E L P D L N T G I A K V V V E E G S R R N Y R I * I L V L L K L W S K K V L V G T T G F E Y W Y C * S C G R R R F S F ----:----|----:----|----:----|----:----|----:----|----:----| S S S G S K F V P I A L T T T S S P E R P P V V P N S Y Q Y Q * L Q P R L L N E L F * R I Q I S T N S F N H D F F T R T Hin4II* | MboII | | MaeIII | | |MboII | | ||SetI | | ||| Eco57I | | ||| Eco57MI | | ||| | MaeII BsmI | | ||| | | SetI | SpeI | | ||| | | TaiI Hpy166II | |MaeI \ \ \\\ \ \ \ \ \ \\ TTTGCTGAAGAAGAACAGAAGGTTACTGCCTACGTTGAAGTTTACTTGAATGCTAAACTA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGACTTCTTCTTGTCTTCCAATGACGGATGCAACTTCAAATGAACTTACGATTTGAT / // / / / / / / / / | || | | | | MaeII Hpy166II BsmI MaeI | || | | | TaiI | || | | | SetI | || | | MaeIII | || | Eco57MI | || | Eco57I | || MboII | |SetI | MboII Hin4II* F A E E E Q K V T A Y V E V Y L N A K L L L K K N R R L L P T L K F T * M L N * C * R R T E G Y C L R * S L L E C * T S ----:----|----:----|----:----|----:----|----:----|----:----| K A S S S C F T V A * T S T * K F A L S N Q Q L L V S P * Q R R Q L K S S H * V K S F F F L L N S G V N F N V Q I S F * MseI Csp6I |HpaI |RsaI ApoI |HindII BsrI |BsrI TspEI |Hpy166II TspRI TsoI |TspRI MslI EcoRI Hpy188I \\ \ \ \\ \ \ \ GTGTTAACCACTGGTAAGGCAACTGACACTGGTACATTGAAGTGGAATTCAGACTACGAA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CACAATTGGTGACCATTCCGTTGACTGTGACCATGTAACTTCACCTTAAGTCTGATGCTT / // / / / / // / // | |TspRI BsrI TsoI TspRI | || MslI |Hpy188I | |MseI | |Csp6I EcoRI | Hpy166II | RsaI TspEI | HindII BsrI ApoI | HpaI SpeI V L T T G K A T D T G T L K W N S D Y E C * P L V R Q L T L V H * S G I Q T T K V N H W * G N * H W Y I E V E F R L R S ----:----|----:----|----:----|----:----|----:----|----:----| T N V V P L A V S V P V N F H F E S * S L T L W Q Y P L Q C Q Y M S T S N L S R H * G S T L C S V S T C Q L P I * V V F MwoI BstAPI | CviRI* | | MboI | | | DpnI | | | |BstKTI | | | || Hpy99I BccI BseGI \ \ \ \\ \ \ \ GCAGTTATTGCAGATCGTCGTAAAACAAGATATAAGTTTGTCGTCAAGGATGGCAAAGGA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCAATAACGTCTAGCAGCATTTTGTTCTATATTCAAACAGCAGTTCCTACCGTTTCCT / / //// / / | | |||MboI BccI BseGI | | ||Hpy99I | | |DpnI | | BstKTI | CviRI* BstAPI MwoI A V I A D R R K T R Y K F V V K D G K G Q L L Q I V V K Q D I S L S S R M A K E S Y C R S S * N K I * V C R Q G W Q R R ----:----|----:----|----:----|----:----|----:----|----:----| A T I A S R R L V L Y L N T T L S P L P L L * Q L D D Y F L I Y T Q R * P H C L C N N C I T T F C S I L K D D L I A F S FokI | TspEI | | MboI | | XhoII | | | DpnI | | | |MboII | | | |BstKTI | | | || BinI* MseI CviJI Hpy166II \ \ \ \\ \ \ \ \ GAAGAAATTGGATCTACCATTCAAACCCTGAATGATTTAATAGATAGAAGCCAAGTGAAC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTTAACCTAGATGGTAAGTTTGGGACTTACTAAATTATCTATCTTCGGTTCACTTG / / // / / / / / | | || | BinI* MseI CviJI Hpy166II | | || XhoII | | || MboI | | |MboII | | |DpnI | | BstKTI | TspEI FokI E E I G S T I Q T L N D L I D R S Q V N K K L D L P F K P * M I * * I E A K * T R N W I Y H S N P E * F N R * K P S E Q ----:----|----:----|----:----|----:----|----:----|----:----| S S I P D V M * V R F S K I S L L W T F L L F Q I * W E F G S H N L L Y F G L S F F N S R G N L G Q I I * Y I S A L H V BsmAI Eco31I ApoI TfiI MaeIII | PflMI TspEI HinfI MseI Tsp45I HphI | BsiYI* \ \ \ \ \ \ \ AAAAATTTGATTCCATTAAAAAACCAAAAGGGTGACATAAAGATTACCACATATTGGAGA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTAAACTAAGGTAATTTTTTGGTTTTCCCACTGTATTTCTAATGGTGTATAACCTCT / / / / / / / / | HinfI MseI | HphI | | SetI | TfiI Tsp45I | Eco31I TspEI MaeIII | BsmAI ApoI BsiYI* PflMI K N L I P L K N Q K G D I K I T T Y W R K I * F H * K T K R V T * R L P H I G D K F D S I K K P K G * H K D Y H I L E T ----:----|----:----|----:----|----:----|----:----|----:----| L F K I G N F F W F P S M F I V V Y Q L C F N S E M L F G F P H C L S * W M N S F I Q N W * F V L L T V Y L N G C I P S MfeI MmeI TspEI | PflMI | BsiYI* | | KasI | | HgiCI* | | |AcyI | | |NarI | | |Hin6I SfeI* | | ||GlaI | GsuI | | ||DinI | Eco57MI | | ||NlaIV | | AluI | | |||HhaI | | CviJI | | ||||HaeII SetI BsrI NlaIV | | | SetI | | |||||TspDTI \ \ \ \ \ \ \ \ \ \\\\\\ CCTGTTAGACTGGAGATTGGTTCCAACTCTGTAGCTTACACGCCACCAATTGGCGCCATC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| GGACAATCTGACCTCTAACCAAGGTTGAGACATCGAATGTGCGGTGGTTAACCGCGGTAG / / / /// // ////// / BsrI NlaIV | ||CviJI || |||||| Hpy188I | ||AluI || |||||HgiCI* | |SfeI* || |||||KasI | SetI || ||||TspDTI Eco57MI || ||||Hin6I GsuI || ||||NarI || ||||AcyI || |||NlaIV || |||DinI || |||GlaI || ||HhaI || |HaeII || TspEI || MfeI |BsiYI* |PflMI MmeI P V R L E I G S N S V A Y T P P I G A I L L D W R L V P T L * L T R H Q L A P S C * T G D W F Q L C S L H A T N W R H Q ----:----|----:----|----:----|----:----|----:----|----:----| G T L S S I P E L E T A * V G G I P A M V Q * V P S Q N W S Q L K C A V L Q R W R N S Q L N T G V R Y S V R W W N A G D Acc65I HgiCI* |Csp6I ||RsaI ||NlaIV |||BinI* ||||KpnI ||||| MboI Hpy188I ApoI ||||| | DpnI | BccI Hin4II* TspEI ||||| | |BstKTI \ \ \ \ \\\\\ \ \\ AGAGTATTCATTGAGAAGGCAAACGATTTGAGAAATTTGGAAAAGTTTGGTACCATTGAT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCATAAGTAACTCTTCCGTTTGCTAAACTCTTTAAACCTTTTCAAACCATGGTAACTA / / / / /// // | Hin4II* TspEI | ||| |DpnI BccI ApoI | ||| BstKTI | ||HgiCI* | ||Acc65I | ||BinI* | |Csp6I | NlaIV | RsaI KpnI R V F I E K A N D L R N L E K F G T I D E Y S L R R Q T I * E I W K S L V P L I S I H * E G K R F E K F G K V W Y H * S ----:----|----:----|----:----|----:----|----:----|----:----| L T N M S F A F S K L F K S F N P V M S * L I * Q S P L R N S F N P F T Q Y W Q S Y E N L L C V I Q S I Q F L K T G N I TsoI Hin4II* Hpy178III* Tsp4CI* MseI | TaqI | CviJI \ \ \ \ \ \ CCATACTGTAAAGTTTTGGTTAATGGTTTATCGAAGGGTAGAACTGATTTCAAGAGCCAA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GGTATGACATTTCAAAACCAATTACCAAATAGCTTCCCATCTTGACTAAAGTTCTCGGTT / // / / / / / | |Tsp4CI* | | TaqI | CviJI | TsoI | Hin4II* Hpy178III* MboI MseI P Y C K V L V N G L S K G R T D F K S Q H T V K F W L M V Y R R V E L I S R A K I L * S F G * W F I E G * N * F Q E P N ----:----|----:----|----:----|----:----|----:----|----:----| G Y Q L T K T L P K D F P L V S K L L W D M S Y L K P * H N I S P Y F Q N * S G W V T F N Q N I T * R L T S S I E L A L Hpy178III* CviRI* TfiI | TfiI |HphI HinfI | HinfI ||MaeIII TspEI \ \ \ \\\ \ ACTTTGAATCCTGTCTGGAATCAAGTTATTTATGTTGCAGTTACTTCACCAAACCAAAGA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAACTTAGGACAGACCTTAGTTCAATAAATACAACGTCAATGAAGTGGTTTGGTTTCT / / / / / HinfI | HinfI CviRI* MaeIII TfiI | TfiI HphI Hpy178III* T L N P V W N Q V I Y V A V T S P N Q R L * I L S G I K L F M L Q L L H Q T K E F E S C L E S S Y L C C S Y F T K P K N ----:----|----:----|----:----|----:----|----:----|----:----| V K F G T Q F * T I * T A T V E G F W L F K S D Q R S D L * K H Q L * K V L G F S Q I R D P I L N N I N C N S * W V L S Tsp4CI* |FokI || HindII || Hpy166II || | MboI || | | DpnI || | | |BstKTI || | | || Hpy166II || | | || | DraIII || | | || | | ApoI TaqI || | | || | | TspEI |BseGI || | | || | | EcoRI \\ \\ \ \ \\ \ \ \ ATTACGCTTCAATGTATGGATGTCGAAACAGTCAACAAAGATCGTTCACTTGGTGAATTC 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGCGAAGTTACATACCTACAGCTTTGTCAGTTGTTTCTAGCAAGTGAACCACTTAAG / / / / / / // / / / / TspEI | | | | FokI || | | DraIII EcoRI | | | | || | Hpy166II TspEI | | | | || MboI ApoI | | | | |DpnI | | | | BstKTI | | | Hpy166II | | | HindII | | Tsp4CI* | TaqI BseGI I T L Q C M D V E T V N K D R S L G E F L R F N V W M S K Q S T K I V H L V N S Y A S M Y G C R N S Q Q R S F T W * I Q ----:----|----:----|----:----|----:----|----:----|----:----| I V S * H I S T S V T L L S R E S P S N F * A E I Y P H R F L * C L D N V Q H I N R K L T H I D F C D V F I T * K T F E HphI |MseI ||HpaI ||HindII ||Hpy166II ||| AclI ||| MaeII ||| | SetI ||| | TaiI ||| | | Hpy178III* ||| | | | Hin4II* MnlI ||| | | | | MseI BseGI |FokI \\\ \ \ \ \ \ \ \\ AATGTTAACGTTCAAGATTTATTTAAGAAGGATGAGAATGATAAATATGAGGAAACTATT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAATTGCAAGTTCTAAATAAATTCTTCCTACTCTTACTATTTATACTCCTTTGATAA / // / / / / / / / | || | | | MseI BseGI MnlI FokI | || | | Hin4II* | || | Hpy178III* | || MaeII | || AclI | |MseI | |TaiI | |SetI | Hpy166II | HindII | HpaI HphI N V N V Q D L F K K D E N D K Y E E T I M L T F K I Y L R R M R M I N M R K L L C * R S R F I * E G * E * * I * G N Y * ----:----|----:----|----:----|----:----|----:----|----:----| L T L T * S K N L F S S F S L Y S S V I * H * R E L N I * S P H S H Y I H P F * I N V N L I * K L L I L I I F I L F S N AluI TspDTI DdeI SduI CviJI | SfaNI SauI* BsaXI | SetI | | MaeI DdeI |SetI BseSI \ \ \ \ \ \ \\ \ GATGAAAAAGCTAAAGTTGGTCGTCTAGTGATGCCTAAGAAAAAACCTAAGGGCACTATA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTTTTCGATTTCAACCAGCAGATCACTACGGATTCTTTTTTGGATTCCCGTGATAT / / / / / / / /// | | TspDTI | MaeI DdeI SetI ||BsaXI | CviJI SfaNI |BseSI | AluI |SduI SetI SauI* DdeI D E K A K V G R L V M P K K K P K G T I M K K L K L V V * * C L R K N L R A L * * K S * S W S S S D A * E K T * G H Y N ----:----|----:----|----:----|----:----|----:----|----:----| S S F A L T P R R T I G L F F G L P V I Q H F L * L Q D D L S A * S F V * P C * I F F S F N T T * H H R L F F R L A S Y MnlI | AciI | | BsaXI | | | FauI | | | | SetI | | | | | MseI | | | | | | MnlI | | | | | | |AclI | | | | | | |MaeII | | | | | | || SetI SetI | | | | | | || TaiI \ \ \ \ \ \ \ \\ \ ACATACTATACCTCCTTTTATCCCGCTTTACCTGTTTTAACGTTAGAGGAAATCCAAGAT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TGTATGATATGGAGGAAAATAGGGCGAAATGGACAAAATTGCAATCTCCTTTAGGTTCTA / / / / / / // / SetI | | | | FauI || MaeII | | | SetI || AclI | | AciI |MseI | BsaXI |TaiI MnlI |SetI MnlI T Y Y T S F Y P A L P V L T L E E I Q D H T I P P F I P L Y L F * R * R K S K I I L Y L L L S R F T C F N V R G N P R F ----:----|----:----|----:----|----:----|----:----|----:----| V Y * V E K * G A K G T K V N S S I W S L M S Y R R K D R K V Q K L T L P F G L C V I G G K I G S * R N * R * L F D L I MseI |HpaI |HindII |Hpy166II MfeI ||AjuI AjuI TspEI \\\ \ \ TTAGATAAAGTTAACAAAAAGAAAAAAGCATTGGAACTGCGTAAGTCAGCAATTGATGAG 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTATTTCAATTGTTTTTCTTTTTTCGTAACCTTGACGCATTCAGTCGTTAACTACTC / // / / | |MseI AjuI TspEI | Hpy166II MfeI | HindII | HpaI AjuI L D K V N K K K K A L E L R K S A I D E * I K L T K R K K H W N C V S Q Q L M R R * S * Q K E K S I G T A * V S N * * E ----:----|----:----|----:----|----:----|----:----|----:----| K