Restriction Map of HST3/YOR025W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

HST3/YOR025W on chromosome XV from coordinates 378219 to 379562.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.4135

SetI MnlI | BsrI | | TaqI | | AarI | | BspMI | | |MboI | | || DpnI | | || |PvuI | | || |McrI* | | || |BstKTI | | || || CviJI | | || || | SduI | | || || | HgiJII* SduI | | || || | | Hin4I HgiAI* | | || || | | Hin4I | Hpy188I | | || || | | |MwoI | | Eam1105I \ \ \\ \\ \ \ \\ \ \ \ ATGACTTCAGTATCGCCCTCGCCACCTGCCAGTCGATCGGGCTCAATGTGCTCCGACTTA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGAAGTCATAGCGGGAGCGGTGGACGGTCAGCTAGCCCGAGTTACACGAGGCTGAAT / // ///// / / / / / | |BsrI ||||| | | | | Eam1105I | MnlI ||||| | | | Hpy188I SetI ||||| | | HgiAI* ||||| | | SduI ||||| | MwoI ||||| CviJI ||||| Hin4I ||||| Hin4I ||||HgiJII* ||||SduI |||MboI ||BspMI ||AarI |DpnI BstKTI McrI* TaqI PvuI M T S V S P S P P A S R S G S M C S D L * L Q Y R P R H L P V D R A Q C A P T Y D F S I A L A T C Q S I G L N V L R L T ----:----|----:----|----:----|----:----|----:----|----:----| X V E T D G E G G A L R D P E I H E S K X S K L I A R A V Q W D I P S L T S R S H S * Y R G R W R G T S R A * H A G V * Tsp4CI* | BseMII | |BspCNI | || CviRI* | || | MnlI | || | | DdeI | || | | MmeI | || | | |Hin4I SetI | || | | |Hin4I BsrI SfaNI |Hpy178III* Hpy99I \ \\ \ \ \\ \ \ \\ \ CCGTCCTCTTTGCAGACTGAGAAACTGGCACATATTATAGGTCTTGATGCCGACGATGAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GGCAGGAGAAACGTCTGACTCTTTGACCGTGTATAATATCCAGAACTACGGCTGCTACTT / // //// / / / / / / | || |||MmeI DdeI BsrI | | | Hpy99I | || ||MnlI | | Hpy178III* | || |Hin4I | SfaNI | || |Hin4I SetI | || CviRI* | |BspCNI | BseMII Tsp4CI* P S S L Q T E K L A H I I G L D A D D E R P L C R L R N W H I L * V L M P T M K V L F A D * E T G T Y Y R S * C R R * S ----:----|----:----|----:----|----:----|----:----|----:----| G D E K C V S F S A C I I P R S A S S S V T R K A S Q S V P V Y * L D Q H R R H R G R Q L S L F Q C M N Y T K I G V I F HpaII TsoI | Hin6I |MboI | |GlaI |BglII | ||HhaI |XhoII | ||TspDTI || DpnI BcgI | ||FnuDII* || |BstKTI | Hpy188I | |||MaeIII || ||MaeI TspEI | | BsrI \ \\\\ \\ \\\ \ \ \ \ GTTCTCCGGCGCGTAACCAAGCAGTTGAGCAGATCTAGGAGAATTGCTTGTCTGACTGGG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGAGGCCGCGCATTGGTTCGTCAACTCGTCTAGATCCTCTTAACGAACAGACTGACCC //// / / // / / / / / / |||| MaeIII | || | MaeI | | | BsrI |||FnuDII* | || XhoII | | Hpy188I |||Hin6I | || BglII | BcgI ||GlaI | || MboI TspEI |TspDTI | |DpnI |HhaI | BstKTI HpaII TsoI V L R R V T K Q L S R S R R I A C L T G F S G A * P S S * A D L G E L L V * L G S P A R N Q A V E Q I * E N C L S D W G ----:----|----:----|----:----|----:----|----:----|----:----| T R R R T V L C N L L D L L I A Q R V P L E G A R L W A T S C I * S F Q K D S Q N E P A Y G L L Q A S R P S N S T Q S P MwoI BstAPI |FauI || CviRI* || | AciI || | FnuDII* || | |MwoI SapI || | ||Cac8I Hpy188I || | |||Hin4I Ksp632I* || | ||||BsmI | CviJI || | |||||BcgI | | SduI Cac8I || | |||||| Hpy178III* | | HgiJII* | BfiI || | |||||| | MboII BccI | | |Hin4I \ \ \\ \ \\\\\\ \ \ \ \ \ \\ GCAGGCATTTCGTGCAACGCGGGCATTCCTGACTTTCGCTCTTCTGATGGGCTCTACGAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCCGTAAAGCACGTTGCGCCCGTAAGGACTGAAAGCGAGAAGACTACCCGAGATGCTG // / / / / // // / / // / / || | | | | |BcgI |MboII | | || CviJI SetI || | | | | Cac8I Hpy178III* | | |HgiJII* || | | | | AciI | | |Hin4I || | | | | BsmI | | |SduI || | | | FnuDII* | | Ksp632I* || | | Hin4I | | SapI || | | MwoI | Hpy188I || | CviRI* BccI || | FauI || BstAPI || MwoI |BfiI Cac8I A G I S C N A G I P D F R S S D G L Y D Q A F R A T R A F L T F A L L M G S T T R H F V Q R G H S * L S L F * W A L R P ----:----|----:----|----:----|----:----|----:----|----:----| A P M E H L A P M G S K R E E S P S * S P L C K T C R P C E Q S E S K Q H A R R C A N R A V R A N R V K A R R I P E V V MaeI Hpy166II |SetI | Tsp4CI* HpaII \\ \ \ \ CTAGTGAAAAAGGATTGTTCACAGTATTGGTCTATCAAGTCCGGCAGGGAAATGTTTGAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GATCACTTTTTCCTAACAAGTGTCATAACCAGATAGTTCAGGCCGTCCCTTTACAAACTA / / / / MaeI | Tsp4CI* HpaII Hpy166II L V K K D C S Q Y W S I K S G R E M F D * * K R I V H S I G L S S P A G K C L I S E K G L F T V L V Y Q V R Q G N V * Y ----:----|----:----|----:----|----:----|----:----|----:----| R T F F S Q E C Y Q D I L D P L S I N S G L S F P N N V T N T * * T R C P F T Q * H F L I T * L I P R D L G A P F H K I ApoI TspEI | MnlI CviJI \ \ \ ATTTCGCTATTTAGAGATGACTTCAAAATATCCATTTTTGCTAAATTTATGGAGAGGCTC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGCGATAAATCTCTACTGAAGTTTTATAGGTAAAAACGATTTAAATACCTCTCCGAG // / |TspEI CviJI |ApoI MnlI I S L F R D D F K I S I F A K F M E R L F R Y L E M T S K Y P F L L N L W R G S F A I * R * L Q N I H F C * I Y G E A L ----:----|----:----|----:----|----:----|----:----|----:----| I E S N L S S K L I D M K A L N I S L S Y K A I * L H S * F I W K Q * I * P S A N R * K S I V E F Y G N K S F K H L P E HgaI | BsrDI | |EcoP15I | || Hin6I CviJI | || |GlaI MfeI | DdeI | || |MstI* TspEI | | TspDTI | || ||HhaI SfaNI \ \ \ \ \ \\ \\\ \ TATTCAAATGTTCAATTGGCAAAGCCGACTAAGACGCACAAGTTCATTGCGCATCTAAAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAGTTTACAAGTTAACCGTTTCGGCTGATTCTGCGTGTTCAAGTAACGCGTAGATTTT / / // / / /// TspEI CviJI |DdeI | | ||Hin6I MfeI TspDTI | | |MstI* | | |GlaI | | HhaI | EcoP15I | HgaI BsrDI Y S N V Q L A K P T K T H K F I A H L K I Q M F N W Q S R L R R T S S L R I * K F K C S I G K A D * D A Q V H C A S K R ----:----|----:----|----:----|----:----|----:----|----:----| * E F T * N A F G V L V C L N M A C R F R N L H E I P L A S * S A C T * Q A D L I * I N L Q C L R S L R V L E N R M * F TseI |BisI ||BlsI |||Hin6I CviJI ||||GlaI BccI | TaqI |||||HhaI | TaqI | SduI BbvI |||||| MaeIII | ClaI | HgiJII* \ \\\\\\ \ \ \ \ \ GATAGGAACAAACTGCTGCGCTGTTACACGCAAAACATCGATGGGCTCGAAGAAAGCATA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTATCCTTGTTTGACGACGCGACAATGTGCGTTTTGTAGCTACCCGAGCTTCTTTCGTAT / / ///// / / / / / / / | BbvI ||||Hin6I MaeIII BccI | | | TaqI MboII SfaNI |||GlaI | | CviJI ||TseI | HgiJII* ||HhaI | SduI |BisI ClaI BlsI TaqI D R N K L L R C Y T Q N I D G L E E S I I G T N C C A V T R K T S M G S K K A * * E Q T A A L L H A K H R W A R R K H R ----:----|----:----|----:----|----:----|----:----|----:----| S L F L S S R Q * V C F M S P S S S L M L Y S C V A A S N C A F C R H A R L F C I P V F Q Q A T V R L V D I P E F F A Y MnlI MboII TspEI AciI SetI |Hpy166II \ \ \ \ \\ GGACTTACTTTATCAAATAGGAAATTACCGCTTACCTCATTTAGTTCACATTGGAAAAAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CCTGAATGAAATAGTTTATCCTTTAATGGCGAATGGAGTAAATCAAGTGTAACCTTTTTA / / / / / | | SetI | Hpy166II | AciI MnlI TspEI G L T L S N R K L P L T S F S S H W K N D L L Y Q I G N Y R L P H L V H I G K I T Y F I K * E I T A Y L I * F T L E K S ----:----|----:----|----:----|----:----|----:----|----:----| P S V K D F L F N G S V E N L E C Q F F L V * K I L Y S I V A * R M * N V N S F S K S * * I P F * R K G * K T * M P F I TatI Bsp1407I |Csp6I Hpy178III* FokI |Hpy166II | BseGI | CviRI* SetI BceAI ||RsaI Hpy178III* \ \ \ \ \ \ \\\ \ CTGGATGTCGTTCAGTTGCACGGCGACCTGAAAACTCTTTCGTGTACAAAGTGCTTCCAG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GACCTACAGCAAGTCAACGTGCCGCTGGACTTTTGAGAAAGCACATGTTTCACGAAGGTC / / / / / / //// / | BseGI | FokI SetI BceAI |||Bsp1407I Hpy178III* Hpy178III* CviRI* |||TatI ||Csp6I |RsaI Hpy166II L D V V Q L H G D L K T L S C T K C F Q W M S F S C T A T * K L F R V Q S A S R G C R S V A R R P E N S F V Y K V L P D ----:----|----:----|----:----|----:----|----:----|----:----| R S T T * N C P S R F V R E H V F H K W D P H R E T A R R G S F E K T Y L T S G Q I D N L Q V A V Q F S K R T C L A E L BspMI | BssKI | SecI* | EcoRII | | ScrFI | | BseBI | | | EcoNI | | | | BsiYI* | | | | | Csp6I | | | | | |RsaI | | | | | |SetI | | | | | ||AlwNI | | | | | ||| BsrI | | | | | ||| | BsmAI | | | | | ||| | Eco31I | | | | | ||| | |GsuI | | | | | ||| | |Eco57MI SetI | | | | | ||| | || Ksp632I* | MaeIII | | | | | ||| | || |MnlI | | MboII BetI* | | | | | ||| | || |DdeI | | | HphI BspMII* \ \ \ \ \ \\\ \ \\ \\ \ \ \ \ \ ACTTTTCCCTGGAGCAGGTACTGGTCTCGTTGTCTAAGAAGAGGTGAGTTACCATTGTGT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAAAGGGACCTCGTCCATGACCAGAGCAACAGATTCTTCTCCACTCAATGGTAACACA ///// / / // / / / // / / / / ||||| | | || BsrI | | || SetI | | HphI ||||| | | |Csp6I | | |DdeI | MaeIII ||||| | | RsaI | | Ksp632I* MboII ||||| | AlwNI | Eco31I ||||| SetI | BsmAI ||||EcoNI | MnlI |||EcoRII Eco57MI |||BssKI GsuI ||BsiYI* ||SecI* |BseBI |ScrFI BspMI T F P