Restriction Map of YOLWTy1-1



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YOLWTy1-1 on chromosome XV from coordinates 117703 to 123628.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.29900

TGTTGGAATAAAAATCCACTATCGTCTATCAACTAATAGTTATATTATCAATATATTATC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| ACAACCTTATTTTTAGGTGATAGCAGATAGTTGATTATCAATATAATAGTTATATAATAG C W N K N P L S S I N * * L Y Y Q Y I I V G I K I H Y R L S T N S Y I I N I L S L E * K S T I V Y Q L I V I L S I Y Y H ----:----|----:----|----:----|----:----|----:----|----:----| X Q F L F G S D D I L * Y N Y * * Y I I X N S Y F D V I T * * S I T I N D I Y * T P I F I W * R R D V L L * I I L I N D AluI TaqI Hin4I Tsp4CI* CviJI ClaI | AluI | MseI Hin4I | SetI | MnlI | CviJI \ \ \ \ \ \ \ \ \ ATATACGGTGTTAAGATGATGACATAAGTTATGAGAAGCTGTCATCGATGTTAGAGGAAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TATATGCCACAATTCTACTACTGTATTCAATACTCTTCGACAGTAGCTACAATCTCCTTC / / / / / // / / / | MseI Hin4I | CviJI || Hin4I | CviJI Tsp4CI* | AluI |ClaI | AluI SetI |TaqI SetI MnlI I Y G V K M M T * V M R S C H R C * R K Y T V L R * * H K L * E A V I D V R G S I R C * D D D I S Y E K L S S M L E E A ----:----|----:----|----:----|----:----|----:----|----:----| M Y P T L I I V Y T I L L Q * R H * L F * I R H * S S S M L * S F S D D I N S S Y V T N L H H C L N H S A T M S T L P L MboI | DpnI TspDTI | |BstKTI | Hin4I SetI | || BinI* | | MnlI \ \ \\ \ \ \ \ CTGAAACGCAAGGATTGATAATGTAATAGGATCAATGAATATAAACATATAAAACGGAAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GACTTTGCGTTCCTAACTATTACATTATCCTAGTTACTTATATTTGTATATTTTGCCTTA // / / // / || MboI BinI* || MnlI |DpnI |TspDTI BstKTI Hin4I L K R K D * * C N R I N E Y K H I K R N * N A R I D N V I G S M N I N I * N G M E T Q G L I M * * D Q * I * T Y K T E * ----:----|----:----|----:----|----:----|----:----|----:----| S F R L S Q Y H L L I L S Y L C I F R F A S V C P N I I Y Y S * H I Y V Y L V S Q F A L I S L T I P D I F I F M Y F P I TfiI BsiYI* HinfI | TfiI TspGWI SspI Hin4I | MnlI | HinfI MnlI \ \ \ \ \ \ \ \ GAGGAATAATCGTAATATTAGTATGTAGAAATATAGATTCCATTTTGAGGATTCCTATAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTTATTAGCATTATAATCATACATCTTTATATCTAAGGTAAAACTCCTAAGGATATA / / / / / / / TspGWI | Hin4I | BsiYI* | MnlI SspI HinfI HinfI TfiI TfiI MnlI E E * S * Y * Y V E I * I P F * G F L Y R N N R N I S M * K Y R F H F E D S Y I G I I V I L V C R N I D S I L R I P I S ----:----|----:----|----:----|----:----|----:----|----:----| S S Y D Y Y * Y T S I Y I G N Q P N R Y H P I I T I N T H L F I S E M K L I G I L F L R L I L I Y F Y L N W K S S E * I AvaI XhoI SmlI AbsI AccI PspXI |BssNAI |TaqI |Hpy166II |BmeT110I MaeI || SetI || MnlI | BseRI || | SspI CviJI \\ \ \ \ \\ \ \ \ CCTCGAGGAGAACTTCTAGTATATTCTGTATACCTAATATTATAGCCTTTATCAACAATG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGCTCCTCTTGAAGATCATATAAGACATATGGATTATAATATCGGAAATAGTTGTTAC // / / // / / || MnlI BseRI |AccI SspI CviJI |PspXI MaeI |SetI |AbsI Hpy166II |SmlI BssNAI |XhoI |AvaI BmeT110I TaqI P R G E L L V Y S V Y L I L * P L S T M L E E N F * Y I L Y T * Y Y S L Y Q Q W S R R T S S I F C I P N I I A F I N N G ----:----|----:----|----:----|----:----|----:----|----:----| G R P S S R T Y E T Y R I N Y G K D V I D E L L V E L I N Q I G L I I A K I L L R S S F K * Y I R Y V * Y * L R * * C H FatI |CviAII || NlaIII || | Hin6I || | |GlaI TfiI ApoI || | ||HhaI HinfI TspEI TspEI TspEI || | |||HaeII MaeIII \ \ \ \ \\ \ \\\\ \ GAATCCCAACAATTATCTAATTACCCACAAATTTCTCATGGTAGCGCCTGTGCTTCGGTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGGGTTGTTAATAGATTAATGGGTGTTTAAAGAGTACCATCGCGGACACGAAGCCAA / / / / / // //// HinfI TspEI TspEI | | || |||Hin6I TfiI | | || ||GlaI | | || |HhaI | | || HaeII | | |FatI | | CviAII | NlaIII TspEI ApoI E S Q Q L S N Y P Q I S H G S A C A S V N P N N Y L I T H K F L M V A P V L R L I P T I I * L P T N F S W * R L C F G Y ----:----|----:----|----:----|----:----|----:----|----:----| S D W C N D L * G C I E * P L A Q A E T P I G V I I * N G V F K E H Y R R H K P F G L L * R I V W L N R M T A G T S R N Hpy166II | TspGWI | | BinI* | | | Hpy178III* | | | | MboI | | | | XhoII MaeII AluI | | | | | DpnI | SetI CviJI DdeI | | | | | |BstKTI | TaiI | SetI \ \ \ \ \ \ \\ \ \ \ \ ACTTCTAAGGAAGTCCACACAAATCAAGATCCGTTAGACGTTTCAGCTTCCAAAACAGAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGATTCCTTCAGGTGTGTTTAGTTCTAGGCAATCTGCAAAGTCGAAGGTTTTGTCTT / / / / / /// / / / / / | DdeI | | | ||| XhoII | | | CviJI MaeIII | | | ||| MboI | | | AluI | | | ||DpnI | | SetI | | | |BstKTI | MaeII | | | | TaiI | | | | SetI | | | Hpy178III* | | BinI* | TspGWI Hpy166II T S K E V H T N Q D P L D V S A S K T E L L R K S T Q I K I R * T F Q L P K Q K F * G S P H K S R S V R R F S F Q N R R ----:----|----:----|----:----|----:----|----:----|----:----| V E L S T W V F * S G N S T E A E L V S * K * P L G C L D L D T L R K L K W F L S R L F D V C I L I R * V N * S G F C F Hin4II* AarI | MboII BspMI | | CviJI DdeI CviJI TspDTI SetI |MwoI \ \ \ \ \ \ \ \\ GAATGTGAGAAGGCTTCCACTAAGGCTAACTCTCAACAGACAACAACACCTGCTTCATCA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTTACACTCTTCCGAAGGTGATTCCGATTGAGAGTTGTCTGTTGTTGTGGACGAAGTAGT / / / / / / / / / | | CviJI | CviJI | SetI | SetI | MboII DdeI TspDTI MwoI Hin4II* E C E K A S T K A N S Q Q T T T P A S S N V R R L P L R L T L N R Q Q H L L H Q M * E G F H * G * L S T D N N T C F I S ----:----|----:----|----:----|----:----|----:----|----:----| S H S F A E V L A L E * C V V V G A E D L I H S P K W * P * S E V S L L V Q K M F T L L S G S L S V R L L C C C R S * * MnlI BseRI | SetI AluI |FatI | | MnlI CviJI ||CviAII | | | BspMI PvuII ||| NlaIII | | | |Csp6I NspBII* ||| |BccI | | | ||RsaI | SetI ||| |Eco57I | | | ||| BceAI | | Hpy178III* ||| |Eco57MI | | | ||| | SetI \ \ \ \\\ \\ \ \ \ \\\ \ \ GCTGTTCCAGAGAACCCCCATCATGCCTCTCCTCAACCTGCTTCAGTACCACCTCCACAG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGACAAGGTCTCTTGGGGGTAGTACGGAGAGGAGTTGGACGAAGTCATGGTGGAGGTGTC / / / / // / / / //// / / NspBII* | | | || BccI MnlI MnlI |||| | BsiYI* BspMI | | | |FatI SetI |||| | PflMI PvuII | | | Eco57MI |||| BceAI CviJI | | | CviAII |||SetI AarI | | | Eco57I ||BspMI AluI | | NlaIII |Csp6I | BseRI RsaI Hpy178III* A V P E N P H H A S P Q P A S V P P P Q L F Q R T P I M P L L N L L Q Y H L H R C S R E P P S C L S S T C F S T T S T E ----:----|----:----|----:----|----:----|----:----|----:----| A T G S F G W * A E G * G A E T G G G C L Q E L S G G D H R E E V Q K L V V E V S N W L V G M M G R R L R S * Y W R W L PflMI BsiYI* |MnlI || AsuI* FatI || |BmgT120I CviRI* || ||CviJI |CviAII || ||HaeIII ||BtsI || ||| Csp6I OliI ||TspRI CviJI BstXI || ||| |RsaI MslI ||| NlaIII | EcoP15I |BccI \\ \\\ \\ \ \\\ \ \ \ \\ AATGGGCCGTACCCACAGCAGTGCATGATGACCCAAAACCAAGCCAATCCATCTGGTTGG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTACCCGGCATGGGTGTCGTCACGTACTACTGGGTTTTGGTTCGGTTAGGTAGACCAACC / // // / / / // / / / / MnlI || || | MslI | |FatI | | BstXI BccI || || | OliI | CviAII | EcoP15I || || TspRI CviRI* CviJI || |Csp6I NlaIII || RsaI BtsI |AsuI* BmgT120I HaeIII CviJI N G P Y P Q Q C M M T Q N Q A N P S G W M G R T H S S A * * P K T K P I H L V G W A V P T A V H D D P K P S Q S I W L V ----:----|----:----|----:----|----:----|----:----|----:----| F P G Y G C C H M I V W F W A L G D P Q S H A T G V A T C S S G F G L W D M Q N I P R V W L L A H H G L V L G I W R T P TspGWI | TspGWI | |TfiI | |BccI | |HinfI | || TaqII | || | AccI | || | |BssNAI TatI | || | |Hpy166II |Csp6I | || | || SetI ||RsaI \ \\ \ \\ \ \\\ TCATTTTACGGACACCCATCTATGATTCCGTATACACCTTATCAAATGTCGCCTATGTAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAAAATGCCTGTGGGTAGATACTAAGGCATATGTGGAATAGTTTACAGCGGATACATG / / / / // / /// | | | | || SetI ||TatI | | | | |AccI |Csp6I | | | | Hpy166II RsaI | | | | BssNAI | | | TaqII | | | HinfI | | | TfiI | | BccI | TspGWI TspGWI S F Y G H P S M I P Y T P Y Q M S P M Y H F T D T H L * F R I H L I K C R L C T I L R T P I Y D S V Y T L S N V A Y V L ----:----|----:----|----:----|----:----|----:----|----:----| D N * P C G D I I G Y V G * * I D G I Y T M K R V G M * S E T Y V K D F T A * T * K V S V W R H N R I C R I L H R R H V BssKI EcoRII |SecI* ||ScrFI ||BseBI |||SetI ||||AsuI* BciVI |||||BmgT120I Tsp4CI* |BccI ||||||CviJI | MmeI || BseMII DdeI ||||||HaeIII | |AciI || |BspCNI |Hpy188I \\\\\\\ \ \\ \\ \\ \\ TTTCCACCTGGGCCACAATCACAGTTTCCGCAGTATCCATCATCAGTTGGAACGCCTCTG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGGTGGACCCGGTGTTAGTGTCAAAGGCGTCATAGGTAGTAGTCAACCTTGCGGAGAC / / /// / / / / /// / / | | ||AsuI* | MmeI AciI | ||BspCNI | HgiAI* | | |BmgT120I Tsp4CI* | |BseMII | SduI | | |HaeIII | BccI Hpy188I | | |CviJI BciVI | | EcoRII | | BssKI | | SecI* | BseBI | ScrFI SetI F P P G P Q S Q F P Q Y P S S V G T P L F H L G H N H S F R S I H H Q L E R L * S T W A T I T V S A V S I I S W N A S E ----:----|----:----|----:----|----:----|----:----|----:----| K G G P G C D C N G C Y G D D T P V G R S E V Q A V I V T E A T D M M L Q F A E K W R P W L * L K R L I W * * N S R R Q TfiI HinfI | BseGI | | DdeI | | BbvCI | | Bpu10I | | |MlyI DdeI | | |PleI |SetI | | || AciI |BccI | | || Hin4I ||HinfI | | || Hin4I |||EcoNI | | || NspBII* |||| BsiYI* | | || | FokI HphI |||| | SetI | | || | |HinfI | SduI |||| | PleI | | || | || MnlI | HgiAI* |||| | |MlyI | | || | || | Hpy188I | |MnlI |||| | || FokI | | || | || | |BspCNI | |BseMII |||| | || |Hin4I | | || | || | ||BseMII | ||BspCNI |||| | || ||TspDTI | | || | || | |||Hin4I \ \\\ \\\\ \ \\ \\\ \ \ \\ \ \\ \ \\\\ AGCACTCCATCACCTGAGTCAGGTAATACATTTACTGATTCATCCTCAGCGGACTCTGAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTGAGGTAGTGGACTCAGTCCATTATGTAAATGACTAAGTAGGAGTCGCCTGAGACTA / // / ///// / / / / / / / //// / / /// | |BspCNI SetI ||||| | | | FokI | | | |||| | | ||BseMII | |MnlI ||||| | | TspDTI | | | |||| | | |Hpy188I | BseMII ||||| | PleI | | | |||| | | |BspCNI DdeI ||||| | MlyI | | | |||| | | Hin4I HphI ||||| Hin4I | | | |||| | | HinfI ||||SetI | | | |||| | | FokI |||HinfI | | | |||| | MnlI ||EcoNI | | | |||| AciI |DdeI | | | |||NspBII* BsiYI* | | | ||Bpu10I BccI | | | ||BbvCI | | | ||DdeI | | | |PleI | | | MlyI | | Hin4I | | Hin4I | HinfI | TfiI BseGI S T P S P E S G N T F T D S S S A D S D A L H H L S Q V I H L L I H P Q R T L I H S I T * V R * Y I Y * F I L S G L * Y ----:----|----:----|----:----|----:----|----:----|----:----| L V G D G S D P L V N V S E D E A S E S S C E M V Q T L Y Y M * Q N M R L P S Q A S W * R L * T I C K S I * G * R V R I HphI | MseI | |HpaI Hin4I | |HindII Hin4I | |Hpy166II SetI BseGI | Hpy188I | || SetI | MnlI \ \ \ \ \\ \ \ \ ATGACATCCACTAAAAAATATGTCAGACCACCACCAATGTTAACCTCACCTAATGACTTT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGTAGGTGATTTTTTATACAGTCTGGTGGTGGTTACAATTGGAGTGGATTACTGAAA / / / / // / / BseGI Hin4I Hpy188I | |MseI SetI MnlI Hin4I | |SetI | Hpy166II | HindII | HpaI HphI M T S T K K Y V R P P P M L T S P N D F * H P L K N M S D H H Q C * P H L M T F D I H * K I C Q T T T N V N L T * * L S ----:----|----:----|----:----|----:----|----:----|----:----| I V D V L F Y T L G G G I N V E G L S K Y S M W * F I H * V V V L T L R V * H S H C G S F F I D S W W W H * G * R I V K TaqI ApoI | TfiI TspEI MseI TspEI | HinfI \ \ \ \ \ CCAAATTGGGTTAAAACATACATCAAATTTTTACAAAACTCGAATCTCGGTGGTATTATT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTAACCCAATTTTGTATGTAGTTTAAAAATGTTTTGAGCTTAGAGCCACCATAATAA / / / / / TspEI MseI TspEI | HinfI ApoI | TfiI TaqI P N W V K T Y I K F L Q N S N L G G I I Q I G L K H T S N F Y K T R I S V V L F K L G * N I H Q I F T K L E S R W Y Y S ----:----|----:----|----:----|----:----|----:----|----:----| G F Q T L V Y M L N K C F E F R P P I I E L N P * F M C * I K V F S S D R H Y * W I P N F C V D F K * L V R I E T T N N SplI* |Csp6I ||RsaI |||MaeII ||||MmeI |||||TspGWI ||||||SetI ||||||TaiI ||||||| MboI Hpy188I ||||||| Hpy188I SetI | Tsp4CI* ||||||| | DpnI HphI | TspDTI | | Hpy166II ||||||| | |BstKTI TspRI | | Hin4II* \ \ \ \\\\\\\ \ \\ \ \ \ \ CCGACAGTAAACGGAAAACCCGTACGTCAGATCACTGATGATGAACTCACCTTCTTGTAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GGCTGTCATTTGCCTTTTGGGCATGCAGTCTAGTGACTACTACTTGAGTGGAAGAACATA / / / //// / // / / / / / | | Hpy166II |||| | || MboI HphI SetI | Hin4II* | Tsp4CI* |||| | |DpnI TspDTI Hpy188I |||| | BstKTI |||| | TspRI |||| Hpy188I |||MaeII ||SplI* |TspGWI |Csp6I MmeI RsaI TaiI SetI P T V N G K P V R Q I T D D E L T F L Y R Q * T E N P Y V R S L M M N S P S C I D S K R K T R T S D H * * * T H L L V * ----:----|----:----|----:----|----:----|----:----|----:----| G V T F P F G T R * I V S S S S V K K Y E S L L R F V R V D S * Q H H V * R R T R C Y V S F G Y T L D S I I F E G E Q I SetI |FokI |BssKI |EcoRII ||SecI* |||ScrFI |||BseBI ||||SetI TspEI ||||Hin4I TspGWI SspI | MnlI ||||Hin4I | BseGI \ \ \ \\\\\ \ \ AACACTTTTCAAATATTTGCTCCCTCTCAATTCCTACCTACCTGGGTCAAAGACATCCTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTGAAAAGTTTATAAACGAGGGAGAGTTAAGGATGGATGGACCCAGTTTCTGTAGGAT / / / // /// / / SspI | | || ||| | BseGI | | || ||| TspGWI | | || ||EcoRII | | || ||BssKI | | || ||SecI* | | || |FokI | | || BseBI | | || ScrFI | | |SetI | | Hin4I | | Hin4I | SetI TspEI MnlI N T F Q I F A P S Q F L P T W V K D I L T L F K Y L L P L N S Y L P G S K T S Y H F S N I C S L S I P T Y L G Q R H P I ----:----|----:----|----:----|----:----|----:----|----:----| L V K * I N A G E * N R G V Q T L S M R Y C K E F I Q E R E I G V * R P * L C G V S K L Y K S G R L E * R G P D F V D * Hin4I Hin4I | EcoRV | | FatI | | BspHI | | |CviAII | | |Hpy178III* | | || NlaIII | | || | ApoI | | || | TspEI CviRI* | | || | | TspGWI TspDTI | Hpy188I \ \ \\ \ \ \ \ \ \ TCCGTTGATTATACGGATATCATGAAAATTCTTTCCAAAAGTATTGAAAAAATGCAATCT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCAACTAATATGCCTATAGTACTTTTAAGAAAGGTTTTCATAACTTTTTTACGTTAGA / / / // / / / / / Hin4I | | || | | TspDTI | Hpy188I Hin4I | | || | TspEI CviRI* | | || | ApoI | | || TspGWI | | |BspHI | | |FatI | | Hpy178III* | | CviAII | NlaIII EcoRV S V D Y T D I M K I L S K S I E K M Q S P L I I R I S * K F F P K V L K K C N L R * L Y G Y H E N S F Q K Y * K N A I * ----:----|----:----|----:----|----:----|----:----|----:----| D T S * V S I M F I R E L L I S F I C D I R Q N Y P Y * S F E K W F Y Q F F A I G N I I R I D H F N K G F T N F F H L R MaeIII Tsp45I | BssKI | SecI* | EcoRII TatI | | ScrFI |Csp6I | | BseBI ||RsaI | | | ApoI ||SfaNI MnlI | | | TspEI CviRI* |||Hpy166II \ \ \ \ \ \ \\\\ GATACCCAAGAGGCAAACGACATTGTGACCCTGGCAAATTTGCAATATAATGGCAGTACA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTATGGGTTCTCCGTTTGCTGTAACACTGGGACCGTTTAAACGTTATATTACCGTCATGT / / /// / / /// MnlI | ||| | CviRI* ||TatI | ||| TspEI ||SetI | ||| ApoI |Hpy166II | ||EcoRII |Csp6I | ||BssKI RsaI | |SecI* | BseBI | ScrFI Tsp45I MaeIII D T Q E A N D I V T L A N L Q Y N G S T I P K R Q T T L * P W Q I C N I M A V H Y P R G K R H C D P G K F A I * W Q Y T ----:----|----:----|----:----|----:----|----:----|----:----| S V W S A F S M T V R A F K C Y L P L V Q Y G L P L R C Q S G P L N A I Y H C Y I G L L C V V N H G Q C I Q L I I A T C SfeI* |SetI ||CviRI* ||| PstI ||| | AarI ||| | BspMI ||| | |CviRI* MaeIII ||| | || EcoT22I Tsp45I TspDTI BsmI \\\ \ \\ \ \ \ \ CCTGCAGATGCATTTGAAACAAAAGTCACAAACATTATCAACAGACTGAACAATAATGGC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GGACGTCTACGTAAACTTTGTTTTCAGTGTTTGTAATAGTTGTCTGACTTGTTATTACCG // / / / / / / / / || | | | | BspMI Tsp45I TspDTI BsmI || | | | | AarI MaeIII || | | | CviRI* || | | EcoT22I || | SfeI* || CviRI* |PstI SfaNI P A D A F E T K V T N I I N R L N N N G L Q M H L K Q K S Q T L S T D * T I M A C R C I * N K S H K H Y Q Q T E Q * W H ----:----|----:----|----:----|----:----|----:----|----:----| G A S A N S V F T V F M I L L S F L L P V Q L H M Q F L L * L C * * C V S C Y H R C I C K F C F D C V N D V S Q V I I A SetI | FatI | |CviAII | ||Cac8I | ||| SphI | ||| NspI | ||| NlaIII | ||| | TspEI | ||| | | MseI | ||| | | VspI | ||| | | |TspEI | ||| | | || MnlI SetI \ \\\ \ \ \\ \ \ ATTCATATCAATAACAAGGTCGCATGCCAATTAATTATGAGAGGTCTATCTGGCGAATAT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTATAGTTATTGTTCCAGCGTACGGTTAATTAATACTCTCCAGATAGACCGCTTATA / / /// // / / SetI | ||FatI || | SetI | |CviAII || TspEI | Cac8I |VspI NlaIII |MseI NspI |MnlI SphI TspEI I H I N N K V A C Q L I M R G L S G E Y F I S I T R S H A N * L * E V Y L A N I S Y Q * Q G R M P I N Y E R S I W R I * ----:----|----:----|----:----|----:----|----:----|----:----| M * I L L L T A H W N I I L P R D P S Y C E Y * Y C P R M G I L * S L D I Q R I N M D I V L D C A L * N H S T * R A F I AflIII | MaeII | |BtrI | || SetI ApoI | || TaiI Tsp4CI* Tsp4CI* TspEI | || | TaqI | AlwNI | DdeI \ \ \\ \ \ \ \ \ \ AAATTTTTACGCTACACACGTCATCGACATCTAAATATGACAGTCGCTGAACTGTTCTTA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAAAAATGCGATGTGTGCAGTAGCTGTAGATTTATACTGTCAGCGACTTGACAAGAAT / / // / / / / / TspEI | || TaqI | AlwNI Tsp4CI* DdeI ApoI | |AflIII Tsp4CI* | |MaeII | BtrI TaiI SetI K F L R Y T R H R H L N M T V A E L F L N F Y A T H V I D I * I * Q S L N C S * I F T L H T S S T S K Y D S R * T V L R ----:----|----:----|----:----|----:----|----:----|----:----| L N K R * V R * R C R F I V T A S S N K Y I K V S C V D D V D L Y S L R Q V T R F K * A V C T M S M * I H C D S F Q E * MboI MboII |TspDTI ||DpnI EcoRV |||TaqI | FatI |||BstKTI | |CviAII ||||Hpy178III* SetI BseMII | || NlaIII ||||| BinI* TspEI |BspCNI \ \\ \ \\\\\ \ \ \\ GATATCCATGCTATTTATGAAGAACAACAGGGATCGAGAAACAGCAAACCTAATTACAGG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTATAGGTACGATAAATACTTCTTGTTGTCCCTAGCTCTTTGTCGTTTGGATTAATGTCC / / // / // /// / / /// | | |FatI | || ||| BinI* SetI ||BspCNI | | CviAII | || ||Hpy178III* |BseMII | NlaIII | || |TaqI TspEI EcoRV | || MboI | |DpnI | BstKTI TspDTI MboII D I H A I Y E E Q Q G S R N S K P N Y R I S M L F M K N N R D R E T A N L I T G Y P C Y L * R T T G I E K Q Q T * L Q E ----:----|----:----|----:----|----:----|----:----|----:----| S I W A I * S S C C P D L F L L G L * L L Y G H * K H L V V P I S F C C V * N C I D M S N I F F L L S R S V A F R I V P TfiI HinfI | MboII | | TseI | | |BisI | | ||BlsI | | |||AluI DdeI | | |||CviJI |Hpy188I | | |||| SetI BbvI \\ \ \ \\\\ \ \ AGAAATCTGAGTGATGAGAAGAATGATTCTCGCAGCTATACGAATACAACCAAACCCAAA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTAGACTCACTACTCTTCTTACTAAGAGCGTCGATATGCTTATGTTGGTTTGGGTTT / / // /// / | DdeI || ||CviJI BbvI Hpy188I || ||TseI || ||AluI || |BisI || BlsI || SetI |MboII HinfI TfiI R N L S D E K N D S R S Y T N T T K P K E I * V M R R M I L A A I R I Q P N P K K S E * * E E * F S Q L Y E Y N Q T Q S ----:----|----:----|----:----|----:----|----:----|----:----| L F R L S S F F S E R L * V F V V L G L S F D S H H S S H N E C S Y S Y L W V W S I Q T I L L I I R A A I R I C G F G F TstI BssKI CviJI EcoRII AluI |SecI* CviJI ||ScrFI | SetI MnlI ||BseBI | | Hpy188I | TspEI ||| CviJI | | |TfiI | | TaqI ||| | SduI | | |HinfI | | AsuII TaqI ||| | HgiJII* \ \ \\ \ \ \ \ \\\ \ \ GTTATAGCTCGGAATCCTCAAAAAACAAATAATTCGAAATCGAAAACAGCCAGGGCTCAC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CAATATCGAGCCTTAGGAGTTTTTTGTTTATTAAGCTTTAGCTTTTGTCGGTCCCGAGTG / / / / / / / / / / //// | | | HinfI MnlI | AsuII | TstI | |||CviJI | | | TfiI | TaqI TaqI | ||EcoRII | | Hpy188I TspEI | ||BssKI | CviJI | ||SecI* | AluI | |HgiJII* SetI | |SduI | BseBI | ScrFI CviJI V I A R N P Q K T N N S K S K T A R A H L * L G I L K K Q I I R N R K Q P G L T Y S S E S S K N K * F E I E N S Q G S Q ----:----|----:----|----:----|----:----|----:----|----:----| T I A R F G * F V F L E F D F V A L A * L * L E S D E F F L Y N S I S F L W P E N Y S P I R L F C I I R F R F C G P S V TspGWI TstI | BdaI | BseYI TfiI | BdaI BciVI | | GsaI HinfI | BccI \ \ \ \ \ \ \ AATGTATCCACATCTAATAACTCTCCCAGCACGGACAACGATTCCATCAGTAAATCAACT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTACATAGGTGTAGATTATTGAGAGGGTCGTGCCTGTTGCTAAGGTAGTCATTTAGTTGA / / / / // / / | TstI | BseYI || | BccI BciVI GsaI || BdaI || BdaI |TspGWI HinfI TfiI N V S T S N N S P S T D N D S I S K S T M Y P H L I T L P A R T T I P S V N Q L C I H I * * L S Q H G Q R F H Q * I N Y ----:----|----:----|----:----|----:----|----:----|----:----| L T D V D L L E G L V S L S E M L L D V C H I W M * Y S E W C P C R N W * Y I L I Y G C R I V R G A R V V I G D T F * S DdeI SauI* |SetI || Hin4II* || | BssKI XmnI || | CviJI |TfiI || | EcoRII |HinfI BdaI || | HaeIII || MfeI BdaI || | | ScrFI TfiI || TspEI | HphI SetI || | | BseBI HinfI \\ \ \ \ \ \\ \ \ \ \ ACTGAACCGATTCAATTGAACAATAAGCACGACCTTCACCTTAGGCCAGGAACTTACTGA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTTGGCTAAGTTAACTTGTTATTCGTGCTGGAAGTGGAATCCGGTCCTTGAATGACT / / / / / / / // / / / | | TspEI | | SetI SetI || | | EcoRII | | MfeI | HphI || | | BssKI | HinfI BdaI || | BseBI | TfiI BdaI || | ScrFI XmnI || HaeIII || CviJI |SauI* |DdeI Hin4II* T E P I Q L N N K H D L H L R P G T Y * L N R F N * T I S T T F T L G Q E L T E * T D S I E Q * A R P S P * A R N L L N ----:----|----:----|----:----|----:----|----:----|----:----| V S G I * N F L L C S R * R L G P V * Q * Q V S E I S C Y A R G E G * A L F K S S F R N L Q V I L V V K V K P W S S V S BssKI Hpy178III* SecI* |TaqI EcoRII || TfiI MslI | ScrFI TspDTI || MnlI Tsp4CI* |Hpy188I | BseBI | SetI || HinfI \ \\ \ \ \ \ \\ \ ATCTACGGTAAATCACACTAATCATTCTGATGATGAACTCCCTGGACACCTCCTTCTCGA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TAGATGCCATTTAGTGTGATTAGTAAGACTACTACTTGAGGGACCTGTGGAGGAAGAGCT / / / ///// // | Tsp4CI* Hpy188I ||||SetI |TaqI HinfI MslI |||TspDTI Hpy178III* TfiI ||EcoRII MnlI ||BssKI |SecI* BseBI ScrFI I Y G K S H * S F * * * T P W T P P S R S T V N H T N H S D D E L P G H L L L D L R * I T L I I L M M N S L D T S F S I ----:----|----:----|----:----|----:----|----:----|----:----| I * P L D C * D N Q H H V G Q V G G E R F R R Y I V S I M R I I F E R S V E K E D V T F * V L * E S S S S G P C R R R S PsiI | MboI Hin4II* | BglII |Hpy178III* | XhoII SfaNI || Hpy178III* | | DpnI BspCNI || | SfaNI | | |BstKTI DdeI |BseMII \\ \ \ \ \ \\ \ \\ TTCAGGAGCATCACGAACCCTTATAAGATCTGCTCATCACATACACTCAGCATCATCTAA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTCCTCGTAGTGCTTGGGAATATTCTAGACGAGTAGTGTATGTGAGTCGTAGTAGATT // / / / / // / / // || | | | | || XhoII DdeI |BseMII || | | | | || BglII BspCNI || | | | | || MboI || | | | | |DpnI || | | | | BstKTI || | | | PsiI || | | SfaNI || | Hpy178III* || Hpy178III* |HinfI |TfiI Hin4II* F R S I T N P Y K I C S S H T L S I I * S G A S R T L I R S A H H I H S A S S N Q E H H E P L * D L L I T Y T Q H H L I ----:----|----:----|----:----|----:----|----:----|----:----| N L L M V F G * L I Q E D C V S L M M * I * S C * S G K Y S R S M V Y V * C * R E P A D R V R I L D A * * M C E A D D L Hpy178III* | SfaNI | | MaeII MaeIII | | | SetI TspEI Tsp45I | | | TaiI | MseI BstEII \ \ \ \ \ \ \ TCCTGACATAAACGTAGTTGATGCTCAAAAAAGAAATATACCAATTAACGCTATTGGTGA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AGGACTGTATTTGCATCAACTACGAGTTTTTTCTTTATATGGTTAATTGCGATAACCACT // / / // / || | MaeII |MseI SetI || | SfaNI TspEI || TaiI || SetI |Hpy178III* SfaNI S * H K R S * C S K K K Y T N * R Y W * P D I N V V D A Q K R N I P I N A I G D L T * T * L M L K K E I Y Q L T L L V T ----:----|----:----|----:----|----:----|----:----|----:----| D Q C L R L Q H E F F F Y V L * R * Q H I R V Y V Y N I S L F S I Y W N V S N T G S M F T T S A * F L F I G I L A I P S PfoI BssKI SetI EcoRII | TspEI | ScrFI SetI | | HphI | BseBI | CviRI* \ \ \ \ \ \ \ CCTACAATTTCACTTCCAGGACAACACCAAAACATCAATAAAGGTATTGCACACTCCTAA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GGATGTTAAAGTGAAGGTCCTGTTGTGGTTTTGTAGTTATTTCCATAACGTGTGAGGATT / / / / / / / | | TspEI | EcoRII SetI CviRI* | HphI | BssKI BstEII | PfoI Tsp45I BseBI MaeIII ScrFI P T I S L P G Q H Q N I N K G I A H S * L Q F H F Q D N T K T S I K V L H T P N Y N F T S R T T P K H Q * R Y C T L L T ----:----|----:----|----:----|----:----|----:----|----:----| G V I E S G P C C W F M L L P I A C E * V * L K V E L V V G F C * Y L Y Q V S R R C N * K W S L V L V D I F T N C V G L TspEI |BspCNI ||BseMII ||| TseI ||| CviJI ||| |BisI ||| |SfeI* FatI ||| ||BlsI |CviAII ||| |||CviRI* ||Cac8I ||| |||| PstI ||| SphI ||| |||| | TspDTI ||| NspI CviJI DdeI BbvI ||| |||| | | EcoRV ||| NlaIII \ \ \ \\\ \\\\ \ \ \ \\\ \ CATAGCCTATGACTTACTCAGTTTGAATGAATTGGCTGCAGTAGATATCACAGCATGCTT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| GTATCGGATACTGAATGAGTCAAACTTACTTAACCGACGTCATCTATAGTGTCGTACGAA / / / // / //// / / / /// CviJI DdeI | || | |||| | EcoRV | ||FatI | || | |||| TspDTI | |CviAII | || | |||| SfeI* | Cac8I | || | |||CviRI* NlaIII | || | |||TseI NspI | || | ||BisI SphI | || | |BlsI | || | |PstI | || | CviJI | || TspEI | |BseMII | BspCNI BbvI H S L * L T Q F E * I G C S R Y H S M L I A Y D L L S L N E L A A V D I T A C F * P M T Y S V * M N W L Q * I S Q H A L ----:----|----:----|----:----|----:----|----:----|----:----| C L R H S V * N S H I P Q L L Y * L M S V Y G I V * E T Q I F Q S C Y I D C C A M A * S K S L K F S N A A T S I V A H K TatI Tsp4CI* |Csp6I ||RsaI MaeII MboI |||TspRI | SetI | DpnI |||| CviRI* | TaiI | |BstKTI |||| | BceAI | |DdeI | || Hpy188I |||| | | SetI BsmAI \ \\ \ \\ \ \\\\ \ \ \ \ TACCAAAAACGTCTTAGAACGATCTGACGGCACTGTACTTGCACCTATCGTAAAATATGG 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGTTTTTGCAGAATCTTGCTAGACTGCCGTGACATGAACGTGGATAGCATTTTATACC / / / // / / / /// // / / | | DdeI || | | | ||| || BceAI BsmAI | MaeII || | | | ||| |SetI TaiI || | | | ||| CviRI* SetI || | | | ||TatI || | | | |Csp6I || | | | RsaI || | | Tsp4CI* || | TspRI || Hpy188I || MboI |DpnI BstKTI Y Q K R L R T I * R H C T C T Y R K I W T K N V L E R S D G T V L A P I V K Y G P K T S * N D L T A L Y L H L S * N M E ----:----|----:----|----:----|----:----|----:----|----:----| * W F R R L V I Q R C Q V Q V * R L I H K G F V D * F S R V A S Y K C R D Y F I V L F T K S R D S P V T S A G I T F Y P TatI |Csp6I ||RsaI TspGWI Csp6I BsrI BfiI ||ScaI | BccI |RsaI \ \ \\\ \ \ \\ AGACTTTTACTGGGTATCTAAAAAGTACTTGCTTCCATCAAATATCTCCGTACCCACCAT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGAAAATGACCCATAGATTTTTCATGAACGAAGGTAGTTTATAGAGGCATGGGTGGTA / / /// / / // BsrI BfiI ||TatI TspGWI BccI |Csp6I |Csp6I RsaI ScaI RsaI R L L L G I * K V L A S I K Y L R T H H D F Y W V S K K Y L L P S N I S V P T I T F T G Y L K S T C F H Q I S P Y P P S ----:----|----:----|----:----|----:----|----:----|----:----| L S K S P I * F T S A E M L Y R R V W W S V K V P Y R F L V Q K W * I D G Y G G S K * Q T D L F Y K S G D F I E T G V M TatI |Csp6I ||RsaI TspDTI BccI MslI |||Hpy166II | TspDTI TaqI \ \ \\\\ \ \ \ CAATAATGTCCATACAAGTGAAAGTACACGCAAATATCCTTATCCTTTCATTCATCGAAT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GTTATTACAGGTATGTTCACTTTCATGTGCGTTTATAGGAATAGGAAAGTAAGTAGCTTA / / /// / / / BccI MslI ||TatI | TspDTI TaqI |Hpy166II TspDTI |Csp6I RsaI Q * C P Y K * K Y T Q I S L S F H S S N N N V H T S E S T R K Y P Y P F I H R M I M S I Q V K V H A N I L I L S F I E C ----:----|----:----|----:----|----:----|----:----|----:----| * Y H G Y L H F Y V C I D K D K * E D F D I I D M C T F T C A F I R I R E N M S L L T W V L S L V R L Y G * G K M * R I BsmI Cac8I | CviRI* | | FatI MaeII | | |CviAII |BsaAI | | || NspI || SetI | | || NlaIII TspEI || TaiI | | || |MslI CviRI* | TaqI MseI || BccI \ \ \\ \\ \ \ \ \ \\ \ GCTTGCACATGCCAATGCACAGACAATTCGATACTCACTTAAAAATAACACCATCACGTA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CGAACGTGTACGGTTACGTGTCTGTTAAGCTATGAGTGAATTTTTATTGTGGTAGTGCAT / / / / /// / / / / / // / | | | | ||MslI CviRI* | TaqI MseI | || BccI | | | | |FatI TspEI | |MaeII | | | | CviAII | BsaAI | | | NlaIII TaiI | | | NspI SetI | | CviRI* | Cac8I BsmI A C T C Q C T D N S I L T * K * H H H V L A H A N A Q T I R Y S L K N N T I T Y L H M P M H R Q F D T H L K I T P S R I ----:----|----:----|----:----|----:----|----:----|----:----| A Q V H W H V S L E I S V * F Y C W * T H K C M G I C L C N S V * K F I V G D R S A C A L A C V I R Y E S L F L V M V Y TfiI HinfI | Hpy188I | | SalI | | |TaqI | | |AccI | | ||HindII | | ||Hpy166II | | ||| BsrI Hpy178III* MseI | | ||| |MaeI | MseI \ \ \ \\\ \\ \ \ TTTTAACGAATCAGATGTCGACTGGTCTAGTGCTATTGACTATCAATGTCCTGATTGTTT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AAAATTGCTTAGTCTACAGCTGACCAGATCACGATAACTGATAGTTACAGGACTAACAAA / // /// / / / MseI || ||| BsrI MaeI Hpy178III* || ||SalI || |AccI || |TaqI || Hpy166II || HindII |Hpy188I HinfI TfiI F * R I R C R L V * C Y * L S M S * L F F N E S D V D W S S A I D Y Q C P D C L L T N Q M S T G L V L L T I N V L I V * ----:----|----:----|----:----|----:----|----:----|----:----| N * R I L H R S T * H * Q S D I D Q N N I K V F * I D V P R T S N V I L T R I T K L S D S T S Q D L A I S * * H G S Q K SetI |Hpy166II ||Hpy178III* ApoI ||| TspDTI TspEI \\\ \ \ AATCGGCAAAAGCACCAAACACAGACATATCAAAGGTTCACGACTAAAATACCAAAATTC 