S L T L L F F F A N S S R L D A I S S N L Y L * C F S F L M P V A Y T L L Q H * I F N V F L F F C Q F Q T L * C N I L BbvII* | CviJI | | ApoI | | TspEI | | MboII | | | MboI | | | BclI | | | | DpnI | | | | |BstKTI ApoI | | | | ||Hpy178III* TspEI | | | | ||| MnlI SetI TspEI \ \ \ \ \ \\\ \ \ \ AAAAAAATTTCTAAAGAAGACAAAGCCAAATTTGATCAAGAATGGAATGAGGTCAAAGAA 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTTAAAGATTTCTTCTGTTTCGGTTTAAACTAGTTCTTACCTTACTCCAGTTTCTT / / / / // / / / / TspEI | | | || | | MnlI SetI ApoI | | | || | Hpy178III* | | | || BclI | | | || MboI | | | |DpnI | | | BstKTI | | TspEI | | ApoI | BbvII* | MboII CviJI K K I S K E D K A K F D Q E W N E V K E K K F L K K T K P N L I K N G M R S K N K N F * R R Q S Q I * S R M E * G Q R I ----:----|----:----|----:----|----:----|----:----|----:----| F F I E L S S L A L N S * S H F S T L S S F F K * L L C L W I Q D L I S H P * L F F N R F F V F G F K I L F P I L D F F FatI AflIII BspLU11I* |CviAII || BbvII* || |NspI CviRI* || |NlaIII | FalI StyI || || MboII TspEI TspEI | FalI SecI* \\ \\ \ \ \ \ \ \ TTGGAAGACATGTATAGTAATAGACAGAAATTGGATTTGCCAGAATTATTGCAATACAAC 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTTCTGTACATATCATTATCTGTCTTTAACCTAAACGGTCTTAATAACGTTATGTTG / / // / / // / TspEI | || BbvII* TspEI || CviRI* | || MboII |FalI | |BspLU11I* |FalI | |AflIII TspEI | |FatI | CviAII NlaIII NspI L E D M Y S N R Q K L D L P E L L Q Y N W K T C I V I D R N W I C Q N Y C N T T G R H V * * * T E I G F A R I I A I Q P ----:----|----:----|----:----|----:----|----:----|----:----| N S S M Y L L L C F N S K G S N N C Y L I P L C T Y Y Y V S I P N A L I I A I C Q F V H I T I S L F Q I Q W F * Q L V V MaeIII Tsp45I | Tsp4CI* | | TspRI | | |FalI HinfI | | |FalI | BsiYI* | | ||MseI | |BsiYI* | | ||| BsiYI* | || CviJI | | ||| | TspEI | || | MaeII | | ||| | | MlyI | || | | SetI SetI | | ||| | | PleI | || | | TaiI \ \ \ \\\ \ \ \ \ \\ \ \ \ CAAGGTGTTCTTGCTGTCACTGTCCTTAATGGGGAATTGCCCGACTCTGGGCTATACGTC 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCCACAAGAACGACAGTGACAGGAATTACCCCTTAACGGGCTGAGACCCGATATGCAG / / / / // // // / / / / | SecI* | | |MseI || || | | | MaeII | StyI | | BsiYI* || || | | TaiI SetI | Tsp4CI* || || | | SetI | Tsp45I || || | CviJI | MaeIII || || HinfI | FalI || |BsiYI* | FalI || BsiYI* TspRI |TspEI |PleI MlyI Q G V L A V T V L N G E L P D S G L Y V K V F L L S L S L M G N C P T L G Y T S R C S C C H C P * W G I A R L W A I R P ----:----|----:----|----:----|----:----|----:----|----:----| W P T R A T V T R L P S N G S E P S Y T G L H E Q Q * Q G * H P I A R S Q A I R L T N K S D S D K I P F Q G V R P * V D Hpy166II | MaeII TaqI | |BsaAI |Hpy178III* BdaI FokI BdaI | || SetI || TspEI BdaI TaqI BseGI BdaI | || TaiI || |BccI \ \ \ \ \ \\ \ \\ \\ CAAGCGTTTTTCGATGATAATGGTCATCCAAGATTTGTTAGTCCACGTATTCCATCGAGA 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCGCAAAAAGCTACTATTACCAGTAGGTTCTAAACAATCAGGTGCATAAGGTAGCTCT / / / / / // // // BdaI | FokI BseGI BdaI || |MaeII |Hpy178III* BdaI TaqI BdaI || BsaAI TaqI |TaiI |SetI Hpy166II Q A F F D D N G H P R F V S P R I P S R K R F S M I M V I Q D L L V H V F H R E S V F R * * W S S K I C * S T Y S I E N ----:----|----:----|----:----|----:----|----:----|----:----| W A N K S S L P * G L N T L G R I G D L G L T K R H Y H D D L I Q * D V Y E M S L R K E I I I T M W S K N T W T N W R S MaeIII Tsp45I | SetI | | MaeII | | |BtrI | | || MboI | | || BclI | | || SetI | | || TaiI | | || | DpnI | | || | |BstKTI Hpy178III* | | || | || HphI