Restriction Map of SGO1/YOR073W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

SGO1/YOR073W on chromosome XV from coordinates 464771 to 466543.


TseI |BisI ||BlsI ||| Cac8I ||| | SplI* ||| | |Csp6I ||| | ||RsaI ||| | ||| BbvI ||| | ||| |Tsp4CI* TspEI ||| | ||| || BsmAI Ksp632I* | MboII ||| | ||| || Eco31I \ \ \ \\\ \ \\\ \\ \ ATGCCGAAGAGAAAAATTGCTCCTAACAAGGAAAGCAGCAGGCGTACGGTCTCCCACGAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGCTTCTCTTTTTAACGAGGATTGTTCCTTTCGTCGTCCGCATGCCAGAGGGTGCTA / // /// / /// / / Ksp632I* |TspEI ||| | ||| BbvI Eco31I MboII ||| | ||Tsp4CI* BsmAI ||| | ||SplI* ||| | |Csp6I ||| | RsaI ||| Cac8I ||TseI |BisI BlsI M P K R K I A P N K E S S R R T V S H D C R R E K L L L T R K A A G V R S P T M A E E K N C S * Q G K Q Q A Y G L P R * ----:----|----:----|----:----|----:----|----:----|----:----| X G F L F I A G L L S L L L R V T E W S X A S S F F Q E * C P F C C A Y P R G R H R L S F N S R V L F A A P T R D G V I Hin4I Hin4I | SetI | | MboI | | XhoII | | | DpnI | | | |BstKTI | | | ||Hpy178III* | | | |||TaqI | | | |||| TfiI MseI ApoI | | | |||| HinfI | EcoP15I TspEI | | | |||| |BinI* \ \ \ \ \ \ \\\\ \\ GATTTAACCCCACAAATACAAGAATTTCAAAACCTAATGGATCTCGAATCGCAAAAAGTG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAATTGGGGTGTTTATGTTCTTAAAGTTTTGGATTACCTAGAGCTTAGCGTTTTTCAC / / / / // / // // / | EcoP15I | SetI || | || |HinfI Hin4I MseI TspEI || | || |TfiI Hin4I Hin4I || | || BinI* Hin4I || | |TaqI ApoI || | Hpy178III* || XhoII || MboI |DpnI BstKTI D L T P Q I Q E F Q N L M D L E S Q K V I * P H K Y K N F K T * W I S N R K K W F N P T N T R I S K P N G S R I A K S G ----:----|----:----|----:----|----:----|----:----|----:----| S K V G C I C S N * F R I S R S D C F T H N L G V F V L I E F G L P D R I A F L I * G W L Y L F K L V * H I E F R L F H CfrI Cac8I | BalI EcoP15I | CviJI |Hpy188I | HaeIII Hin4I || Tsp4CI* | |StyI Hin4I || | MnlI TaqI | |SecI* \ \\ \ \ \ \ \\ GAAAACATCAGACAGTCGTATTCGAGGCAAAACTCCCTGCTGGCCAAGGATAACTCCATA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTGTAGTCTGTCAGCATAAGCTCCGTTTTGAGGGACGACCGGTTCCTATTGAGGTAT / / / / / / / / / | | | MnlI TaqI | | | SecI* | | Tsp4CI* | | | StyI | EcoP15I | | CfrI Hpy188I | HaeIII | CviJI | BalI Cac8I E N I R Q S Y S R Q N S L L A K D N S I K T S D S R I R G K T P C W P R I T P Y K H Q T V V F E A K L P A G Q G * L H I ----:----|----:----|----:----|----:----|----:----|----:----| S F M L C D Y E L C F E R S A L S L E M P F C * V T T N S A F S G A P W P Y S W F V D S L R I R P L V G Q Q G L I V G Y CviJI | Cac8I MlyI | | AluI PleI | | CviJI | MaeII | | PvuII | |MaeIII | | NspBII* | |Tsp45I MseI AluI | | | SetI | || SetI | TspEI CviJI | | | | Csp6I | || TaiI | | MseI MseI | SetI | | | | |RsaI | || |HinfI \ \ \ \ \ \ \ \ \ \ \\ \ \\ \\ TTAAAAATTAAAGTTAATAGCTTGGAAAAAAAAATAAGCCAGCTGGTACAAGAAAACGTG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTTTAATTTCAATTATCGAACCTTTTTTTTTATTCGGTCGACCATGTTCTTTTGCAC / // / / / / / / // // / MseI |MseI | | CviJI | | | |Csp6I || MaeII TspEI | | AluI | | | RsaI |TaiI | SetI | | NspBII* |SetI MseI | | PvuII |PleI | | CviJI MlyI | | AluI | Cac8I | SetI CviJI L K I K V N S L E K K I S