W S R Y W S R C L R R G E L P L C L F P G A G T G L V V * E E V S Y H C V F S L E Q V L V S L S K K R * V T I V S ----:----|----:----|----:----|----:----|----:----|----:----| V K G Q L L Y Q D R Q R L L P S N G N H S K E R S C T S T E N D L F L H T V M T S K G P A P V P R T T * S S T L * W Q T HpaII Hpy178III* Hin4II* TspDTI \ \ \ CCGGATTGCGAAGCACTTATCAACAAGAGATTGAATGAAGGAAAGCGAACTCTTGGTTCT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GGCCTAACGCTTCGTGAATAGTTGTTCTCTAACTTACTTCCTTTCGCTTGAGAACCAAGA // / / |BspMII* Hin4II* TspDTI |BetI* Hpy178III* HpaII P D C E A L I N K R L N E G K R T L G S R I A K H L S T R D * M K E S E L L V L G L R S T Y Q Q E I E * R K A N S W F * ----:----|----:----|----:----|----:----|----:----|----:----| G S Q S A S I L L L N F S P F R V R P E D P N R L V * * C S I S H L F A F E Q N R I A F C K D V L S Q I F S L S S K T R FokI | FokI | | Hin4I | | Hin4I | | | BseGI | | | | HphI | | | | BseGI Hin4I | | | | | BccI Hin4I | | | | | | BccI | DdeI SetI | | | | | | | TspEI \ \ \ \ \ \ \ \ \ \ \ AATGTGGGTATTCTAAGACCTAATATCGTCCTGTATGGTGAAAACCATCCATCCTGTGAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTACACCCATAAGATTCTGGATTATAGCAGGACATACCACTTTTGGTAGGTAGGACACTT / // // / / // / / Hin4I |SetI || | | |HphI | BccI Hin4I DdeI || | | BseGI BccI || | BseGI || FokI |FokI Hin4I Hin4I N V G I L R P N I V L Y G E N H P S C E M W V F * D L I S S C M V K T I H P V K C G Y S K T * Y R P V W * K P S I L * N ----:----|----:----|----:----|----:----|----:----|----:----| L T P I R L G L I T R Y P S F W G D Q S * H P Y E L V * Y R G T H H F G D M R H I H T N * S R I D D Q I T F V M W G T F Hpy178III* | MboI | BclI | | DpnI StuI Hpy178III* | | |BstKTI CviJI | TspEI | | || FatI HaeIII | | MseI | | || |CviAII \ \ \ \ \ \ \\ \\ ATTATTACGCAAGGCCTAAATCTTGACATAATTAAAGGCAATCCTGATTTTTTGATCATC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TAATAATGCGTTCCGGATTTAGAACTGTATTAATTTCCGTTAGGACTAAAAAACTAGTAG / / / // / // / / TspEI HaeIII | |MseI | || | NlaIII CviJI | TspEI | || BclI StuI Hpy178III* | || MboI | |DpnI | BstKTI Hpy178III* I I T Q G L N L D I I K G N P D F L I I L L R K A * I L T * L K A I L I F * S S Y Y A R P K S * H N * R Q S * F F D H H ----:----|----:----|----:----|----:----|----:----|----:----| I I V C P R F R S M I L P L G S K K I M F * * A L G L D Q C L * L C D Q N K S * N N R L A * I K V Y N F A I R I K Q D D NlaIII | Csp6I TspEI ApoI | |RsaI BccI BsrI | MseI TspEI \ \\ \ \ \ \ \ ATGGGTACAAGTTTGAAAGTTGATGGTGTGAAACAACTGGTAAAAAAATTAAGTAAGAAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCATGTTCAAACTTTCAACTACCACACTTTGTTGACCATTTTTTTAATTCATTCTTT // // / / // || |Csp6I BccI BsrI |MseI || RsaI TspEI |FatI CviAII M G T S L K V D G V K Q L V K K L S K K W V Q V * K L M V * N N W * K N * V R K G Y K F E S * W C E T T G K K I K * E N ----:----|----:----|----:----|----:----|----:----|----:----| M