TspEI \ \ \ \\ \ \\ \ \ ATTGTCAAGAATGGTTGGTCAGGTGACGTGATCATAAAAGAATTGGACAAATCCATTACC 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TAACAGTTCTTACCAACCAGTCCACTGCACTAGTATTTTCTTAACCTGTTTAGGTAATGG / / / / / // // / / | | Hpy178III* SetI | || || HphI TspEI | TspEI | || || BclI BccI | || || MboI | || |DpnI | || BstKTI | |MaeII | Tsp45I | MaeIII | BtrI TaiI SetI I V K N G W S G D V I I K E L D K S I T L S R M V G Q V T * S * K N W T N P L P C Q E W L V R * R D H K R I G Q I H Y H ----:----|----:----|----:----|----:----|----:----|----:----| I T L F P Q D P S T I M F S N S L D M V F Q * S H N T L H R S * L L I P C I W * N D L I T P * T V H D Y F F Q V F G N G BarI \ ACTTTTAGAGTTGCTAAAAATAAAAACTACAACAGAGTGGAGAAATGCGTTTGTGAAGTA 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAAATCTCAACGATTTTTATTTTTGATGTTGTCTCACCTCTTTACGCAAACACTTCAT / BarI T F R V A K N K N Y N R V E K C V C E V L L E L L K I K T T T E W R N A F V K * F * S C * K * K L Q Q S G E M R L * S R ----:----|----:----|----:----|----:----|----:----|----:----| V K L T A L F L F * L L T S F H T Q S T W K * L Q * F Y F S C C L P S I R K H L S K S N S F I F V V V S H L F A N T F Y Tsp4CI* BarI | PsiI SspI | MseI | | CviJI |BccI \ \ \ \ \ \\ GAACTACCCACACAAGAGTTAGTTAAGAACTGTTATTATAAGCCATCAATATTACATCTT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGATGGGTGTGTTCTCAATCAATTCTTGACAATAATATTCGGTAGTTATAATGTAGAA / / / / / / / / BarI MseI Tsp4CI* | CviJI | BccI Hin4II* PsiI SspI E L P T Q E L V K N C Y Y K P S I L H L N Y P H K S * L R T V I I S H Q Y Y I F T T H T R V S * E L L L * A I N I T S F ----:----|----:----|----:----|----:----|----:----|----:----| S S G V C S N T L F Q * * L G D I N C R L V V W V L T L * S S N N Y A M L I V D F * G C L L * N L V T I I L W * Y * M K FatI BsaXI |CviAII | HphI || BsaXI Hin4II* | | BtsI || NlaIII | SetI | | TspRI || | NlaIV \ \ \ \ \ \\ \ \ TCAGGTGAAGGCAGTGCTAAACTAATGCTCCAAATATCATGGTTCCCTATTGATACAAAA 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCCACTTCCGTCACGATTTGATTACGAGGTTTATAGTACCAAGGGATAACTATGTTTT / // // // // / SetI |TspRI |BtsI || || NlaIV BsaXI HphI || |FatI || CviAII |BsaXI NlaIII S G E G S A K L M L Q I S W F P I D T K Q V K A V L N * C S K Y H G S L L I Q N R * R Q C * T N A P N I M V P Y * Y K T ----:----|----:----|----:----|----:----|----:----|----:----| E P S P L A L S I S W I D H N G I S V F K L H L C H * V L A G F I M T G * Q Y L * T F A T S F * H E L Y * P E R N I C F MboI Tsp4CI* BclI | MroNI SetI | Cfr10I | DpnI HphI | |HpaII | |BstKTI |MnlI | ||NaeI | || ApoI ||DrdI | ||Cac8I | || TspEI ||| TaqI \ \\\ \ \\ \ \\\ \ CAGTTGCCGGCAAATGACCTGATCACAAATTCTGGTGATTTGACGATTATGTCGAGGAGT 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| GTCAACGGCCGTTTACTGGACTAGTGTTTAAGACCACTAAACTGCTAATACAGCTCCTCA / /// / // / / // / | ||| SetI || BclI TspEI |DrdI TaqI | ||Cfr10I || MboI ApoI |MnlI | ||MroNI |DpnI HphI | |HpaII BstKTI | Cac8I | NaeI Tsp4CI* Q L P A N D L I T N S G D L T I M S R S S C R Q M T * S Q I L V I * R L C R G V V A G K * P D H K F W * F D D Y V E E C ----:----|----:----|----:----|----:----|----:----|----:----| C N G A F S R I V F E P S K V I I D L L V T A P L H G S * L N Q H N S S * T S S L Q R C I V Q D C I R T I Q R N H R P T BseGI | TsoI | BsgI | |Hpy188I AsuI* | || MseI AvaII | || SfaNI Hpy188I CviRI* | || |SwaI |BmgT120I | FokI BseRI | || |AhaIII* ||NlaIV MseI \ \ \ \ \\ \\ \\\ \ GCAGAAAACTTGATAGCATCCGATTTAAATGGTTATTCGGACCCATACTTAAAGTATTAC 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCTTTTGAACTATCGTAGGCTAAATTTACCAATAAGCCTGGGTATGAATTTCATAATG / / / / / // / / // / | BseRI | | | || SfaNI | |AvaII MseI | FokI | | | |MseI | |AsuI* CviRI* | | | AhaIII* | BmgT120I | | | SwaI | NlaIV | | Hpy188I Hpy188I | BsgI | TsoI BseGI A E N L I A S D L N G Y S D P Y L K Y Y Q K T * * H P I * M V I R T H T * S I T R K L D S I R F K W L F G P I L K V L H ----:----|----:----|----:----|----:----|----:----|----:----| A S F K I A D S K F P * E S G Y K F Y * H L F S S L M R N L H N N P G M S L T N C F V Q Y C G I * I T I R V W V * L I V Hin6I BbvII* |GlaI ||HhaI ||| MboII SetI TfiI MnlI ||| | Hin4II* | MseI HinfI \ \\\ \ \ \ \ \ ATCAATAATGAGGAAGACTGCGCTTACAAGACGAAGGTTGTTAAGAAAACTTTGAATCCT 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTATTACTCCTTCTGACGCGAATGTTCTGCTTCCAACAATTCTTTTGAAACTTAGGA / /// / / / / / MnlI ||| | Hin4II* SetI MseI HinfI ||| BbvII* TfiI ||| MboII ||Hin6I |GlaI HhaI I N N E E D C A Y K T K V V K K T L N P S I M R K T A L T R R R L L R K L * I L Q * * G R L R L Q D E G C * E N F E S * ----:----|----:----|----:----|----:----|----:----|----:----| M L L S S S Q A * L V F T T L F V K F G C * Y H P L S R K C S S P Q * S F K S D D I I L F V A S V L R L N N L F S Q I R Tsp4CI* DdeI | MseI | TfiI Hin4II* TspDTI | |AhaIII* | HinfI \ \ \ \\ \ \ AAATGGAATGATGAAGGAACTATTCAAATCAATAACCGTTTAAATGATGTTCTAAGAATC 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| TTTACCTTACTACTTCCTTGATAAGTTTAGTTATTGGCAAATTTACTACAAGATTCTTAG / / / // / / Hin4II* TspDTI | |MseI | HinfI | AhaIII* | TfiI Tsp4CI* DdeI K W N D E G T I Q I N N R L N D V L R I N G M M K E L F K S I T V * M M F * E S M E * * R N Y S N Q * P F K * C S K N Q ----:----|----:----|----:----|----:----|----:----|----:----| L H F S S P V I * I L L R K F S T R L I * I S H H L F * E F * Y G N L H H E L F F P I I F S S N L D I V T * I I N * S D BseGI FatI | Hin4I |CviAII TfiI | Hin4I ||Hin4I BsrI | | FokI ||Hin4I HinfI | | |Csp6I BdaI ||| NlaIII | BfiI AciI | | ||RsaI BdaI \\\ \ \ \ \ \ \ \\\ \ AAAGTCATGGACTGGGATTCCACATCTGCGGATGATACCATTGGTACAGCAGAAATCCCA 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCAGTACCTGACCCTAAGGTGTAGACGCCTACTATGGTAACCATGTCGTCTTTAGGGT / / // / // / / /// / | | |FatI BsrI |BfiI | Hin4I ||| BdaI | | CviAII HinfI | Hin4I ||| BdaI | NlaIII TfiI | BseGI ||FokI Hin4I AciI |Csp6I Hin4I RsaI K V M D W D S T S A D D T I G T A E I P K S W T G I P H L R M I P L V Q Q K S H S H G L G F H I C G * Y H W Y S R N P I ----:----|----:----|----:----|----:----|----:----|----:----| L T M S Q S E V D A S S V M P V A S I G * L * P S P N W M Q P H Y W Q Y L L F G F D H V P I G C R R I I G N T C C F D W MaeII | Csp6I | |RsaI | |SetI | |TaiI TaqI | ||AgeI EcoP15I | ||BetI* | Csp6I | ||Cfr10I | |RsaI | |||HpaII SetI | ||BdaI | |||Hin4II* |MnlI | ||BdaI TspEI | |||| BsiYI* \\ \ \\\ \ \ \\\\ \ TTGAATAAGGTCAAAGTCGAGGGTACTACCGAATTAGACGTACCGGTAGAAGGATTAGAG 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTATTCCAGTTTCAGCTCCCATGATGGCTTAATCTGCATGGCCATCTTCCTAATCTC / / / /// / / /// // | MnlI | ||Csp6I | | ||| |Cfr10I SetI | |RsaI | | ||| |BsiYI* | BdaI | | ||| |BetI* | BdaI | | ||| |AgeI EcoP15I | | ||| HpaII TaqI | | ||Hin4II* | | ||Csp6I | | |RsaI | | MaeII | TaiI | SetI TspEI L N K V K V E G T T E L D V P V E G L E * I R S K S R V L P N * T Y R * K D * R E * G Q S R G Y Y R I R R T G R R I R E ----:----|----:----|----:----|----:----|----:----|----:----| N F L T L T S P V V S N S T G T S P N S M S Y P * L R P Y * R I L R V P L L I L Q I L D F D L T S G F * V Y R Y F S * L AluI