Q L V Q E N V * K L K L I A W K K K * A S W Y K K T * K N * S * * L G K K N K P A G T R K R D ----:----|----:----|----:----|----:----|----:----|----:----| N F I L T L L K S F F I L W S T C S F T I L F * L * Y S P F F F L G A P V L F R * F N F N I A Q F F F Y A L Q Y L F V H MnlI | AluI MboI | CviJI | DpnI | | SetI Tsp4CI* | |BstKTI SetI | | | SfeI* | MseI \ \\ \ \ \ \ \ \ \ ACTCTACGATCTAAAACCTCTATAAGCGAAGCTATCTACAGGGAACGGTTAAGTAATCAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGATGCTAGATTTTGGAGATATTCGCTTCGATAGATGTCCCTTGCCAATTCATTAGTT // // / / / / / / / / || || | SetI | | CviJI SfeI* | MseI || || MboI | | AluI Tsp4CI* || |DpnI | SetI || BstKTI MnlI |HinfI Tsp45I MaeIII T L R S K T S I S E A I Y R E R L S N Q L Y D L K P L * A K L S T G N G * V I N S T I * N L Y K R S Y L Q G T V K * S T ----:----|----:----|----:----|----:----|----:----|----:----| V R R D L V E I L S A I * L S R N L L * S E V I * F R * L R L * R C P V T L Y D S * S R F G R Y A F S D V P F P * T I L ApoI Tsp4CI* TspEI \ \ CTACAAGTCATTGAAAACGGTATTATTCAAAGATTTGACGAAATTTTTTATATGTTTGAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GATGTTCAGTAACTTTTGCCATAATAAGTTTCTAAACTGCTTTAAAAAATATACAAACTC / / Tsp4CI* TspEI ApoI L Q V I E N G I I Q R F D E I F Y M F E Y K S L K T V L F K D L T K F F I C L R T S H * K R Y Y S K I * R N F L Y V * E ----:----|----:----|----:----|----:----|----:----|----:----| S C T M S F P I I * L N S S I K * I N S V V L * Q F R Y * E F I Q R F K K Y T Q * L D N F V T N N L S K V F N K I H K L MaeII |SplI* ||Csp6I |||RsaI |||SetI TaqI |||TaiI | AluI ||||MaeII | CviJI |||||BsaAI | |SmlI |||||SnaBI ApoI | |AflII |||||| SetI TspEI | ||MseI PpiI |||||| TaiI | BfiI BsrI | ||SetI |Ksp632I* XmnI \\\\\\ \ \ \ \ \ \\\ \\ \ AACGTACGTAAAAACGAAAATTTGCCCAGTTCGAGCTTAAGAACAATGTTGAAGAGAACG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCATGCATTTTTGCTTTTAAACGGGTCAAGCTCGAATTCTTGTTACAACTTCTCTTGC / ///// / / / / / // / / | ||||MaeII | | BsrI | | |AflII Ksp632I* XmnI | |||SplI* | TspEI | | |SmlI | |||SnaBI | ApoI | | |PpiI | |||BsaAI BfiI | | MseI | ||Csp6I | CviJI | |RsaI | AluI | |TaiI TaqI | |SetI SetI | MaeII TaiI SetI N V R K N E N L P S S S L R T M L K R T T Y V K T K I C P V R A * E Q C * R E R R T * K R K F A Q F E L K N N V E E N E ----:----|----:----|----:----|----:----|----:----|----:----| F T R L F S F K G L E L K L V I N F L V S R V Y F R F N A W N S S L F L T S S F V Y T F V F I Q G T R A * S C H Q L S R MboII |BssKI |EcoRII || ScrFI || BseBI || | SetI || | |Hpy178III* || | || MboI || | || | DpnI || | || | |FatI || | || | |BstKTI || | || | ||PpiI || | || | ||CviAII || | || | ||| NlaIII TaqII || | || | ||| | HphI |MaeIII MaeI \\ \ \\ \ \\\ \ \ \\ \ AGTTCCAGGTCAAGATCATGCTCATTGTCATCACCCACATACTCAAAAAGTTACACTAGG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAGGTCCAGTTCTAGTACGAGTAACAGTAGTGGGTGTATGAGTTTTTCAATGTGATCC / // / ////// // / / / // | || | |||||| || HphI TaqII | |MaeI | || | |||||| |FatI | SetI | || | |||||| CviAII MaeIII | || | |||||MboI | || | ||||NlaIII | || | |||DpnI | || | ||BstKTI | || | |Hpy178III* | || | PpiI | || EcoRII | || BssKI | |BseBI | |ScrFI | SetI MboII S S R S R S C S L S S P T