P V L K F T S P T F C S T F F N L L F * P Y L N S L Q H H S V V P L F I L Y S H T C T Q F N I T H F L Q Y F F * T L F Hpy178III* | MboI | | DpnI | | OliI | | MslI | | |PvuI | | |McrI* | | |BstKTI | | || AciI | | || |BisI | | || ||BlsI | | || |||TauI | | || |||CviJI | | || |||HaeIII | | || |||| MboI | | || |||| BclI TfiI | | || |||| | DpnI HinfI | | || |||| | |BstKTI Hpy166II | TaqII \ \ \\ \\\\ \ \\ \ \ \ ATTCACGATCGTGGCGGCCTGATCATTCTCGTAAACAAGACACCCATTGGCGAATCCTCT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTGCTAGCACCGCCGGACTAGTAAGAGCATTTGTTCTGTGGGTAACCGCTTAGGAGA / /// / //// // / / / | ||| | |||| || BclI Hpy166II TaqII | ||| | |||| || MboI HinfI | ||| | |||| |DpnI TfiI | ||| | |||| BstKTI | ||| | |||HaeIII | ||| | |||CviJI | ||| | ||BisI | ||| | ||AciI | ||| | |BlsI | ||| | TauI | ||| MboI | ||MslI | ||OliI | ||DpnI | |BstKTI | |McrI* | |PvuI | Hpy178III* TspEI ApoI I H D R G G L I I L V N K T P I G E S S F T I V A A * S F S * T R H P L A N P L S R S W R P D H S R K Q D T H W R I L L ----:----|----:----|----:----|----:----|----:----|----:----| I * S R P P R I M R T F L V G M P S D E F E R D H R G S * E R L C S V W Q R I R N V I T A A Q D N E Y V L C G N A F G R TspEI |BspCNI ||BseMII ||| MaeIII CspCI DdeI ||| Tsp45I MnlI | BceAI | Hpy188I ||| | CspCI Hpy178III* \ \ \ \ \ \\\ \ \ \ TGGCACGGCATTATAGACTACCAAATCCACTCAGATTGTGATAATTGGGTCACATTTCTT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ACCGTGCCGTAATATCTGATGGTTTAGGTGAGTCTAACACTATTAACCCAGTGTAAAGAA / / / // // / / / / MnlI CspCI BceAI |DdeI || | | Tsp45I Hpy178III* Hpy188I || | | MaeIII || | CspCI || TspEI |BseMII BspCNI W H G I I D Y Q I H S D C D N W V T F L G T A L * T T K S T Q I V I I G S H F L A R H Y R L P N P L R L * * L G H I S * ----:----|----:----|----:----|----:----|----:----|----:----| Q C P M I S * W I W E S Q S L Q T V N R K A R C * L S G F G S L N H Y N P * M E P V A N Y V V L D V * I T I I P D C K K Hpy178III* | MboI | | DpnI | | |HgaI | | |BstKTI MseI Tsp4CI* TfiI Hin4I | | || TspEI |Hin4I | MseI HinfI MboII Hin4I | | || | MseI |Hin4I | | MnlI \ \ \ \ \ \\ \ \ \\ \ \ \ GAATCCCAAATACCAGATTTCTTCAAGACGCAAGATCAAATTAAGAAGTTAAGACAGTTA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGGGTTTATGGTCTAAAGAAGTTCTGCGTTCTAGTTTAATTCTTCAATTCTGTCAAT / / / / // / /// / / / // HinfI | Hin4I | || | ||| Hin4I | | |MseI TfiI | Hin4I | || | ||| Hin4I | | MnlI MboII | || | ||MseI | Tsp4CI* | || | |TspEI MseI | || | HgaI | || MboI | |DpnI | BstKTI Hpy178III* E S Q I P D F F K T Q D Q I K K L R Q L N P K Y Q I S S R R K I K L R S * D S * I P N T R F L Q D A R S N * E V K T V K ----:----|----:----|----:----|----:----|----:----|----:----| S D W I G S K K L V C S * I L F N L C N Q I G F V L N R * S A L D F * S T L V T F G L Y W I E E L R L I L N L L * S L * AsuI* |CviJI |HaeIII |BmgT120I || Bce83I* || |MlyI HinfI Hpy188I Cac8I SmlI