CviJI AluI | SetI Hpy178III* CviJI | |MseI | Tsp4CI* CviRI* | SetI | || CviJI \ \ \ \ \ \ \\ \ AACGCTGGTCAAGACGGTGGTATGTTGCATTTAGCTTTCAGCTTTAAGCCAAGATACACC 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCGACCAGTTCTGCCACCATACAACGTAAATCGAAAGTCGAAATTCGGTTCTATGTGG / / / / / / / / / | Tsp4CI* | | | | | | CviJI Hpy178III* | | | | | MseI | | | | CviJI | | | | AluI | | | SetI | | CviJI | | AluI | SetI CviRI* N A G Q D G G M L H L A F S F K P R Y T T L V K T V V C C I * L S A L S Q D T P R W S R R W Y V A F S F Q L * A K I H H ----:----|----:----|----:----|----:----|----:----|----:----| F A P * S P P I N C K A K L K L G L Y V S R Q D L R H Y T A N L K * S * A L I C V S T L V T T H Q M * S E A K L W S V G BseGI | StyI | SecI* | | SfaNI Hin4II* | | | MaeI | Hin4I | | | | Csp6I | Hin4I | | | | |RsaI | | FokI | | | | |SetI | | | SetI | | | | |Hin4I MslI MmeI | | | | Hpy188I | | | | |Hin4I \ \ \ \ \ \ \ \ \ \ \ \\ ATTAGCGTGAGTAAAAGAGAAAAGAAGGTCGGAGATATAGCATCCAAGGGACTAGGTACT 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| TAATCGCACTCATTTTCTCTTTTCTTCCAGCCTCTATATCGTAGGTTCCCTGATCCATGA / / / / / // / / /// // / | MmeI | | SetI |FokI BseGI | ||| || BaeI MslI | Hin4I Hpy188I | ||| |Csp6I | Hin4I | ||| RsaI Hin4II* | ||MaeI | |SfaNI | |SetI | Hin4I | Hin4I SecI* StyI I S V S K R E K K V G D I A S K G L G T L A * V K E K R R S E I * H P R D * V L * R E * K R K E G R R Y S I Q G T R Y W ----:----|----:----|----:----|----:----|----:----|----:----| M L T L L L S F F T P S I A D L P S P V W * R S Y F L F S P R L Y L M W P V L Y N A H T F S F L L D S I Y C G L S * T S AluI AciI CviJI |BisI MboI BslFI | SetI ||BlsI BaeI | DpnI |BsrI | | Csp6I McrI* |||AciI | HgiCI* | |BstKTI || BaeI | | |RsaI |Tsp4CI* |||TauI | | NlaIV | ||Hpy178III* \\ \ \ \ \\ \\ \\\\ \ \ \ \ \\\ GGTTTGAAAGCTGGTACGACCGTGATAGGCGGCGGTGTTGGTGCCATTGGCAAGATCAAG 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAACTTTCGACCATGCTGGCACTATCCGCCGCCACAACCACGGTAACCGTTCTAGTTC / / / / // / / /// // / / // / / BsrI | | | || | Tsp4CI* ||| |AciI | HgiCI* || | Hpy178III* | | | || McrI* ||| BaeI NlaIV || MboI | | | |Csp6I ||BisI |DpnI | | | RsaI ||AciI BstKTI | | CviJI |BlsI | | AluI TauI | SetI BslFI G L K A G T T V I G G G V G A I G K I K V * K L V R P * * A A V L V P L A R S R F E S W Y D R D R R R C W C H W Q D Q E ----:----|----:----|----:----|----:----|----:----|----:----| P K F A P V V T I P P P T P A M P L I L Q N S L Q Y S R S L R R H Q H W Q C S * T Q F S T R G H Y A A T N T G N A L D L TfiI HinfI | BccI Hpy166II | FatI | MaeI | BspHI | | TseI | |CviAII | | |BisI | |Hpy178III* | | ||BlsI BbvI | || NlaIII | | |||CviJI | MnlI | || | MboII \ \ \\\\ \ \ \ \\ \ \ AAAGGGGTATTCGGTGGACTAGGCAGCCTCACAAACCATAAGAAGAATCATGAGATGGGC 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCCCCATAAGCCACCTGATCCGTCGGAGTGTTTGGTATTCTTCTTAGTACTCTACCCG / / /// / / // /// | | ||CviJI | BbvI || ||MboII | | ||TseI MnlI || |BspHI | | |BisI || |FatI | | BlsI || Hpy178III* | MaeI || CviAII Hpy166II |BccI NlaIII HinfI TfiI K G V F G G L G S L T N H K K N H E M G K G Y S V D * A A S Q T I R R I M R W A R G I R W T R Q P H K P * E E S * D G R ----:----|----:----|----:----|----:----|----:----|----:----| F P T N P P S P L R V F W L F F * S I P S L P I R H V L C G * L G Y S S D H S P F P Y E T S * A A E C V M L L I M L H A DdeI | MboII | | MboII \ \ \ GAAGAAGAAACTAAGTTTTAG 3550 3560 ----:----|----:----|- CTTCTTCTTTGATTCAAAATC / // | |MboII | DdeI MboII E E E T K F * K K K L S F X R R N * V L X ----:----|----:----|- S