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGCCGTTTTCGTGGTTTGTGTCTGTATAGTTTCCAAGTGCTGATTTTATGGTTTTAAG / / / / / / MseI SetI | | TspDTI TspEI | Hpy178III* ApoI Hpy166II N R Q K H Q T Q T Y Q R F T T K I P K F I G K S T K H R H I K G S R L K Y Q N S S A K A P N T D I S K V H D * N T K I H ----:----|----:----|----:----|----:----|----:----|----:----| L R C F C W V C V Y * L N V V L I G F N * D A F A G F V S M D F T * S * F V L I I P L L V L C L C I L P E R S F Y W F E AsuI* AvaII |BmgT120I || Hpy166II || | SetI XmnI SetI || BsrI | |FokI \ \ \\ \ \ \\ ATACGAACCCTTTCAATACCTACATACTGACATATTTGGTCCAGTTCACAACCTACCAAA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TATGCTTGGGAAAGTTATGGATGTATGACTGTATAAACCAGGTCAAGTGTTGGATGGTTT / / /// / / / XmnI SetI ||| | SetI FokI ||| Hpy166II ||AvaII ||AsuI* |BmgT120I BsrI I R T L S I P T Y * H I W S S S Q P T K Y E P F Q Y L H T D I F G P V H N L P K T N P F N T Y I L T Y L V Q F T T Y Q K ----:----|----:----|----:----|----:----|----:----|----:----| M R V R E I G V Y Q C I Q D L E C G V L * V F G K L V * M S V Y K T W N V V * W Y S G K * Y R C V S M N P G T * L R G F ApaLI | CviRI* | Hpy166II | | SduI | | BseSI | | TspDTI TspGWI | | HgiAI* | ApoI | | |BseGI BccI BsmAI | TspEI \ \ \\ \ \ \ \ AAGTGCACCATCCTATTTCATCTCATTTACTGATGAGACAACAAAATTCCGTTGGGTTTA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TTCACGTGGTAGGATAAAGTAGAGTAAATGACTACTCTGTTGTTTTAAGGCAACCCAAAT / /// / / / / | ||ApaLI BccI | TspGWI TspEI | |BseGI BsmAI ApoI | Hpy166II | CviRI* | TspDTI HgiAI* BseSI SduI K C T I L F H L I Y * * D N K I P L G L S A P S Y F I S F T D E T T K F R W V Y V H H P I S S H L L M R Q Q N S V G F I ----:----|----:----|----:----|----:----|----:----|----:----| F H V M R N * R M * Q H S L L I G N P K F T C W G I E D * K S I L C C F E T P N L A G D * K M E N V S S V V F N R Q T * MnlI McrI* |Tsp4CI* || MlyI || PleI || Hpy178III* || |NruI || |Hpy99I MaeI || |FnuDII* | AluI || ||BsiYI* | CviJI || ||| HinfI TaqI MnlI | | SetI \\ \\\ \ \ \ \ \ \ TCCATTACACGACCGTCGCGAGGACTCTATCCTCGATGTTTTTACTACGATACTAGCTTT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTAATGTGCTGGCAGCGCTCCTGAGATAGGAGCTACAAAAATGATGCTATGATCGAAA /// //// / / / /// ||| |||| HinfI TaqI MnlI ||CviJI ||| |||Hpy178III* ||AluI ||| ||FnuDII* |MaeI ||| ||NruI SetI ||| ||PleI ||| |MlyI ||| BsiYI* ||Tsp4CI* ||Hpy99I |MnlI McrI* S I T R P S R G L Y P R C F Y Y D T S F P L H D R R E D S I L D V F T T I L A F H Y T T V A R T L S S M F L L R Y * L L ----:----|----:----|----:----|----:----|----:----|----:----| D M V R G D R P S * G R H K * * S V L K I W * V V T A L V R D E I N K S R Y * S G N C S R R S S E I R S T K V V I S A K AsuI* AvaII |BmgT120I ||BseMII |||SecI* |||DsaI* |||BspCNI ||||Tsp4CI* BsiYI* ||||| DdeI | TsoI ||||| |Hpy188I | CviJI ||||| || AccI | HaeIII TspRI ||||| || |BssNAI MseI BsrI | |BsrI BstXI ||||| || |Hpy166II \ \ \ \\ \ \\\\\ \\ \\ TATTAAGAACCAGTTTCAGGCCAGTGTCTTGGTTATACAAATGGACCGTGGTTCTGAGTA 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| ATAATTCTTGGTCAAAGTCCGGTCACAGAACCAATATGTTTACCTGGCACCAAGACTCAT / / / /// / //// / / / / | BsrI | ||| BstXI |||| | | | Hpy166II MseI | ||HaeIII |||| | | | BssNAI | ||CviJI |||| | | DdeI | |TspRI |||| | Hpy188I | |BsrI |||| DsaI* | TsoI |||| SecI* BsiYI* |||Tsp4CI* |||AvaII |||AsuI* ||BmgT120I |BspCNI BseMII Y * E P V S G Q C L G Y T N G P W F * V I K N Q F Q A S V L V I Q M D R G S E Y L R T S F R P V S W L Y K W T V V L S I ----:----|----:----|----:----|----:----|----:----|----:----| * * S G T E P W H R P * V F P G H N Q T K N L V L K L G T D Q N Y L H V T T R L I L F W N * A L T K T I C I S R P E S Y FatI ApoI |CviAII TspEI || NlaIII \ \\ \ TACTAACAGAACTCTCCATAAATTCCTTGAAAAAAATGGTATAACTCCATGCTATACAAC 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| ATGATTGTCTTGAGAGGTATTTAAGGAACTTTTTTTACCATATTGAGGTACGATATGTTG / / / // AccI TspEI | |FatI ApoI | CviAII NlaIII Y * Q N S P * I P * K K W Y N S M L Y N T N R T L H K F L E K N G I T P C Y T T L T E L S I N S L K K M V * L H A I Q P ----:----|----:----|----:----|----:----|----:----|----:----| Y * C F E G Y I G Q F F H Y L E M S Y L I S V S S E M F E K F F I T Y S W A I C V L L V R W L N R S F F P I V G H * V V AciI NspBII* | TfiI | HinfI | | AvaI | | Hpy178III* | | |BmeT110I | | || FatI Tsp4CI* | | || SduI |Csp6I | | || HgiAI* ||RsaI | | || |CviAII PleI ||| BceAI | | || || NlaIII |MlyI ||| | SetI | | || || |HinfI || CviJI ||| | BceAI \ \ \\ \\ \\ \\ \ \\\ \ \ CACAGCGGATTCCCGAGCACATGGAGTCGCTGAACGGCTCAACCGTACCTTATTAGATGA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTCGCCTAAGGGCTCGTGTACCTCAGCGACTTGCCGAGTTGGCATGGAATAATCTACT / / / /// / // / / / / // / / | | | ||| | || HinfI | CviJI | || | BceAI | | | ||| | |FatI PleI | || BceAI | | | ||| | CviAII MlyI | |Csp6I | | | ||| NlaIII | RsaI | | | ||AvaI | SetI | | | |BmeT110I Tsp4CI* | | | |HgiAI* | | | |SduI | | | Hpy178III* | | HinfI | | TfiI | AciI NspBII* H S G F P S T W S R * T A Q P Y L I R * T A D S R A H G V A E R L N R T L L D D Q R I P E H M E S L N G S T V P Y * M T ----:----|----:----|----:----|----:----|----:----|----:----| W L P N G L V H L R Q V A * G Y R I L H G C R I G S C M S D S F P E V T G * * I V A S E R A C P T A S R S L R V K N S S CviRI* | TaqI Csp6I | | ApoI |RsaI CviRI* BsrDI Hpy166II | | TspEI \\ \ \ \ \ \ \ CTGCCGTACTCAACTGCAATGTAGTGGTTTACCGAACCATTTATGGTTCTCTGCAATCGA 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| GACGGCATGAGTTGACGTTACATCACCAAATGGCTTGGTAAATACCAAGAGACGTTAGCT // / / / / / |Csp6I | BsrDI Hpy166II | TaqI RsaI CviRI* CviRI* L P Y S T A M * W F T E P F M V L C N R C R T Q L Q C S G L P N H L W F S A I E A V L N C N V V V Y R T I Y G S L Q S N ----:----|----:----|----:----|----:----|----:----|----:----| S G Y E V A I Y H N V S G N I T R Q L R V A T S L Q L T T T * R V M * P E R C D Q R V * S C H L P K G F W K H N E A I S ApoI TspEI | HphI | | MaeI | | | AluI | | | CviJI | | | | SetI SetI CviRI* \ \ \ \ \ \ \ ATTTTCTACTATTGTGAGAAATTCACTAGCTTCACCTAAAAGCAAAAAATCTGCAAGACA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAGATGATAACACTCTTTAAGTGATCGAAGTGGATTTTCGTTTTTTAGACGTTCTGT / / /// / / TspEI | ||| SetI CviRI* ApoI | ||CviJI | ||AluI | |MaeI | SetI TspEI ApoI HphI I F Y Y C E K F T S F T * K Q K I C K T F S T I V R N S L A S P K S K K S A R Q F L L L * E I H * L H L K A K N L Q D N ----:----|----:----|----:----|----:----|----:----|----:----| I K * * Q S F N V L K V * F C F I Q L V F K R S N H S I * * S * R F A F F R C S N E V I T L F E S A E G L L L F D A L C EcoRV FatI | TatI |CviAII | |Csp6I || NspI | ||RsaI || NlaIII | ||ScaI || | Cac8I | ||| TaqII || | | Hin4I | ||| |MaeIII || | | Hin4I | ||| || Hin4I HindII || | | CviJI | ||| || Hin4I Hpy166II || | | | MwoI | ||| || | SetI | SetI \\ \ \ \ \ \ \\\ \\ \ \ \ \ ACATGCTGGCTTGGCAGGACTTGATATCAGTACTTTGTTACCTTTCGGTCAACCTGTTAT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TGTACGACCGAACCGTCCTGAACTATAGTCATGAAACAATGGAAAGCCAGTTGGACAATA / // /// / /// / / / // | || ||CviJI EcoRV ||| | | MaeIII |SetI | || |MwoI ||| | SetI Hpy166II | || Cac8I ||| Hin4I HindII | |FatI ||| Hin4I | CviAII ||TaqII | Hin4I ||TatI | Hin4I |Csp6I NlaIII ScaI NspI RsaI T C W L G R T * Y Q Y F V T F R S T C Y H A G L A G L D I S T L L P F G Q P V I M L A W Q D L I S V L C Y L S V N L L S ----:----|----:----|----:----|----:----|----:----|----:----| V H Q S P L V Q Y * Y K T V K R D V Q * L M S A Q C S K I D T S Q * R E T L R N C A P K A P S S I L V K N G K P * G T I BseGI | MnlI | |BssKI | |SecI* | |EcoRII | || FokI | || MwoI BsaXI FokI | || ScrFI | MboI | BseGI | || BseBI | BclI | | BsaXI | || | CviJI | | DpnI | | |MslI | || | SfaNI | | |BstKTI FokI | | |BsiI* | || | | TspGWI \ \ \\ \ \ \ \\ \ \\ \ \ \ CGTCAATGATCACAACCCTAACTCCAAAATACATCCTCGTGGCATCCCAGGCTACGCTCT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| GCAGTTACTAGTGTTGGGATTGAGGTTTTATGTAGGAGCACCGTAGGGTCCGATGCGAGA / // / / / // / / // //// / / BsaXI || BclI FokI | || | | || |||| | BseGI || MboI | || | | || |||| SfaNI |DpnI | || | | || |||TspGWI BstKTI | || | | || |||FokI | || | | || ||EcoRII | || | | || ||BssKI | || | | || ||CviJI | || | | || |SecI* | || | | || BseBI | || | | || ScrFI | || | | |MwoI | || | | MnlI | || | BsiI* | || | BseGI | || MslI | |FokI | BsaXI BseGI R Q * S Q P * L Q N T S S W H P R L R S V N D H N P N S K I H P R G I P G Y A L S M I T T L T P K Y I L V A S Q A T L Y ----:----|----:----|----:----|----:----|----:----|----:----| R * H D C G * S W F V D E H C G L S R E D D I I V V R V G F Y M R T A D W A V S T L S * L G L E L I C G R P M G P * A R Hpy178III* |TaqI || BsmAI MseI || Esp3I Hin4I || | Hin4I FokI Hin4I Tsp4CI* BseGI || | Hin4I |MboII BseGI | BccI |BbvII* \ \\ \ \ \\ \ \ \ \\ ACATCCGTCTCGAAACTCTTATGGATATATCATCTATCTTCCATCCTTAAAGAAGACAGT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAGGCAGAGCTTTGAGAATACCTATATAGTAGATAGAAGGTAGGAATTTCTTCTGTCA /// / / / / / // / ||| Esp3I | FokI | Hin4I |BccI Tsp4CI* ||| BsmAI MboII | Hin4I MseI ||TaqI BseGI |Hpy178III* Hin4I Hin4I T S V S K L L W I Y H L S S I L K E D S H P S R N S Y G Y I I Y L P S L K K T V I R L E T L M D I S S I F H P * R R Q * ----:----|----:----|----:----|----:----|----:----|----:----| V D T E F S K H I Y * R D E M R L S S L * M R R S V R I S I D D I K W G * L L C C G D R F E * P Y I M * R G D K F F V T TfiI HinfI | Hpy178III* | | MboI MboII | | | DpnI | Eco57I | | | |BstKTI | Eco57MI | | | ||TspEI | | MboII | | | ||| TspEI \ \ \ \ \ \ \\\ \ AGATACAACTAACTATGTTATTCTTCAGGGCAAGGAATCCAGATTAGATCAATTCAATTA 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| TCTATGTTGATTGATACAATAAGAAGTCCCGTTCCTTAGGTCTAATCTAGTTAAGTTAAT / / / / / // / / // | | MboII | | || | | |Hpy99I | Eco57MI | | || | | TspEI | Eco57I | | || | TspEI BbvII* | | || MboI MboII | | |DpnI | | BstKTI | Hpy178III* HinfI TfiI R Y N * L C Y S S G Q G I Q I R S I Q L D T T N Y V I L Q G K E S R L D Q F N Y I Q L T M L F F R A R N P D * I N S I T ----:----|----:----|----:----|----:----|----:----|----:----| L Y L * S H * E E P C P I W I L D I * N Y I C S V I N N K L A L F G S * I L E I S V V L * T I R * P L S D L N S * N L * MseI |BbvII* || MboII Hpy99I || Tsp4CI* | HgaI || |TspDTI TspDTI | | TaqI || || MseI | HgaI BsrDI \ \ \ \\ \\ \ \ \ \ CGACGCACTCACTTTCGATGAAGACTTAAACCGTTTAACTGCTTCATATCAATCGTTCAT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| GCTGCGTGAGTGAAAGCTACTTCTGAATTTGGCAAATTGACGAAGTATAGTTAGCAAGTA // / / / / // |TaqI | | MseI TspDTI |HgaI HgaI | Tsp4CI* BsrDI | TspDTI | BbvII* | MboII MseI R R T H F R * R L K P F N C F I S I V H D A L T F D E D L N R L T A S Y Q S F I T H S L S M K T * T V * L L H I N R S L ----:----|----:----|----:----|----:----|----:----|----:----| R R V * K R H L S L G N L Q K M D I T * V V C E S E I F V * V T * S S * I L R E S A S V K S S S K F R K V A E Y * D N M MmeI |TfiI |HinfI || Hin4I BinI* Hpy188I || Hin4I | MboI | MboI || | Hpy188I | XhoII | | DpnI || | | FatI | | DpnI | | |BstKTI || | | |CviAII | | |BstKTI | | || MseI || | | || NlaIII \ \ \\ \ \ \\ \ \\ \ \ \\ \ TGCGTCAAATGAGATCCAACAATCCGATGATCTTAACATAGAATCTGACCATGACTTCCA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| ACGCAGTTTACTCTAGGTTGTTAGGCTACTAGAATTGTATCTTAGACTGGTACTGAAGGT / // / / // / / // // / // | || XhoII | || | | || || | |FatI | || MboI | || | | || || | CviAII | |DpnI | || | | || || NlaIII | BstKTI | || | | || |Hpy188I BinI* | || | | || HinfI | || | | || TfiI | || | | |Hin4I | || | | |Hin4I | || | | MmeI | || | MseI | || MboI | |DpnI | BstKTI Hpy188I C V K * D P T I R * S * H R I * P * L P A S N E I Q Q S D D L N I E S D H D F Q R Q M R S N N P M I L T * N L T M T S N ----:----|----:----|----:----|----:----|----:----|----:----| Q T L H S G V I R H D * C L I Q G H S G N R * I L D L L G I I K V Y F R V M V E A D F S I W C D S S R L M S D S W S K W FokI |Hpy188I || TaqI || | BseMII || | |BspCNI || | || BseGI || | || Hin4I || | || Hin4I AluI || | || | Hpy178III* CviJI || | || | |DdeI | SetI || | || | |Bpu10I | | HinfI \\ \ \\ \ \\ \ \ \ ATCTGACATCGAACTACATCCTGAGCAACCGAGAAATGTCCTTTCAAAAGCTGTGAGTCC 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| TAGACTGTAGCTTGATGTAGGACTCGTTGGCTCTTTACAGGAAAGTTTTCGACACTCAGG / / // / / / / / / | | || BseGI | Bpu10I | CviJI HinfI | | |BspCNI | DdeI | AluI | | |Hin4I Hpy178III* SetI | | |Hin4I | | |TaqI | | BseMII | FokI Hpy188I I * H R T T S * A T E K C P F K S C E S S D I E L H P E Q P R N V L S K A V S P L T S N Y I L S N R E M S F Q K L * V Q ----:----|----:----|----:----|----:----|----:----|----:----| I Q C R V V D Q A V S F H G K L L Q S D L R V D F * M R L L R S I D K * F S H T D S M S S C G S C G L F T R E F A T L G TfiI HinfI | TaqI | AsuII PleI | | MaeII |MlyI HindII | | AflIII ||TfiI Hpy166II | | |MboII ||HinfI | MmeI | | || SetI Eco57I |||TspGWI SetI | |MnlI | | || TaiI Eco57MI \\\\ \ \ \\ \ \ \\ \ \ AACCGATTCCACACCTCCGTCAACTCATACTGAAGATTCGAAACGTGTTTCTAAAACCAA 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGCTAAGGTGTGGAGGCAGTTGAGTATGACTTCTAAGCTTTGCACAAAGATTTTGGTT / / / / / / / // / / / | | SetI | MnlI | | || | | Eco57MI | HinfI Hpy166II | | || | | Eco57I | TfiI HindII | | || | AflIII TspGWI MmeI | | || MaeII PleI | | |MboII MlyI | | TaiI | | SetI | AsuII | TaqI HinfI TfiI N R F H T S V N S Y * R F E T C F * N Q T D S T P P S T H T E D S K R V S K T N P I P H L R Q L I L K I R N V F L K P I ----:----|----:----|----:----|----:----|----:----|----:----| L R N W V E T L E Y Q L N S V H K * F W W G I G C R R * S M S F I R F T N R F G V S E V G G D V * V S S E F R T E L V L Hpy188I Hin6I |TfiI FnuDII* HindII |HinfI |GlaI Hpy166II || MboII SspI ||HhaI | TaqII || | SspI Ksp632I* \ \\\ \ \ \\ \ \ \ TATTCGCGCACCCAGAGAAGTTGACCCCAACATATCTGAATCTAATATTCTTCCATCAAA 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAGCGCGTGGGTCTCTTCAACTGGGGTTGTATAGACTTAGATTATAAGAAGGTAGTTT / /// // / // / / SspI ||Hin6I |TaqII | || SspI Ksp632I* |GlaI Hpy166II | |HinfI FnuDII* HindII | |TfiI HhaI | MboII Hpy188I Y S R T Q R S * P Q H I * I * Y S S I K I R A P R E V D P N I S E S N I L P S K F A H P E K L T P T Y L N L I F F H Q R ----:----|----:----|----:----|----:----|----:----|----:----| Y E R V W L L Q G W C I Q I * Y E E M L I N A C G S F N V G V Y R F R I N K W * I R A G L S T S G L M D S D L I R G D F BccI TaqI | MboI |Hpy178III* | BglII || Csp6I | XhoII || |RsaI | | DpnI || ||AgeI | | |BstKTI || ||BetI* CviRI* | | ||MaeI ApoI || ||Cfr10I | PpiI | | ||| MboII TspEI PpiI || |||HpaII | EcoT22I \ \ \\\ \ \ \ \\ \\\\ \ \ GAAGAGATCTAGCACCCCCCAAATTTCCAATATCGAGAGTACCGGTTCGGGTGGTATGCA 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTCTAGATCGTGGGGGGTTTAAAGGTTATAGCTCTCATGGCCAAGCCCACCATACGT / // / // / / // // // // / | || | |MboII | TspEI || || |Cfr10I || CviRI* | || | MaeI | ApoI || || |BetI* |EcoT22I | || XhoII PpiI || || |AgeI PpiI | || BglII || || HpaII | || MboI || |Csp6I | |DpnI || RsaI | BstKTI |Hpy178III* BccI TaqI E E I * H P P N F Q Y R E Y R F G W Y A K R S S T P Q I S N I E S T G S G G M H R D L A P P K F P I S R V P V R V V C I ----:----|----:----|----:----|----:----|----:----|----:----| S S I * C G G F K W Y R S Y R N P H Y A L L S R A G G L N G I D L T G T R T T H F L D L V G W I E L I S L V P E P P I C FatI PleI FatI |CviAII Hpy99I TspEI |CviAII || HinfI |MlyI | MseI BslFI || NlaIII || NlaIII ||Cac8I \ \ \ \\ \ \\ \ \\\ TAAATTAAATGTTCCTTTACTTGCTCCCATGTCCCAATCTAACACACATGAGTCGTCGCA 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| ATTTAATTTACAAGGAAATGAACGAGGGTACAGGGTTAGATTGTGTGTACTCAGCAGCGT // / / // / // / // |MseI BslFI | |FatI | || | |Cac8I TspEI | CviAII | || | PleI NlaIII | || | MlyI | || Hpy99I | || HinfI | |FatI | CviAII NlaIII * I K C S F T C S H V P I * H T * V V A K L N V P L L A P M S Q S N T H E S S H N * M F L Y L L P C P N L T H M S R R T ----:----|----:----|----:----|----:----|----:----|----:----| Y I L H E K V Q E W T G I * C V H T T A M F * I N R * K S G H G L R V C M L R R L N F T G K S A G M D W D L V C S D D C Hpy188I | MlyI | PleI | | DdeI | | | Hpy188I | | | |HinfI | | | || Csp6I | | | || |BdaI | | | || |BdaI | | | || |RsaI | | | || || BspCNI | | | || || Tsp4CI* | | | || || |BseMII | | | || || || BsmAI | | | || || || | TspRI BsrI | | | || || || | | BaeI \ \ \ \ \\ \\ \\ \ \ \ CGCCAGTAAATCTAAAGATTTCAGACACTCAGACTCGTACAGTGAAAATGAGACTAATCA 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| GCGGTCATTTAGATTTCTAAAGTCTGTGAGTCTGAGCATGTCACTTTTACTCTGATTAGT / / // // ////// / / BsrI | || || |||||| | BsmAI | || || |||||| BaeI | || || |||||Tsp4CI* | || || |||||BseMII | || || ||||BspCNI | || || ||||Csp6I | || || |||RsaI | || || ||TspRI | || || |BdaI | || || |BdaI | || || HinfI | || |DdeI | || Hpy188I | |PleI | MlyI Hpy188I R Q * I * R F Q T L R L V Q * K * D * S A S K S K D F R H S D S Y S E N E T N H P V N L K I S D T Q T R T V K M R L I I ----:----|----:----|----:----|----:----|----:----|----:----| R W Y I * L N * V S L S T C H F H S * D V G T F R F I E S V * V R V T F I L S I A L L D L S K L C E S E Y L S F S V L * MaeII | Csp6I Acc65I | |RsaI HgiCI* | |SetI BsrI |Csp6I | |TaiI | Csp6I ||RsaI | || BdaI | |RsaI ||NlaIV Tsp4CI* MaeIII | || BdaI | || BaeI ||| KpnI | AciI Tsp45I \ \\ \ \ \\ \ \\\ \ \ \ \ TACAAACGTACCAATATCCAGTACGGGTGGTACCAACAACAAAACTGTTCCGCAGATAAG 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTTGCATGGTTATAGGTCATGCCCACCATGGTTGTTGTTTTGACAAGGCGTCTATTC / /// / / // / /// / / | ||Csp6I | | |Csp6I | ||HgiCI* | AciI | ||BdaI | | RsaI | ||Acc65I Tsp4CI* | ||BdaI | BaeI | |Csp6I | |RsaI BsrI | NlaIV | MaeII | RsaI TaiI KpnI SetI Y K R T N I Q Y G W Y Q Q Q N C S A D K T N V P I S S T G G T N N K T V P Q I S Q T Y Q Y P V R V V P T T K L F R R * V ----:----|----:----|----:----|----:----|----:----|----:----| Y L R V L I W Y P H Y W C C F Q E A S L M C V Y W Y G T R T T G V V F S N R L Y V F T G I D L V P P V L L L V T G C I L Tsp4CI* BtgZI BsmAI | Hpy166II TaqI |BetI* |BseMII | | SfaNI ClaI ||HpaII ||BspCNI DdeI HphI | | | SetI | Hin4II* |||TspDTI \\\ \ \ \ \ \ \ \ \ \\\\ TGACCAAGAGACTGAGAAAAGGATTATACACCGTTCACCTTCAATCGATGCTTCTCCACC 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| ACTGGTTCTCTGACTCTTTTCCTAATATGTGGCAAGTGGAAGTTAGCTACGAAGAGGTGG // / / / / / // / / / || | BsmAI DdeI HphI | |SetI SfaNI Hin4II* TspDTI || Tsp45I | Hpy166II ClaI || MaeIII Tsp4CI* TaqI |BspCNI BseMII * P R D * E K D Y T P F T F N R C F S T D Q E T E K R I I H R S P S I D A S P P T K R L R K G L Y T V H L Q S M L L H R ----:----|----:----|----:----|----:----|----:----|----:----| H G L S Q S F S * V G N V K L R H K E V T V L L S L F P N Y V T * R * D I S R W S W S V S F L I I C R E G E I S A E G G Tsp4CI* TspEI SspI AjuI | Hpy188I \ \ \ \ \ GGAAAATAATTCATCGCACAATATTGTTCCTATCAAAACGCCAACTACTGTTTCTGAACA 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTTTATTAAGTAGCGTGTTATAACAAGGATAGTTTTGCGGTTGATGACAAAGACTTGT // / / / / / / |BetI* TspEI SspI AjuI | | MnlI HpaII | Hpy188I BtgZI Tsp4CI* G K * F I A Q Y C S Y Q N A N Y C F * T E N N S S H N I V P I K T P T T V S E Q K I I H R T I L F L S K R Q L L F L N R ----:----|----:----|----:----|----:----|----:----|----:----| P F Y N M A C Y Q E * * F A L * Q K Q V R F I I * R V I N N R D F R W S S N R F S F L E D C L I T G I L V G V V T E S C MboI | DpnI | |BstKTI | || GsuI | || Eco57MI | || | MboI | || | | DpnI MnlI | || | | |BstKTI | BtgZI | || | | || SetI | | AjuI | || | | || |Hpy178III* | | SecI* | || | | || || TfiI | | | TfiI | || | | || || HinfI | | | HinfI | || | | || || | MnlI \ \ \ \ \ \\ \ \ \\ \\ \ \ GAATACCGAGGAATCTATCATCGCTGATCTCCCACTCCCTGATCTACCTCCAGAATCTCC 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATGGCTCCTTAGATAGTAGCGACTAGAGGGTGAGGGACTAGATGGAGGTCTTAGAGG / / / / // / / // // / / AjuI | | HinfI || | Eco57MI || |SetI | HinfI | | TfiI || | GsuI || MboI | MnlI | SecI* || MboI |DpnI | TfiI BtgZI |DpnI BstKTI Hpy178III* BstKTI E Y R G I Y H R * S P T P * S T S R I S N T E E S I I A D L P L P D L P P E S P I P R N L S S L I S H S L I Y L Q N L L ----:----|----:----|----:----|----:----|----:----|----:----| S Y R P I * * R Q D G V G Q D V E L I E L I G L F R D D S I E W E R I * R W F R F V S S D I M A S R G S G S R G G S D G TspEI ApoI MseI |TaqII TspEI |AhaIII* ApoI || BsrI EcoRI || Hin4I TspEI || Hin4I \ \\ \ \ \\ \ TACCGAATTCCCTGACCCATTTAAAGAACTCCCACCGATAAATTCTCATCAAACTAATTC 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGCTTAAGGGACTGGGTAAATTTCTTGAGGGTGGCTATTTAAGAGTAGTTTGATTAAG / // / // // EcoRI |Hin4I TspEI || |TspEI TspEI |MseI ApoI || BsrI ApoI AhaIII* |Hin4I TaqII Y R I P * P I * R T P T D K F S S N * F T E F P D P F K E L P P I N S H Q T N S P N S L T H L K N S H R * I L I K L I P ----:----|----:----|----:----|----:----|----:----|----:----| * R I G Q G M * L V G V S L N E D F * N R G F E R V W K F F E W R Y I R M L S I V S N G S G N L S S G G I F E * * V L E MlyI PleI | MaeIII MboI | Tsp45I | DpnI | | HinfI HphI Tsp4CI* | |BstKTI \ \ \ \ \ \ \\ CAGTTTGGGTGGTATTGGTGACTCTAATGCCTATACTACTATCAACAGTAAGAAAAGATC 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| GTCAAACCCACCATAACCACTGAGATTACGGATATGATGATAGTTGTCATTCTTTTCTAG // // / / // / |PleI || HphI Tsp4CI* || MboI MlyI |HinfI |DpnI Tsp45I BstKTI MaeIII Q F G W Y W * L * C L Y Y Y Q Q * E K I S L G G I G D S N A Y T T I N S K K R S V W V V L V T L M P I L L S T V R K D H ----:----|----:----|----:----|----:----|----:----|----:----| W N P H Y Q H S * H R Y * * * C Y S F I G T Q T T N T V R I G I S S D V T L F S L K P P I P S E L A * V V I L L L F L D MboII | TspEI | | MseI | | | TspDTI | | | | SetI | | | | BsmAI | | | | | BsiI* | | | | | Hpy178III* | | | | | | FatI | | | | | | |CviAII | | | | | | || NlaIII | | | | | | || | DdeI \ \ \ \ \ \ \\ \ \ ATTAGAAGATAATGAAACTGAAATTAAGGTATCACGAGACACATGGAATACTAAGAATAT 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| TAATCTTCTATTACTTTGACTTTAATTCCATAGTGCTCTGTGTACCTTATGATTCTTATA / // // / / // / MboII |MseI || | | |FatI DdeI |SetI || | | CviAII TspDTI || | NlaIII TspEI || BsiI* |Hpy178III* BsmAI I R R * * N * N * G I T R H M E Y * E Y L E D N E T E I K V S R D T W N T K N M * K I M K L K L R Y H E T H G I L R I C ----:----|----:----|----:----|----:----|----:----|----:----| M L L Y H F Q F * P I V L C M S Y * S Y * * F I I F S F N L Y * S V C P I S L I N S S L S V S I L T D R S V H F V L F I SetI | Hpy188I TseI | | MboI CviRI* | | | DpnI |BisI | | | |TaqI ||BlsI | | | |BstKTI |||AluI | | | || HphI |||CviJI | | | || | ApoI |||PvuII | | | || | TspEI |||NspBII* | | | || | EcoRI |||| SetI | | | || | | MboII |||| | MwoI | | | ||MnlI | | | SetI |||| | | BbvI \ \ \ \\\ \ \ \ \ \\\\ \ \ \ GCGTAGTTTAGAACCTCCGAGATCGAAGAAACGAATTCACCTGATTGCAGCTGTAAAAGC 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| CGCATCAAATCTTGGAGGCTCTAGCTTCTTTGCTTAAGTGGACTAACGTCGACATTTTCG / / ///// / /// //// / SetI | ||||| HphI ||SetI |||| MwoI | ||||TaqI |EcoRI |||NspBII* | |||MboI |TspEI |||PvuII | ||MnlI |ApoI |||CviJI | |DpnI MboII |||TseI | BstKTI |||AluI Hpy188I ||BisI |BlsI |SetI CviRI* A * F R T S E I E E T N S P D C S C K S R S L E P P R S K K R I H L I A A V K A V V * N L R D R R N E F T * L Q L * K Q ----:----|----:----|----:----|----:----|----:----|----:----| A Y N L V E S I S S V F E G S Q L Q L L H T T * F R R S R L F S N V Q N C S Y F R L K S G G L D F F R I * R I A A T F A MnlI TspGWI SetI | HphI SetI \ \ \ \ AGTAAAATCAATCAAACCAATACGGACAACCTTACGATACGATGAGGCAATCACCTATAA 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTTTAGTTAGTTTGGTTATGCCTGTTGGAATGCTATGCTACTCCGTTAGTGGATATT / / // / / BbvI SetI |MnlI HphI SetI TspGWI S K I N Q T N T D N L T I R * G N H L * V K S I K P I R T T L R Y D E A I T Y N * N Q S N Q Y G Q P Y D T M R Q S P I I ----:----|----:----|----:----|----:----|----:----|----:----| L L I L * V L V S L R V I R H P L * R Y C Y F * D F W Y P C G * S V I L C D G I T F D I L G I R V V K R Y S S A I V * L MseI MnlI TaqI Tsp4CI* \ \ \ \ TAAAGATATTAAAGAAAAAGAAAAATATATCGAGGCATACCACAAAGAAGTCAATCAACT 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| ATTTCTATAATTTCTTTTTCTTTTTATATAGCTCCGTATGGTGTTTCTTCAGTTAGTTGA / / / / MseI MnlI TaqI Tsp4CI* * R Y * R K R K I Y R G I P Q R S Q S T K D I K E K E K Y I E A Y H K E V N Q L K I L K K K K N I S R H T T K K S I N C ----:----|----:----|----:----|----:----|----:----|----:----| Y L Y * L F L F I Y R P M G C L L * D V I F I N F F F F F I D L C V V F F D I L L S I L S F S F Y I S A Y W L S T L * S TspDTI | TspRI | | SspI MboII | | BslFI \ \ \ \ GTTGAAGATGAAAACTTGGGACACTGACGAATATTATGACAGAAAAGAAATAGACCCTAA 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTTCTACTTTTGAACCCTGTGACTGCTTATAATACTGTCTTTTCTTTATCTGGGATT / / / / / | | TspDTI | BslFI | TspRI SspI MboII V E D E N L G H * R I L * Q K R N R P * L K M K T W D T D E Y Y D R K E I D P K * R * K L G T L T N I M T E K K * T L K ----:----|----:----|----:----|----:----|----:----|----:----| T S S S F K P C Q R I N H C F L F L G * Q Q L H F S P V S V F I I V S F F Y V R N F I F V Q S V S S Y * S L F S I S G L MaeII |MaeIII |Tsp45I || SetI || TaiI AluI || | Tsp4CI* CviJI BdaI || | |Csp6I |MaeI MboII BdaI || | ||RsaI ||SetI \ \ \\ \ \\\ \\\ AAGAGTAATAAACTCAATGTTTATCTTCAACAAGAAACGTGACGGTACTCATAAAGCTAG 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTCATTATTTGAGTTACAAATAGAAGTTGTTCTTTGCACTGCCATGAGTATTTCGATC / / / / / // / / / MboII BdaI | | | |Csp6I | | MaeI BdaI | | | RsaI | CviJI | | Tsp4CI* | AluI | | Tsp45I SetI | | MaeIII | MaeII TaiI SetI K S N K L N V Y L Q Q E T * R Y S * S * R V I N S M F I F N K K R D G T H K A R E * * T Q C L S S T R N V T V L I K L D ----:----|----:----|----:----|----:----|----:----|----:----| F L L L S L T * R * C S V H R Y E Y L * F S Y Y V * H K D E V L F T V T S M F S L T I F E I N I K L L F R S P V * L A L FatI |CviAII ||Cac8I BdaI BseGI ||| SphI BdaI |HphI ||| NspI | MnlI || Hpy178III* ||| CviRI* | | CviRI* || | SfaNI ||| NlaIII | | | FokI || | |MlyI HinfI ||| | BspCNI | | | | SetI || | |PleI | DdeI ||| | |BseMII \ \ \ \ \ \\ \ \\ \ \ \\\ \ \\ ATTTGTTGCAAGAGGTGATATTCAGCATCCTGACACTTACGACTCAGGCATGCAATCCAA 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| TAAACAACGTTCTCCACTATAAGTCGTAGGACTGTGAATGCTGAGTCCGTACGTTAGGTT / / / / / / / / // / / / / /// // | | | | FokI | HphI | || SfaNI | | | ||| |BseMII | | | SetI BseGI | |PleI | | | ||| BspCNI | | CviRI* | MlyI | | | ||CviRI* | MnlI Hpy178III* | | | ||FatI BdaI | | | |CviAII BdaI | | | Cac8I | | NlaIII | | NspI | | SphI | DdeI HinfI I C C K R * Y S A S * H L R L R H A I Q F V A R G D I Q H P D T Y D S G M Q S N L L Q E V I F S I L T L T T Q A C N P I ----:----|----:----|----:----|----:----|----:----|----:----| I Q Q L L H Y E A D Q C K R S L C A I W S K N C S T I N L M R V S V V * A H L G N T A L P S I * C G S V * S E P M C D L MslI |FokI || CviRI* || | EcoT22I || | | BseGI Tsp4CI* || | | | DrdI |Csp6I || | |MseI | | MaeIII ||RsaI || | |VspI | | Tsp45I CviRI* \\\ \\ \ \\ \ \ \ \ TACCGTACATCACTATGCATTAATGACATCCCTGTCACTTGCATTAGACAATAACTACTA 4270 4280 4290 4300 4310 4320 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGCATGTAGTGATACGTAATTACTGTAGGGACAGTGAACGTAATCTGTTATTGATGAT / // / / / / / / / / | || | | | | | DrdI | CviRI* | || | | | | BseGI Tsp45I | || | | | VspI MaeIII | || | | | MseI | || | | CviRI* | || | | FokI | || | EcoT22I | || MslI | |Csp6I | RsaI Tsp4CI* Y R T S L C I N D I P V T C I R Q * L L T V H H Y A L M T S L S L A L D N N Y Y P Y I T M H * * H P C H L H * T I T T I ----:----|----:----|----:----|----:----|----:----|----:----| Y R V D S H M L S M G T V Q M L C Y S S I G Y M V I C * H C G Q * K C * V I V V V T C * * A N I V D R D S A N S L L * * TspEI | MboII CviRI* TspEI \ \ \ \ TATTACACAATTAGACATATCTTCGGCATATTTGTATGCAGACATCAAAGAAGAATTATA 4330 4340 4350 4360 4370 4380 ----:----|----:----|----:----|----:----|----:----|----:----| ATAATGTGTTAATCTGTATAGAAGCCGTATAAACATACGTCTGTAGTTTCTTCTTAATAT // / / |TspEI CviRI* TspEI MboII Y Y T I R H I F G I F V C R H Q R R I I I T Q L D I S S A Y L Y A D I K E E L Y L H N * T Y L R H I C M Q T S K K N Y T ----:----|----:----|----:----|----:----|----:----|----:----| Y * V I L C I K P M N T H L C * L L I I I N C L * V Y R R C I Q I C V D F F F * I V C N S M D E A Y K Y A S M L S S N Y TspDTI | MaeII MnlI | | SetI MboII SetI | BsiYI* | | TaiI \ \ \ \ \ \ \ CATAAGACCTCCACCACATTTAGGAATGAATGATAAGTTGATACGTTTGAAGAAATCACT 4390 4400 4410 4420 4430 4440 ----:----|----:----|----:----|----:----|----:----|----:----| GTATTCTGGAGGTGGTGTAAATCCTTACTTACTATTCAACTATGCAAACTTCTTTAGTGA / / / / / / / | SetI BsiYI* | | MaeII MboII MboII MnlI | TaiI | SetI TspDTI H K T S T T F R N E * * V D T F E E I T I R P P P H L G M N D K L I R L K K S L * D L H H I * E * M I S * Y V * R N H F ----:----|----:----|----:----|----:----|----:----|----:----| C L V E V V N L F S H Y T S V N S S I V V Y S R W W M * S H I I L Q Y T Q L F * M L G G G C K P I F S L N I R K F F D S Csp6I |RsaI MboII |BsrI SetI \ \\ \ TTATGGATTGAAACAAAGTGGAGCGAACTGGTACGAAACTATCAAATCATACCTGATAAA 4450 4460 4470 4480 4490 4500 ----:----|----:----|----:----|----:----|----:----|----:----| AATACCTAACTTTGTTTCACCTCGCTTGACCATGCTTTGATAGTTTAGTATGGACTATTT / // / / | |Csp6I SetI TspRI | RsaI BsrI L W I E T K W S E L V R N Y Q I I P D K Y G L K Q S G A N W Y E T I K S Y L I K M D * N K V E R T G T K L S N H T * * N ----:----|----:----|----:----|----:----|----:----|----:----| K H I S V F H L S S T R F * * I M G S L K I S Q F L T S R V P V F S D F * V Q Y * P N F C L P A F Q Y S V I L D Y R I F FatI BseGI |CviAII || NlaIII Tsp4CI* XmnI || | FokI | TspRI | BccI MboII || | | MseI MaeIII \ \ \ \ \ \\ \ \ \ \ ACAGTGTGGTATGGAAGAAGTTCGTGGATGGTCATGCGTATTTAAGAATAGTCAAGTAAC 4510 4520 4530 4540 4550 4560 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCACACCATACCTTCTTCAAGCACCTACCAGTACGCATAAATTCTTATCAGTTCATTG / / / / / / // // / Tsp4CI* | | | | | |FatI |MseI MaeIII | | | | | CviAII FokI | | | | NlaIII | | | BseGI | | MboII | BccI XmnI T V W Y G R S S W M V M R I * E * S S N Q C G M E E V R G W S C V F K N S Q V T S V V W K K F V D G H A Y L R I V K * Q ----:----|----:----|----:----|----:----|----:----|----:----| V T H Y P L L E H I T M R I * S Y D L L F L T T H F F N T S P * A Y K L I T L Y C H P I S S T R P H D H T N L F L * T V BdaI BdaI | HindII | Hpy166II MseI | | FatI | BdaI | | |CviAII | BdaI | | || NlaIII | | CviRI* Bce83I* \ \ \\ \ \ \ \ \ AATATGTTTATTTGTTGACGACATGATTTTATTCAGCAAAGACTTAAATGCAAATAAGAA 4570 4580 4590 4600 4610 4620 ----:----|----:----|----:----|----:----|----:----|----:----| TTATACAAATAAACAACTGCTGTACTAAAATAAGTCGTTTCTGAATTTACGTTTATTCTT / / / // // / / BdaI | | |FatI || CviRI* Bce83I* BdaI | | CviAII |MseI | NlaIII BdaI Hpy166II BdaI HindII N M F I C * R H D F I Q Q R L K C K * E I C L F V D D M I L F S K D L N A N K K Y V Y L L T T * F Y S A K T * M Q I R K ----:----|----:----|----:----|----:----|----:----|----:----| L I N I Q Q R C S K I * C L S L H L Y S C Y T * K N V V H N * E A F V * I C I L I H K N T S S M I K N L L S K F A F L F SmlI Hin4I Hin4I | Hpy178III* Hin4I TaqII Hin4I \ \ \ \ \ AATCATAACAACACTCAAGAAACAATACGATACAAAGATAATAAATCTGGGTGAAAGTGA 4630 4640 4650 4660 4670 4680 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTATTGTTGTGAGTTCTTTGTTATGCTATGTTTCTATTATTTAGACCCACTTTCACT / / / / | Hin4I TaqII Hin4I | Hin4I Hin4I Hpy178III* SmlI N H N N T Q E T I R Y K D N K S G * K * I I T T L K K Q Y D T K I I N L G E S D S * Q H S R N N T I Q R * * I W V K V I ----:----|----:----|----:----|----:----|----:----|----:----| F * L L V * S V I R Y L S L L D P H F H F D Y C C E L F L V I C L Y Y I Q T F T I M V V S L F C Y S V F I I F R P S L S HphI | ApoI Csp6I CviJI FatI | TspEI |RsaI |DdeI MnlI SetI |CviAII \ \ \\ \\ \ \ \\ TAACGAAATTCAGTACGACATACTTGGCTTAGAAATCAAATATCAAAGAGGTAAATACAT 4690 4700 4710 4720 4730 4740 ----:----|----:----|----:----|----:----|----:----|----:----| ATTGCTTTAAGTCATGCTGTATGAACCGAATCTTTAGTTTATAGTTTCTCCATTTATGTA / / // / / / / / / HphI | |Csp6I | DdeI MnlI SetI | CviAII | RsaI CviJI NlaIII TspEI ApoI * R N S V R H T W L R N Q I S K R * I H N E I Q Y D I L G L E I K Y Q R G K Y M T K F S T T Y L A * K S N I K E V N T * ----:----|----:----|----:----|----:----|----:----|----:----| Y R F E T R C V Q S L F * I D F L Y I C I V F N L V V Y K A * F D F I L S T F V L S I * Y S M S P K S I L Y * L P L Y M TspEI | MseI | | MaeII | | | Csp6I SetI | | | |RsaI | TspDTI | | | |SetI | | BseMII | | | |TaiI | | |BspCNI | | | || SetI NlaIII | | || MseI | | | || | TfiI |TspEI | | || | DdeI | | | || | HinfI \\ \ \ \\ \ \ \ \ \ \\ \ \ GAAATTAGGTATGGAAAACTCATTAACTGAGAAAATACCCAAATTAAACGTACCTTTGAA 4750 4760 4770 4780 4790 4800 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAATCCATACCTTTTGAGTAATTGACTCTTTTATGGGTTTAATTTGCATGGAAACTT / / / // / / /// /// FatI TspEI | |BspCNI MseI DdeI ||| ||Csp6I SetI | BseMII ||| |RsaI TspDTI ||| |SetI ||| MaeII ||TaiI ||SetI |MseI TspEI E I R Y G K L I N * E N T Q I K R T F E K L G M E N S L T E K I P K L N V P L N N * V W K T H * L R K Y P N * T Y L * I ----:----|----:----|----:----|----:----|----:----|----:----| S I L Y P F S M L Q S F V W I L R V K S H F * T H F V * * S L F Y G F * V Y R Q F N P I S F E N V S F I G L N F T G K F DdeI | Hin6I | MboII | |GlaI | |Eco47III | ||HhaI | |||HaeII | ||||BssKI | ||||EcoRII | ||||| ScrFI | ||||| BseBI | ||||| | SetI | ||||| | |HindII | ||||| | |Hpy166II | ||||| | || BssKI | ||||| | || SexAI | ||||| | || EcoRII BssKI | ||||| | || | ScrFI EcoRII GsuI | ||||| | || | BseBI | ScrFI Eco57MI | ||||| | || | | SetI | BseBI \ \ \\\\\ \ \\ \ \ \ \ \ TCCAAAAGGAAGAAAACTTAGCGCTCCAGGTCAACCAGGTCTTTATATAGACCAGGATGA 4810 4820 4830 4840 4850 4860 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTTTCCTTCTTTTGAATCGCGAGGTCCAGTTGGTCCAGAAATATATCTGGTCCTACT / / //// // / / // / / / / HinfI Eco57MI |||| || | | || EcoRII | | BseGI TfiI GsuI |||| || | | || SexAI | EcoRII |||| || | | || BssKI | BssKI |||| || | | |BseBI BseBI |||| || | | |ScrFI ScrFI |||| || | | SetI |||| || | Hpy166II |||| || | HindII |||| || EcoRII |||| || BssKI |||| |BseBI |||| |ScrFI |||| SetI |||Hin6I ||Eco47III ||GlaI |HhaI MboII HaeII DdeI S K R K K T * R S R S T R S L Y R P G * P K G R K L S A P G Q P G L Y I D Q D E Q K E E N L A L Q V N Q V F I * T R M N ----:----|----:----|----:----|----:----|----:----|----:----| D L L F F V * R E L D V L D K Y L G P H I W F S S F K A S W T L W T K I Y V L I G F P L F S L A G P * G P R * I S W S S Hin4II* |MboII ||TspDTI ||| TspDTI ||| | Csp6I ||| | |RsaI ||| | |SetI ||| | ||FatI ||| | |||CviAII TspDTI BseGI FokI ||| | |||| NlaIII |MmeI |MaeI | TspDTI ||| | |||| | CviRI* || TspDTI \\ \ \ \\\ \ \\\\ \ \ \\ \ ACTAGAAATAGATGAAGATGAATACAAAGAGAAGGTACATGAAATGCAAAAGTTGATTGG 4870 4880 4890 4900 4910 4920 ----:----|----:----|----:----|----:----|----:----|----:----| TGATCTTTATCTACTTCTACTTATGTTTCTCTTCCATGTACTTTACGTTTTCAACTAACC / / / // // // // / // / MaeI | FokI || || || |FatI | || TspDTI TspDTI || || || | | |MmeI || || || | | TspDTI || || || | CviRI* || || || CviAII || || |NlaIII || || |Csp6I || || RsaI || |SetI || TspDTI |TspDTI |MboII Hin4II* T R N R * R * I Q R E G T * N A K V D W L E I D E D E Y K E K V H E M Q K L I G * K * M K M N T K R R Y M K C K S * L V ----:----|----:----|----:----|----:----|----:----|----:----| V L F L H L H I C L S P V H F A F T S Q F * F Y I F I F V F L L Y M F H L L Q N S S I S S S S Y L S F T C S I C F N I P MaeI | AluI | CviJI | | SetI ApoI | | | NdeI TspEI \ \ \ \ \ TCTAGCTTCATATGTTGGATATAAATTTAGATTTGACTTACTATACTACATCAACACACT 4930 4940 4950 4960 4970 4980 ----:----|----:----|----:----|----:----|----:----|----:----| AGATCGAAGTATACAACCTATATTTAAATCTAAACTGAATGATATGATGTAGTTGTGTGA /// / / ||CviJI NdeI TspEI ||AluI ApoI |MaeI SetI S S F I C W I * I * I * L T I L H Q H T L A S Y V G Y K F R F D L L Y Y I N T L * L H M L D I N L D L T Y Y T T S T H L ----:----|----:----|----:----|----:----|----:----|----:----| D L K M H Q I Y I * I Q S V I S C * C V T * S * I N S I F K S K V * * V V D V C R A E Y T P Y L N L N S K S Y * M L V S FatI |CviAII || BdaI || BdaI || NlaIII || | NdeI || | |CspCI MaeI MnlI || | || TspDTI TspEI \ \ \\ \ \\ \ \ TGCTCAACATATACTATTCCCCTCTAGGCAAGTTTTAGACATGACATATGAGTTGATACA 4990 5000 5010 5020 5030 5040 ----:----|----:----|----:----|----:----|----:----|----:----| ACGAGTTGTATATGATAAGGGGAGATCCGTTCAAAATCTGTACTGTATACTCAACTATGT / / / /// / / / | MnlI | ||| | | TspDTI MaeI | ||| | NdeI | ||| CspCI | ||FatI | |CviAII | BdaI | BdaI NlaIII C S T Y T I P L * A S F R H D I * V D T A Q H I L F P S R Q V L D M T Y E L I Q L N I Y Y S P L G K F * T * H M S * Y N ----:----|----:----|----:----|----:----|----:----|----:----| Q E V Y V I G R * A L K L C S M H T S V K S L M Y * E G R P L N * V H C I L Q Y A * C I S N G E L C T K S M V Y S N I C FatI MaeI |CviAII | BdaI CspCI || NlaIII | BdaI |BslFI SetI CviJI \\ \ \ \ \\ \ \ ATTCATGTGGGACACTAGAGATAAACAACTGATATGGCACAAAAACAAACCTACCGAGCC 5050 5060 5070 5080 5090 5100 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTACACCCTGTGATCTCTATTTGTTGACTATACCGTGTTTTTGTTTGGATGGCTCGG / // / / / / / / | |FatI | | CspCI BslFI SetI CviJI | CviAII | MaeI NlaIII BdaI TspEI BdaI I H V G H * R * T T D M A Q K Q T Y R A F M W D T R D K Q L I W H K N K P T E P S C G T L E I N N * Y G T K T N L P S Q ----:----|----:----|----:----|----:----|----:----|----:----| I * T P C * L Y V V S I A C F C V * R A L E H P V S S I F L Q Y P V F V F R G L N M H S V L S L C S I H C L F L G V S G SpeI |MaeI FalI || FalI FalI || FalI | Tsp4CI* || | SfaNI | | PsiI \\ \ \ \ \ \ AGATAATAAACTAGTCGCAATAAGTGATGCTTCGTATGGCAACCAACCGTATTATAAATC 5110 5120 5130 5140 5150 5160 ----:----|----:----|----:----|----:----|----:----|----:----| TCTATTATTTGATCAGCGTTATTCACTACGAAGCATACCGTTGGTTGGCATAATATTTAG / // / / / / FalI |SpeI SfaNI FalI | PsiI FalI MaeI FalI Tsp4CI* R * * T S R N K * C F V W Q P T V L * I D N K L V A I S D A S Y G N Q P Y Y K S I I N * S Q * V M L R M A T N R I I N H ----:----|----:----|----:----|----:----|----:----|----:----| L Y Y V L R L L H H K T H C G V T N Y I W I I F * D C Y T I S R I A V L R I I F S L L S T A I L S A E Y P L W G Y * L D TspDTI Hpy166II MnlI | StyI |SetI | SecI* TspEI MseI |TspEI | | CviJI \ \ \\ \ \ \ ACAAATTGGCAACATATATTTACTTAATGGAAAGGTAATTGGAGGAAAGTCCACCAAGGC 5170 5180 5190 5200 5210 5220 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTAACCGTTGTATATAAATGAATTACCTTTCCATTAACCTCCTTTCAGGTGGTTCCG / / / / / / / // TspEI MseI | MnlI TspEI | | |CviJI SetI | | SecI* | | StyI | Hpy166II TspDTI T N W Q H I F T * W K G N W R K V H Q G Q I G N I Y L L N G K V I G G K S T K A K L A T Y I Y L M E R * L E E S P P R L ----:----|----:----|----:----|----:----|----:----|----:----| V F Q C C I N V * H F P L Q L F T W W P * L N A V Y I * K I S L Y N S S L G G L C I P L M Y K S L P