Y S K S Y T R V P G Q D H A H C H H P H T Q K V T L G F Q V K I M L I V I T H I L K K L H * V ----:----|----:----|----:----|----:----|----:----|----:----| L E L D L D H E N D D G V Y E F L * V L S N W T L I M S M T M V W M S L F N C * T G P * S * A * Q * * G C V * F T V S P PshAI | AsuI* SetI | AvaII | FatI | |BmgT120I | |CviAII | || Hpy178III* | || TfiI MseI | || | MboI BsiI* | || HinfI | TspDTI | || | BglII SetI Hpy178III* | || NlaIII | | BccI | || | XhoII \ \ \ \\ \ \ \ \ \ \\ \ \ TTATCAAATCACGAGAATAACCTGTCGCATGAATCAAGTTTTAACAAGGACGATGGTCCA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AATAGTTTAGTGCTCTTATTGGACAGCGTACTTAGTTCAAAATTGTTCCTGCTACCAGGT / / / / // / // / / // / | | SetI | || HinfI || BccI | || Hpy178III* | BsiI* | || TfiI |MseI | |AvaII Hpy178III* | |FatI TspDTI | |AsuI* | CviAII | BmgT120I NlaIII PshAI L S N H E N N L S H E S S F N K D D G P Y Q I T R I T C R M N Q V L T R T M V Q I K S R E * P V A * I K F * Q G R W S R ----:----|----:----|----:----|----:----|----:----|----:----| N D F * S F L R D C S D L K L L S S P G T I L D R S Y G T A H I L N * C P R H D * * I V L I V Q R M F * T K V L V I T W DpnI |BstKTI ||SmlI MaeI ||Hpy178III* | AciI ||| CviJI | MboII ||| | DdeI | |BisI ||| | SauI* Ksp632I* | ||BlsI ||| | | CviJI | Bce83I* | |||TauI BsiI* \\\ \ \ \ \ \ \ \\\\ \ GATCTTGAGCCTAAGGCTAAAAAAAGGAAGAGTTCTAGGCGGCAATCTATGTTTGTATCC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGAACTCGGATTCCGATTTTTTTCCTTCTCAAGATCCGCCGTTAGATACAAACATAGG // / / // / / / / ///// || | | || | CviJI | Ksp632I* ||||BisI || | | || SauI* Bce83I* ||||AciI || | | || DdeI |||BlsI || | | |CviJI ||TauI || | | SmlI |MboII || | Hpy178III* MaeI || XhoII || BglII || MboI |DpnI BstKTI D L E P K A K K R K S S R R Q S M F V S I L S L R L K K G R V L G G N L C L Y P S * A * G * K K E E F * A A I Y V C I H ----:----|----:----|----:----|----:----|----:----|----:----| S R S G L A L F L F L E L R C D I N T D L D Q A * P * F F S S N * A A I * T Q I I K L R L S F F P L T R P P L R H K Y G Eco57I Eco57MI | BccI BbvII* | |HphI | AgeI | ||FatI | BetI* | |||CviAII | Cfr10I | |||| NlaIII | |HpaII | |||| | ApoI MnlI BciVI SetI | || MboII | |||| | TspEI | SfeI* \ \ \ \\ \ \ \\\\ \ \ \ \ ACGAGTTTAGAACCTGAAGACGAAACCGGTGAAAACGAACCCATGATGGAAAATTCCTCT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTCAAATCTTGGACTTCTGCTTTGGCCACTTTTGCTTGGGTACTACCTTTTAAGGAGA // / /// / /// // // |BciVI SetI ||| | ||| |FatI |MnlI BsiI* ||| | ||| CviAII TspEI ||| | ||NlaIII ApoI ||| | |BccI ||| | HphI ||| Eco57MI ||| Eco57I ||Cfr10I ||BetI* ||AgeI |HpaII BbvII* MboII T S L E P E D E T G E N E P M M E N S S R V * N L K T K P V K T N P * W K I P L E F R T * R R N R * K R T H D G K F L C ----:----|----:----|----:----|----:----|----:----|----:----| V L K S G S S S V P S F S G M I S F E E W S N L V Q L R F R H F R V W S P F N R R T * F R F V F G T F V F G H H F I G R MnlI Acc65I HgiCI* |Csp6I Hin6I ||RsaI |GlaI ||SetI |MstI* ||NlaIV ||MnlI |||Cfr10I ||HhaI ||||KpnI TfiI BsiI* ||PleI ||||HpaII HinfI | HinfI |||MlyI SfaNI MseI \\\\\ \ \ \ \\\\ \ \ GTAGAGGTACCGGCAGAATCACACGAGTCTGCGCAAGTGGAGGAAACAATAGATGCCTTA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CATCTCCATGGCCGTCTTAGTGTGCTCAGACGCGTTCACCTCCTTTGTTATCTACGGAAT //// /// // / / / //// / / |||| ||| || HinfI | | |||PleI SfaNI MseI |||| ||| || TfiI | | |||MlyI |||| ||| |Cfr10I | | ||Hin6I |||| ||| HpaII | | |MstI* |||| ||HgiCI* | | |GlaI |||| ||Acc65I | | |MnlI |||| |Csp6I | | HhaI |||| NlaIV | HinfI |||| RsaI BsiI* |||KpnI ||MnlI |SetI SfeI* V E V P A E S H E S A Q V E E T I D A L * R Y R Q N H T S L R K W R K Q * M P * R G T G R I T R V C A S G G N N R C L K ----:----|----:----|----:----|----:----|----:----|----:----| T S T G A S D C S D A C T S S V I S A K Q L P V P L I V R T Q A L P P F L L H R Y L Y R C F * V L R R L H L F C Y I G * MboII | TfiI | HinfI | | Eco57I Ksp632I* | | Eco57MI TspEI |MnlI BsiYI* | | | TspEI | TspEI \\ \ \ \ \ \ \ \ AACCCTGAAGAGGAAAATAGCGATTCTGTCAGTAATTTTACCAATTCAATTATAGAATAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGGACTTCTCCTTTTATCGCTAAGACAGTCATTAAAATGGTTAAGTTAATATCTTATG / // / // / / / | |BsiYI* MboII |HinfI TspEI | TspEI | Ksp632I* |TfiI TspEI MnlI Eco57MI Eco57I N P E E E N S D S V S N F T N S I I E Y T L K R K I A I L S V I L P I Q L * N T P * R G K * R F C Q * F Y Q F N Y R I L ----:----|----:----|----:----|----:----|----:----|----:----| F G S S S F L S E T L L K V L E I I S Y L G Q L P F Y R N Q * Y N * W N L * L I V R F L F I A I R D T I K G I * N Y F V TfiI HinfI | Hpy188I | | Hin4I | | | BseRI | | | |TspDTI | | | || AvaI | | | || |BmeT110I | | | || || MboII Hin4I MnlI | | | || || |BsmI MmeI MaeI | SspI \ \ \ \ \\ \\ \\ \ \ \ \ TCCATACCAGAGGAGAATCCGACAGAACCCGAGCATTCATCTTCTAAACTAGAAATATTC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTATGGTCTCCTCTTAGGCTGTCTTGGGCTCGTAAGTAGAAGATTTGATCTTTATAAG / /// // // / / / / MnlI ||| |TspDTI |AvaI MmeI | MaeI SspI ||| BseRI BmeT110I Hin4I ||Hpy188I MboII |HinfI BsmI |TfiI Hin4I S I P E E N P T E P E H S S S K L E I F P Y Q R R I R Q N P S I H L L N * K Y S H T R G E S D R T R A F I F * T R N I Q ----:----|----:----|----:----|----:----|----:----|----:----| E M G S S F G V S G S C E D E L S S I N S W V L P S D S L V R A N M K * V L F I G Y W L L I R C F G L M * R R F * F Y E BceAI | DdeI | | TatI EcoNI | | |Csp6I |BssKI TatI | | ||RsaI |EcoRII Tsp4CI* | | ||| Tsp4CI* ||BsiYI* |Csp6I | | ||| | BceAI |||ScrFI ||RsaI | | ||| | | TspRI FokI |||BseBI \\\ \ \ \\\ \ \ \ \ \\\\ AATGACAGTACAAATATGCTAAGTACAGTGCCGTCAAATCCTTTGCCGTTGCCTTTACCA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTGTCATGTTTATACGATTCATGTCACGGCAGTTTAGGAAACGGCAACGGAAATGGT / /// / ///// / / / / | ||TatI | ||||| BceAI | | BseBI | |Csp6I | ||||Tsp4CI* | | ScrFI | RsaI | ||||TatI | EcoNI Tsp4CI* | |||Csp6I BsiYI* | ||RsaI FokI | |TspRI | DdeI BceAI N D S T N M L S T V P S N P L P L P L P M T V Q I C * V Q C R Q I L C R C L Y Q * Q Y K Y A K Y S A V K S F A V A F T R ----:----|----:----|----:----|----:----|----:----|----:----| L S L V F I S L V T G D F G K G N G K G * H C Y L Y A L Y L A T L D K A T A K V I V T C I H * T C H R * I R Q R Q R * W AsuI* |CviJI |HaeIII |BmgT120I || BseGI SetI TspDTI || | AciI | SfaNI |Tsp4CI* || | | BccI | | MaeI || BtgZI MboII \\ \ \ \ \ \ \ \\ \ \ GGCCCATCCGCAACTTTACCTACTACCACTAGCGATGCTTCAACGGTCTATCCTTCATCA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CCGGGTAGGCGTTGAAATGGATGATGGTGATCGCTACGAAGTTGCCAGATAGGAAGTAGT /// / / / / / / / / / ||AsuI* | | SetI | MaeI | | | MboII || | BccI SfaNI | | BtgZI || AciI | Tsp4CI* |BmgT120I TspDTI EcoRII HaeIII BssKI CviJI BseGI G P S A T L P T T T S D A S T V Y P S S A H P Q L Y L L P L A M L Q R S I L H Q P I R N F T Y Y H * R C F N G L S F I K ----:----|----:----|----:----|----:----|----:----|----:----| P G D A V K G V V V L S A E V T * G E D L G M R L K V * * W * R H K L P R D K M A W G C S * R S G S A I S * R D I R * * FatI |CviAII || NlaIII || | CviJI || | |AciI || | |BisI || | ||BlsI || | |||TauI || | ||||StyI TspEI || | ||||AvrII Hin4II* | MseI || | ||||SecI* | FokI TspEI BseGI | | BsmI || | |||||MaeI \ \ \ \ \ \ \ \\ \ \\\\\\ AGTTCTTCTACTAATTCTCATCCAAAGACCAAAATTAAGCATTCCATGAAGCCGCCTAGG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAGAAGATGATTAAGAGTAGGTTTCTGGTTTTAATTCGTAAGGTACTTCGGCGGATCC / / / // / // //// // Hin4II* FokI TspEI |MseI | || |||| |TspDTI BseGI |BsmI | || |||| |SecI* TspEI | || |||| |AvrII | || |||| |StyI | || |||| MaeI | || |||AciI | || ||BisI | || |BlsI | || CviJI | || TauI | |FatI | CviAII NlaIII S S S T N S H P K T K I K H S M K P P R V L L L I L I Q R P K L S I P * S R L G F F Y * F S S K D Q N * A F H E A A * D ----:----|----:----|----:----|----:----|----:----|----:----| L E E V L E * G F V L I L C E M F G G L L N K * * N E D L S W F * A N W S A A * T R R S I R M W L G F N L M G H L R R P MaeIII | FatI Eco57I | |CviAII Tth111I | || NlaIII Eco57MI | || | TseI | FatI | || | |BisI SetI | |CviAII | || | ||BlsI TspDTI |MboII | || NlaIII | || | ||| MwoI \ \\ \ \\ \ \ \\ \ \\\ \ ATAGAACTGAAGAAAAAGGTTATTGACGAAGTCATGCCCGTAAGTAACATGAGCAGCAAC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TATCTTGACTTCTTTTTCCAATAACTGCTTCAGTACGGGCATTCATTGTACTCGTCGTTG / / / / / // // // /// | MboII | | | |FatI || || ||MwoI SetI | | | CviAII || || ||TseI | | NlaIII || || |BisI | Tth111I || || BlsI Eco57MI || |FatI Eco57I || CviAII |MaeIII NlaIII I E L K K K V I D E V M P V S N M S S N * N * R K R L L T K S C P * V T * A A T R T E E K G Y * R S H A R K * H E Q Q Q ----:----|----:----|----:----|----:----|----:----|----:----| I S S F F F T I S S T M G T L L M L L L S L V S S F P * Q R L * A R L Y C S C C Y F Q L F L N N V F D H G Y T V H A A V MboII | AluI | CviJI | |SfeI* BbvI MaeI BsiI* | ||SetI \ \ \ \ \\\ AGCGAAATATCATTTACGAGAACTAGAAGAACTCGTGGTAAAGCTGTAGATTACACTTTG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCTTTATAGTAAATGCTCTTGATCTTCTTGAGCACCATTTCGACATCTAATGTGAAAC / / // / / / BbvI MaeI || | | SfeI* || | CviJI || | AluI || SetI |MboII BsiI* S E I S F T R T R R T R G K A V D Y T L A K Y H L R E L E E L V V K L * I T L C R N I I Y E N * K N S W * S C R L H F A ----:----|----:----|----:----|----:----|----:----|----:----| L S I D N V L V L L V R P L A T S * V K C R F I M * S F * F F E H Y L Q L N C K A F Y * K R S S S S S T T F S Y I V S Q MseI | Hin4II* StuI | | CviJI CviJI | | |MnlI HaeIII | | |Eco57I | Hpy188I | | |Eco57MI | | SfaNI | | || MnlI | | BseRI Tsp4CI* | | || | BsiYI* | | | Hin4II* BseGI |FokI \ \ \\ \ \ \ \ \ \ \ \\ CCTTCTTTAAGAGCCAAAATGAGGAGGCCTTCAGAAAAACTTGTGGATGCTACTACTGTG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAGAAATTCTCGGTTTTACTCCTCCGGAAGTCTTTTTGAACACCTACGATGATGACAC // // // / / / / / / / || || |BsiYI* | | | | SfaNI BseGI Tsp4CI* || || MnlI | | | Hin4II* || |CviJI | | BseRI || |MnlI | Hpy188I || Eco57MI HaeIII || Eco57I CviJI |Hin4II* StuI MseI P S L R A K M R R P S E K L V D A T T V L L * E P K * G G L Q K N L W M L L L * F F K S Q N E E A F R K T C G C Y Y C D ----:----|----:----|----:----|----:----|----:----|----:----| G E K L A L I L L G E S F S T S A V V T A K K L L W F S S A K L F V Q P H * * Q R R * S G F H P P R * F F K H I S S S H FatI |CviAII || MboI || |NlaIII || ||DpnI || |||BstKTI || ||||SfeI* SetI Hpy178III* \\ \\\\\ \ \ ATTGATATACATGATCTACAGGTTTCCAAGAGAAATCGGGAAACTTCACATAAAAGGAAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTATATGTACTAGATGTCCAAAGGTTCTCTTTAGCCCTTTGAAGTGTATTTTCCTTT / / /// / // / FokI | ||| | |SfeI* Hpy178III* | ||| | SetI | ||| MboI | ||DpnI | |BstKTI | |FatI | CviAII NlaIII I D I H D L Q V S K R N R E T S H K R K L I Y M I Y R F P R E I G K L H I K G K * Y T * S T G F Q E K S G N F T * K E K ----:----|----:----|----:----|----:----|----:----|----:----| I S I C S R C T E L L F R S V E C L L F S Q Y V H D V P K W S F D P F K V Y F S N I Y M I * L N G L S I P F S * M F P F Hpy99I | AciI | |Hin4I Hpy99I TfiI | || MfeI | BsmAI HinfI | || TspEI | Esp3I \ \ \\ \ \ \ AGTTTATCCCAAGATTCAATACCCGACGAACCGCAATTGAGAGAAGTCGTCGTCTCAAAG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAATAGGGTTCTAAGTTATGGGCTGCTTGGCGTTAACTCTCTTCAGCAGCAGAGTTTC / / / / / / / HinfI | Hin4I AciI TspEI Hpy99I Hin4I TfiI Hpy99I MfeI S L S Q D S I P D E P Q L R E V V V S K V Y P K I Q Y P T N R N * E K S S S Q R F I P R F N T R R T A I E R S R R L K G ----:----|----:----|----:----|----:----|----:----|----:----| L K D W S E I G S S G C N L S T T T E F F N I G L N L V R R V A I S L L R R R L T * G L I * Y G V F R L Q S F D D D * L MnlI | BciVI TspDTI | |BsiI* | AciI | |MboII | | BarI Hin4I BarI | |TspGWI | | BsrBI \ \ \ \\ \ \ \ GATTATGGAACTCCAAAAGGGAAAAAAACGGAAGATGAAATACACGAGGATACCGCTCAT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTAATACCTTGAGGTTTTCCCTTTTTTTGCCTTCTACTTTATGTGCTCCTATGGCGAGTA / / / // // / / Esp3I BarI | || || BarI BsrBI BsmAI | || |TspDTI AciI | || BsiI* | |MboII | TspGWI | BciVI MnlI D Y G T P K G K K T E D E I H E D T A H I M E L Q K G K K R K M K Y T R I P L I L W N S K R E K N G R * N T R G Y R S S ----:----|----:----|----:----|----:----|----:----|----:----| S * P V G F P F F V S S S I C S S V A * P N H F E L L S F F P L H F V R P Y R E I I S S W F P F F R F I F Y V L I G S M MmeI MaeI \ \ CTAATGACCACTTCCAACAACAACAGCAACAACAAAAACGAAAAAAAACTAACTAGCAAC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GATTACTGGTGAAGGTTGTTGTTGTCGTTGTTGTTTTTGCTTTTTTTTGATTGATCGTTG / / / MmeI | MwoI MaeI L M T T S N N N S N N K N E K K L T S N * * P L P T T T A T T K T K K N * L A T N D H F Q Q Q Q Q Q Q K R K K T N * Q Q ----:----|----:----|----:----|----:----|----:----|----:----| R I V V E L L L L L L L F S F F S V L L D L S W K W C C C C C C F R F F V L * C * H G S G V V V A V V F V F F F * S A V MwoI | CviJI Hpy99I Hpy188I \ \ \ \ AATAGCCCTAAAAAATCGTCGCCTTTACTTGACATTACAAATAAATCGGAGAATAAGAAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCGGGATTTTTTAGCAGCGGAAATGAACTGTAATGTTTATTTAGCCTCTTATTCTTT / / / CviJI Hpy99I Hpy188I N S P K K S S P L L D I T N K S E N K K I A L K N R R L Y L T L Q I N R R I R K * P * K I V A F T * H Y K * I G E * E K ----:----|----:----|----:----|----:----|----:----|----:----| L L G L F D D G K S S M V F L D S F L F C Y G * F I T A K V Q C * L Y I P S Y S I A R F F R R R * K V N C I F R L I L F CviRI* Hpy188I HindII |MfeI | ApoI Hpy166II TspEI |TspEI TspEI | TspEI \ \ \\ \ \ \ AAGTCAACAAGAACTAAAAAATTGTTCAAAAATGCAATTGTCAATAATTTATCTGATGAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGTTGTTCTTGATTTTTTAACAAGTTTTTACGTTAACAGTTATTAAATAGACTACTT / / / / / / Hpy166II TspEI | TspEI | Hpy188I HindII | MfeI TspEI CviRI* K S T R T K K L F K N A I V N N L S D E S Q Q E L K N C S K M Q L S I I Y L M K V N K N * K I V Q K C N C Q * F I * * K ----:----|----:----|----:----|----:----|----:----|----:----| F D V L V L F N N L F A I T L L K D S S F T L L F * F I T * F H L Q * Y N I Q H L * C S S F F Q E F I C N D I I * R I F TspDTI NlaIV |FnuDII* MnlI | BsrI TspEI \\ \ \ \ \ AATTCTACTACGCGACCCTCCAAGTCGTCAAAGGGAACCAGTAATAATAACAACAATTAC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGATGATGCGCTGGGAGGTTCAGCAGTTTCCCTTGGTCATTATTATTGTTGTTAATG / / / / / / | | FnuDII* MnlI NlaIV TspEI | TspDTI BsrI TspEI ApoI N S T T R P S K S S K G T S N N N N N Y I L L R D P P S R Q R E P V I I T T I T F Y Y A T L Q V V K G N Q * * * Q Q L Q ----:----|----:----|----:----|----:----|----:----|----:----| F E V V R G E L D D F P V L L L L L L * F N * * A V R W T T L P F W Y Y Y C C N I R S R S G G L R * L S G T I I V V I V AluI TspEI MseI CviJI | TaqI TspEI VspI MseI | SetI \ \ \ \ \ \ \ AACAATTTCGACAATAACAATTCAAACATTAATAATGTTAATAATAAATCTGTTAGCTTT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTAAAGCTGTTATTGTTAAGTTTGTAATTATTACAATTATTATTTAGACAATCGAAA / / / / / / / | TaqI TspEI VspI MseI | CviJI TspEI MseI | AluI SetI N N F D N N N S N I N N V N N K S V S F T I S T I T I Q T L I M L I I N L L A L Q F R Q * Q F K H * * C * * * I C * L * ----:----|----:----|----:----|----:----|----:----|----:----| L L K S L L L E F M L L T L L L D T L K C C N R C Y C N L C * Y H * Y Y I Q * S V I E V I V I * V N I I N I I F R N A K MboII BtsI |TspDTI TspRI \\ \ AGACTAAATGAAGATGATTTAGCAGTATTTGATTTATTTGGAAATGGTAAGGCAGTGAAA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGATTTACTTCTACTAAATCGTCATAAACTAAATAAACCTTTACCATTCCGTCACTTT / / / TspDTI TspRI BtsI MboII R L N E D D L A V F D L F G N G K A V K D * M K M I * Q Y L I Y L E M V R Q * N T K * R * F S S I * F I W K W * G S E T ----:----|----:----|----:----|----:----|----:----|----:----| L S F S S S K A T N S K N P F P L A T F * V L H L H N L L I Q N I Q F H Y P L S S * I F I I * C Y K I * K S I T L C H F CATCAACCAAAAACATATCGCACCAAAAAATGA 1750 1760 1770 ----:----|----:----|----:----|--- GTAGTTGGTTTTTGTATAGCGTGGTTTTTTACT H Q P K T Y R T K K * I N Q K H I A P K N X S T K N I S H Q K M X ----:----|----:----|----:----|--- C * G F V Y R V L F H V D V L F M D