S S V L N * R L L F * T K F F F S L K L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AciI 6 BspACI,SsiI AclI 2 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AgeI 2 AsiGI,BshTI,CspAI,PinAI AhaIII* 2 DraI AjuI 2 AluI 12 AluBI AlwNI 1 CaiI ApoI 13 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BaeI 2 BalI 2 MlsI,MluNI,MscI,Msp20I BarI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 5 BpiI,BpuAI,BstV2I,BbsI BccI 11 BceAI 1 BcgI 1 BciVI 1 BfuI BclI 3 FbaI,Ksp22I BdaI 6 BetI* 4 BsaWI BfiI 3 BmrI,BmuI BinI* 4 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 3 BsaAI 1 BstBAI,Ppu21I BsaXI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 10 BstF5I,BtsCI BseMII 2 BseRI 2 BseSI 1 BaeGI,BstSLI BseYI 1 BsgI 2 BsiYI* 8 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 2 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BsrDI 1 BseMI,Bse3DI BsrI 11 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstAPI 2 BstKTI 10 BtrI 1 BmgBI,AjiI BtsI 2 Cac8I 3 BstC8I Cfr10I 3 BsrFI,BssAI,Bse118I CfrI 3 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 11 CviQI,RsaNI CviAII 10 CviJI 35 CviKI-1 CviRI* 10 HpyCH4V DdeI 8 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 10 MalI DraIII 2 AdeI DrdI 1 AasI,DseDI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 3 EcoP15I 1 EcoRI 3 EcoRII 1 AjnI,Psp6I,PspGI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 10 FauI 1 SmuI FokI 10 GlaI 2 GsaI 1 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 7 BsnI,BsuRI,BshFI,PhoI HgiCI* 3 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 7 Hin4II* 16 HpyAV Hin6I 2 HinP1I,HspAI HindII 5 HincII HindIII 2 HinfI 14 HpaI 3 KspAI HpaII 6 HapII,BsiSI,MspI HphI 9 AsuHPI Hpy166II 11 Hpy8I Hpy178III* 13 Hpy188III Hpy188I 10 Hpy99I 1 KasI 1 KpnI 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 9 FspBI,BfaI,XspI MaeII 10 HpyCH4IV MaeIII 8 MboI 10 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 17 McrI* 2 BsiEI,BstMCI,Bsh1285I MfeI 4 MunI MlyI 2 SchI MmeI 3 MnlI 19 MroNI 1 NgoMIV MseI 25 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NaeI 1 PdiI NarI 1 Mly113I NlaIII 10 Hin1II,Hsp92II,FaeI NlaIV 10 BspLI,BmiI,PspN4I NspI 2 BstNSI,XceI PflMI 2 BasI,AccB7I,Van91I PleI 2 PpsI PsiI 2 AanI RsaI 11 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 1 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 46 SfaNI 5 LweI SfeI* 1 BstSFI,SfcI,BfmI SpeI 1 BcuI,AhlI SspI 1 StuI 1 Eco147I,PceI,SseBI,AatI StyI 3 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 10 TaqI 12 TatI 2 TauI 2 TfiI 12 PfeI TseI 1 ApeKI TsoI 5 Tsp45I 4 NmuCI Tsp4CI* 13 HpyCH4III,TaaI,Bst4CI TspDTI 10 TspEI 34 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 6 TscAI VspI 1 PshBI,AseI XcmI 2 XhoII 2 BstYI,MflI,PsuI,BstX2I XmaIII* 1 BstZI,EagI,EclXI,Eco52I,BseX3I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AccI AflII AlfI AloI ApaI ApaLI AscI AvaI BamHI BbvCI Bce83I* BglI BglII BmeT110I BmtI BplI Bpu10I BsaBI BsePI BsiI* Bsp120I Bsp1407I BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstEII BstXI BstZ17I BtgZI CauII* Cfr9I CspCI DraII DsaI* Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoRV EcoT22I Esp3I FnuDII* FseI FspAI HgaI HgiAI* HgiJII* MauBI MluI Mph1103I MstI* NcoI NdeI NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SexAI SfiI SgfI SgrAI SgrDI SmaI SmlI SnaBI SphI SplI* SrfI Sse232I* Sse8387I TaqII TspMI TstI Tth111I XbaI XhoI XmaCI XmaI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769