Hin4II* || |PleI TspDTI | NlaIV \ \ \ \\ \\ \ \ \ AAAAGGGAGGCGAGCGACTTGAGAAAGCAAATGAAGGCCCAAAAAGACTCAATCGGAACC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCCCTCCGCTCGCTGAACTCTTTCGTTTACTTCCGGGTTTTTCTGAGTTAGCCTTGG / / / ///// / / / / Cac8I | Hin4II* ||||| | | | NlaIV SmlI ||||| | | Hpy188I ||||| | HinfI ||||| TspDTI ||||PleI |||MlyI ||AsuI* |BmgT120I Bce83I* HaeIII CviJI K R E A S D L R K Q M K A Q K D S I G T K G R R A T * E S K * R P K K T Q S E P K G G E R L E K A N E G P K R L N R N P ----:----|----:----|----:----|----:----|----:----|----:----| F L S A L S K L F C I F A W F S E I P V L F P P S R S S F A F S P G F L S L R F F P L R A V Q S L L H L G L F V * D S G MnlI | BssKI | SecI* | EcoRII | |PasI | |SecI* | ||ScrFI | ||BseBI TspEI \ \\\ \ CCCCCAACAACCCCTCTACGAACTGCCCAGGGGATTGATATTCAAGGAAACAACGAATTG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GGGGGTTGTTGGGGAGATGCTTGACGGGTCCCCTAACTATAAGTTCCTTTGTTGCTTAAC / /// / MnlI ||EcoRII TspEI ||BssKI ||SecI* |SecI* |PasI BseBI ScrFI P P T T P L R T A Q G I D I Q G N N E L P Q Q P L Y E L P R G L I F K E T T N * P N N P S T N C P G D * Y S R K Q R I E ----:----|----:----|----:----|----:----|----:----|----:----| G G V V G R R V A W P I S I * P F L S N G G L L G E V F Q G P S Q Y E L F C R I G W C G R * S S G L P N I N L S V V F Q HphI | GsuI | Eco57MI | | MaeIII Tsp4CI* | | Tsp45I MnlI MseI | MseI | | Tsp4CI* | BsrI \ \ \ \ \ \ \ \ AATACAAAAATAAAGTCGTTAAACACAGTTAAGAGAAAAATACTGTCACCAGAAAACTCC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGTTTTTATTTCAGCAATTTGTGTCAATTCTCTTTTTATGACAGTGGTCTTTTGAGG / / / / / / / // MseI | MseI | | | Tsp45I |TspRI Tsp4CI* | | | MaeIII |BsrI | | Tsp4CI* MnlI | Eco57MI | GsuI HphI N T K I K S L N T V K R K I L S P E N S I Q K * S R * T Q L R E K Y C H Q K T P Y K N K V V K H S * E K N T V T R K L Q ----:----|----:----|----:----|----:----|----:----|----:----| F V F I F D N F V T L L F I S D G S F E S Y L F L T T L C L * S F F V T V L F S I C F Y L R * V C N L S F Y Q * W F V G TspRI | Ksp632I* Hin6I | | BbvII* FnuDII* | | | MboII |GlaI | | | | BciVI ||HhaI | |MnlI | | | MboII |||DdeI \ \\ \ \ \ \ \\\\ AGTGAGGAAGACGAAGAGGAAAACTTGGATACAAGAAAACGCGCTAAGATACGACCAACT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTCCTTCTGCTTCTCCTTTTGAACCTATGTTCTTTTGCGCGATTCTATGCTGGTTGA / / / / / /// / / | | | | MboII ||| DdeI BsiYI* | | | BciVI ||Hin6I | | BbvII* |GlaI | | MboII FnuDII* | Ksp632I* HhaI MnlI S E E D E E E N L D T R K R A K I R P T V R K T K R K T W I Q E N A L R Y D Q L * G R R R G K L G Y K K T R * D T T N F ----:----|----:----|----:----|----:----|----:----|----:----| L S S S S S S F K S V L F R A L I R G V W H P L R L P F S P Y L F V R * S V V L T L F V F L F V Q I C S F A S L Y S W S BsiYI* | MaeIII HphI | Tsp45I CviJI \ \ \ TTCGGTGACAACCAAGCCTCATAA 1330 1340 ----:----|----:----|---- AAGCCACTGTTGGTTCGGAGTATT / // | |CviJI | HphI Tsp45I MaeIII F G D N Q A S * S V T T K P H X R * Q P S L I X ----:----|----:----|---- K P S L W A E Y K R H C G L R M E T V V L G * L # Enzymes that cut Frequency Isoschizomers AarI 1 AciI 3 BspACI,SsiI AlwNI 1 CaiI ApoI 2 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 5 Bce83I* 1 BpuEI BceAI 2 BcgI 1 BciVI 1 BfuI BclI 2 FbaI,Ksp22I BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglII 1 BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 2 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 2 BspMI 2 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 1 BseMI,Bse3DI BsrI 6 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstAPI 1 BstKTI 6 Cac8I 3 BstC8I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 3 CviQI,RsaNI CspCI 1 CviAII 1 CviJI 9 CviKI-1 CviRI* 3 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 6 MalI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco31I 1 Bso31I,BspTNI,BsaI Eco57MI 2 EcoNI 1 BstENI,XagI EcoP15I 1 EcoRII 2 AjnI,Psp6I,PspGI FatI 1 FauI 1 SmuI FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 4 GsuI 2 BpmI HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 3 Eco24I,EcoT38I,FriOI,BanII HhaI 4 BstHHI,CfoI,AspLEI Hin4I 7 Hin4II* 2 HpyAV Hin6I 4 HinP1I,HspAI HinfI 3 HpaII 3 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 10 Hpy188III Hpy188I 5 Hpy99I 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeIII 6 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 McrI* 2 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 1 SchI MmeI 1 MnlI 10 MseI 7 Tru1I,Tru9I MslI 1 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 3 HpyF10VI,BstMWI NlaIII 1 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I OliI 1 AleI PasI 1 PleI 1 PpsI PvuI 2 MvrI,Ple19I,BpvUI RsaI 3 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 8 SfaNI 2 LweI SmlI 1 SmoI StuI 1 Eco147I,PceI,SseBI,AatI TaqI 3 TaqII 1 TatI 1 TauI 1 TfiI 2 PfeI TseI 1 ApeKI TsoI 1 Tsp45I 3 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 11 TasI,Tsp509I,Sse9I TspRI 1 TscAI XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AluI ApaI ApaLI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BdaI BglI BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI Bsp120I BspHI BspLU11I* BspOI BsrBI BssNAI Bst1107I BstEII BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI DinI DraII DraIII DrdI DsaI* EciI Ecl136II Eco47III Eco57I EcoICRI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FseI FspAI GsaI HaeII HgiCI* HindII HindIII HpaI KasI KpnI MaeII MauBI MluI Mph1103I MroNI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI PacI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuII RsrII SacI SacII SalI SanDI SauI* ScaI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StyI SwaI TaiI TspGWI TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769