C W F I M L W F C I A G F F S # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AciI 5 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AgeI 1 AsiGI,BshTI,CspAI,PinAI AluI 6 AluBI ApoI 5 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BalI 1 MlsI,MluNI,MscI,Msp20I BarI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 1 BpuEI BceAI 2 BciVI 2 BfuI BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmeT110I 1 BmgT120I 2 BsaAI 1 BstBAI,Ppu21I BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseRI 2 BsiI* 5 BssSI,Bst2BI,BauI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BsmAI 2 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BsrBI 1 AccBSI,MbiI BsrI 2 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 5 BtgZI 1 BtsI 1 Cac8I 3 BstC8I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 6 CviQI,RsaNI CviAII 7 CviJI 15 CviKI-1 CviRI* 1 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 5 MalI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 4 AcuI Eco57MI 4 EcoNI 1 BstENI,XagI EcoP15I 2 EcoRII 2 AjnI,Psp6I,PspGI Esp3I 1 BsmBI FatI 7 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 1 HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 4 Hin4II* 3 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HinfI 8 HpaII 2 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 5 Hpy99I 3 KpnI 1 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 7 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 3 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 11 MfeI 2 MunI MlyI 2 SchI MmeI 2 MnlI 11 MseI 12 Tru1I,Tru9I MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 2 HpyF10VI,BstMWI NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PleI 2 PpsI PpiI 1 PshAI 1 BstPAI,BoxI PvuII 1 RsaI 6 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 2 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 19 SfaNI 3 LweI SfeI* 4 BstSFI,SfcI,BfmI SmlI 2 SmoI SnaBI 1 Eco105I,BstSNI SplI* 2 Pfl23II,PspLI,BsiWI SspI 1 StuI 1 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 4 TaqII 1 TatI 2 TauI 2 TfiI 6 PfeI TseI 2 ApeKI Tsp45I 1 NmuCI Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 19 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 2 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 1 PshBI,AseI XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AccI AclI AcyI AflIII AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI AsuII BaeI BamHI BbvCI BcgI BclI BdaI BglI BmtI BplI Bpu10I BsaBI BsaXI BseMII BsePI BseSI BseYI BsgI BslFI BsmFI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrDI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtrI CauII* Cfr9I ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco47III EcoICRI EcoRI EcoRV EcoT22I EgeI EheI EspI* FalI FaqI FauI FseI FspAI GsaI GsuI HaeII HgaI HgiAI* HgiJII* HindIII HpaI KasI MauBI McrI* MluI Mph1103I MroNI MslI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpuMI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SapI ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SphI SrfI Sse232I* Sse8387I SwaI TsoI TspMI TstI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769