F T I P P F D V L A MseI | MslI | |FatI | |AflIII | |BspLU11I* | ||CviAII | ||| TatI | ||| |NspI | ||| |Csp6I TspGWI TfiI | ||| |NlaIII | BslFI BarI | ||| ||RsaI BarI | FnuDII* HinfI \ \\\ \\\ \ \ \ \ TTCATTAACATGTACTTCAACTACGGAAGCAGAAATACACGCGATAAGTGAATCTGTCCC 5230 5240 5250 5260 5270 5280 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTAATTGTACATGAAGTTGATGCCTTCGTCTTTATGTGCGCTATTCACTTAGACAGGG // ///// / / / / || ||||TatI | | BslFI HinfI || |||Csp6I | | BarI TfiI || ||RsaI | FnuDII* || ||BarI TspGWI || |BspLU11I* || |AflIII || |FatI || CviAII |NlaIII |NspI MslI MseI F I N M Y F N Y G S R N T R D K * I C P S L T C T S T T E A E I H A I S E S V P H * H V L Q L R K Q K Y T R * V N L S H ----:----|----:----|----:----|----:----|----:----|----:----| K M L M Y K L * P L L F V R S L H I Q G S * * C T S * S R F C F Y V R Y T F R D E N V H V E V V S A S I C A I L S D T G FalI DdeI FalI MseI | MaeIII SetI MseI TspEI MseI CviJI \ \ \ \ \ \ \ \ ATTATTAAATAATCTAAGTTACCTGATACAAGAACTTAACAAGAAACCAATTATTAAAGG 5290 5300 5310 5320 5330 5340 ----:----|----:----|----:----|----:----|----:----|----:----| TAATAATTTATTAGATTCAATGGACTATGTTCTTGAATTGTTCTTTGGTTAATAATTTCC / / / / / / / // / MseI | | MaeIII MseI FalI | || CviJI | SetI FalI | |Hin4I DdeI | |Hin4I | MseI TspEI I I K * S K L P D T R T * Q E T N Y * R L L N N L S Y L I Q E L N K K P I I K G Y * I I * V T * Y K N L T R N Q L L K A ----:----|----:----|----:----|----:----|----:----|----:----| M I L Y D L N G S V L V * C S V L * * L W * * I I * T V Q Y L F K V L F W N N F N N F L R L * R I C S S L L F G I I L P MboI | DpnI | |FalI | |FalI | |BstKTI | || MboI | || | DpnI | || | |BstKTI AccI | || | || TspEI Hin4I | || | || |Hin4I Hin4I Hin4I Hin4I | || | || |Hin4I |Hpy166II ApoI Hin4I Hin4I | || | || || MseI || Ksp632I* TspEI \ \ \ \\ \ \\ \\ \ \\ \ \ CTTACTTACTGATAGTAGATCAACGATCAGTATAATTAAGTCTACAAATGAAGAGAAATT 5350 5360 5370 5380 5390 5400 ----:----|----:----|----:----|----:----|----:----|----:----| GAATGAATGACTATCATCTAGTTGCTAGTCATATTAATTCAGATGTTTACTTCTCTTTAA / / // / // // /// // / / Hin4I | || | || |Hin4I ||| |AccI Ksp632I* TspEI Hin4I | || | || |Hin4I ||| Hpy166II ApoI | || | || MboI ||MseI | || | |DpnI |TspEI | || | BstKTI Hin4I | || MboI Hin4I | |DpnI | BstKTI FalI FalI L T Y * * * I N D Q Y N * V Y K * R E I L L T D S R S T I S I I K S T N E E K F Y L L I V D Q R S V * L S L Q M K R N L ----:----|----:----|----:----|----:----|----:----|----:----| S V * Q Y Y I L S * Y L * T * L H L S I A * K S I T S * R D T Y N L R C I F L F K S V S L L D V I L I I L D V F S S F N Hin4I Hin4I SetI MboII |BsrDI | TspDTI |TspDTI BsmAI || DdeI | |TspEI \\ \ \\ \ \ \\ TAGAAACAGATTTTTTGGCACAAAGGCAATGAGACTTAGAGATGAAGTATCAGGTAATAA 5410 5420 5430 5440 5450 5460 ----:----|----:----|----:----|----:----|----:----|----:----| ATCTTTGTCTAAAAAACCGTGTTTCCGTTACTCTGAATCTCTACTTCATAGTCCATTATT / / / / / / / / TspDTI | | BsrDI DdeI | | Hin4I MboII | BsmAI | | Hin4I Hin4I | TspDTI Hin4I SetI * K Q I F W H K G N E T * R * S I R * * R N R F F G T K A M R L R D E V S G N N E T D F L A Q R Q * D L E M K Y Q V I I ----:----|----:----|----:----|----:----|----:----|----:----| * F C I K Q C L P L S V * L H L I L Y Y K S V S K K A C L C H S K S I F Y * T I L F L N K P V F A I L S L S S T D P L L Hin4I Hin4I | MaeII | |BsaAI | |SnaBI | || AccI | || SetI | || TaiI | || |BssNAI | || |Hpy166II | || || BsmAI | || || Eco31I | || || | TaqI Hin4I | || || | |Hpy178III* BsrDI MboII MboII SetI \ \\ \\ \ \\ \ \ \ \ TTTATACGTATACTACATCGAGACCAAGAAGAACATTGCTGATGTGATGACAAAACCTCT 5470 5480 5490 5500 5510 5520 ----:----|----:----|----:----|----:----|----:----|----:----| AAATATGCATATGATGTAGCTCTGGTTCTTCTTGTAACGACTACACTACTGTTTTGGAGA / / // // / // / / / / / | | || |AccI | || | | MboII | SetI | | || | | || | Hin4I MboII | | || | | || BsrDI | | || | | |Hpy178III* | | || | | TaqI | | || | Eco31I | | || | BsmAI | | || Hpy166II | | || BssNAI | | |MaeII | | SnaBI | | BsaAI | TaiI | SetI TspEI F I R I L H R D Q E E H C * C D D K T S L Y V Y Y I E T K K N I A D V M T K P L Y T Y T T S R P R R T L L M * * Q N L F ----:----|----:----|----:----|----:----|----:----|----:----| N I R I S C R S W S S C Q Q H S S L V E I * V Y V V D L G L L V N S I H H C F R K Y T Y * M S V L F F M A S T I V F G R MboI BglII XhoII | DpnI Hpy188I | |BstKTI Ksp632I* TfiI | || TaqII | MnlI Hin4I MseI TspDTI HinfI | || |MmeI \ \ \ \ \ \ \ \\ \\ TCCGATAAAAACATTCAAACTATTAACAAACAAATGGATTCATTAGATCTATTACATTAT 5530 5540 5550 5560 5570 5580 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCTATTTTTGTAAGTTTGATAATTGTTTGTTTACCTAAGTAATCTAGATAATGTAATA / /// / / / //// | ||Hin4I | TspDTI HinfI |||XhoII | |Ksp632I* MseI TfiI |||BglII | MnlI |||MboI Hpy188I |||MmeI ||TaqII |DpnI BstKTI S D K N I Q T I N K Q M D S L D L L H Y P I K T F K L L T N K W I H * I Y Y I M R * K H S N Y * Q T N G F I R S I T L W ----:----|----:----|----:----|----:----|----:----|----:----| E S L F M * V I L L C I S E N S R N C * K R Y F C E F * * C V F P N M L D I V N G I F V N L S N V F L H I * * I * * M I GGGTGGTATGTTGGAATAAAAATCCACTATCGTCTATCAACTAATAGTTATATTATCAAT 5590 5600 5610 5620 5630 5640 ----:----|----:----|----:----|----:----|----:----|----:----| CCCACCATACAACCTTATTTTTAGGTGATAGCAGATAGTTGATTATCAATATAATAGTTA G W Y V G I K I H Y R L S T N S Y I I N G G M L E * K S T I V Y Q L I V I L S I V V C W N K N P L S S I N * * L Y Y Q Y ----:----|----:----|----:----|----:----|----:----|----:----| P H Y T P I F I W * R R D V L L * I I L H T T H Q F L F G S D D I L * Y N Y * * P P I N S Y F D V I T * * S I T I N D I AluI TaqI Tsp4CI* CviJI ClaI | MseI Hin4I | SetI | MnlI \ \ \ \ \ \ \ ATATTATCATATACGGTGTTAAGATGATGACATAAGTTATGAGAAGCTGTCATCGATGTT 5650 5660 5670 5680 5690 5700 ----:----|----:----|----:----|----:----|----:----|----:----| TATAATAGTATATGCCACAATTCTACTACTGTATTCAATACTCTTCGACAGTAGCTACAA / / / / / // / | MseI Hin4I | CviJI || Hin4I Tsp4CI* | AluI |ClaI SetI |TaqI MnlI I L S Y T V L R * * H K L * E A V I D V Y Y H I R C * D D D I S Y E K L S S M L I I I Y G V K M M T * V M R S C H R C * ----:----|----:----|----:----|----:----|----:----|----:----| I N D Y V T N L H H C L N H S A T M S T Y I I M Y P T L I I V Y T I L L Q * R H Y * * I R H * S S S M L * S F S D D I N Hin4I MboI | AluI | DpnI | CviJI | |BstKTI TspDTI | | SetI | || BinI* | Hin4I \ \ \ \ \\ \ \ \ AGAGGAAGCTGAAACGCAAGGATTGATAATGTAATAGGATCAATGAATATAAACATATAA 5710 5720 5730 5740 5750 5760 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCCTTCGACTTTGCGTTCCTAACTATTACATTATCCTAGTTACTTATATTTGTATATT / / // / / // | CviJI || MboI BinI* |TspDTI | AluI |DpnI Hin4I SetI BstKTI R G S * N A R I D N V I G S M N I N I * E E A E T Q G L I M * * D Q * I * T Y K R K L K R K D * * C N R I N E Y K H I K ----:----|----:----|----:----|----:----|----:----|----:----| L P L Q F A L I S L T I P D I F I F M Y * L F S F R L S Q Y H L L I L S Y L C I S S A S V C P N I I Y Y S * H I Y V Y L TfiI BsiYI* HinfI | TfiI MnlI TspGWI SspI Hin4I | MnlI | HinfI \ \ \ \ \ \ \ \ AACGGAATGAGGAATAATCGTAATATTAGTATGTAGAAATATAGATTCCATTTTGAGGAT 5770 5780 5790 5800 5810 5820 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCCTTACTCCTTATTAGCATTATAATCATACATCTTTATATCTAAGGTAAAACTCCTA / / / / / / MnlI TspGWI | Hin4I | BsiYI* SspI HinfI TfiI MnlI N G M R N N R N I S M * K Y R F H F E D T E * G I I V I L V C R N I D S I L R I R N E E * S * Y * Y V E I * I P F * G F ----:----|----:----|----:----|----:----|----:----|----:----| F P I L F L R L I L I Y F Y L N W K S S F R F S S Y D Y Y * Y T S I Y I G N Q P V S H P I I T I N T H L F I S E M K L I MnlI | AvaI | XhoI | SmlI | AbsI AccI | PspXI |BssNAI | |TaqI |Hpy166II | |BmeT110I MaeI || SetI | || MnlI | BseRI || | SspI CviJI \ \\ \ \ \ \\ \ \ \ TCCTATATCCTCGAGGAGAACTTCTAGTATATTCTGTATACCTAATATTATAGCCTTTAT 5830 5840 5850 5860 5870 5880 ----:----|----:----|----:----|----:----|----:----|----:----| AGGATATAGGAGCTCCTCTTGAAGATCATATAAGACATATGGATTATAATATCGGAAATA / / // / / // / / | MnlI || MnlI BseRI |AccI SspI CviJI HinfI |PspXI MaeI |SetI TfiI |AbsI Hpy166II |SmlI BssNAI |XhoI |AvaI BmeT110I TaqI S Y I L E E N F * Y I L Y T * Y Y S L Y P I S S R R T S S I F C I P N I I A F I L Y P R G E L L V Y S V Y L I L * P L S ----:----|----:----|----:----|----:----|----:----|----:----| E * I R S S F K * Y I R Y V * Y * L R * N R Y G R P S S R T Y E T Y R I N Y G K G I D E L L V E L I N Q I G L I I A K I TfiI HinfI TspEI HphI \ \ \ CAACAATGGAATCCCAACAATTATCTCAACATTCACCCATTTCTCA 5890 5900 5910 5920 ----:----|----:----|----:----|----:----|----:- GTTGTTACCTTAGGGTTGTTAATAGAGTTGTAAGTGGGTAAAGAGT / / / HinfI | HphI TfiI TspEI Q Q W N P N N Y L N I H P F L X N N G I P T I I S T F T H F S T M E S Q Q L S Q H S P I S X ----:----|----:----|----:----|----:----|----:- * C H F G L L * R L M * G N R D V I S D W C N D * C E G M E * L L P I G V I I E V N V W K E # Enzymes that cut Frequency Isoschizomers AarI 2 AbsI 2 Acc65I 1 Asp718I AccI 7 FblI,XmiI AciI 4 BspACI,SsiI AflIII 3 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AjuI 1 AluI 14 AluBI AlwNI 1 CaiI ApaLI 1 Alw44I,VneI ApoI 17 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 3 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BarI 1 BbvCI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 13 Bce83I* 1 BpuEI BceAI 4 BciVI 2 BfuI BclI 1 FbaI,Ksp22I BdaI 10 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglII 3 BinI* 5 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 3 BmgT120I 4 Bpu10I 2 BsaAI 2 BstBAI,Ppu21I BsaXI 1 BseBI 11 Bst2UI,BstNI,BstOI,MvaI BseGI 13 BstF5I,BtsCI BseMII 12 BseRI 3 BseSI 1 BaeGI,BstSLI BseYI 1 BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 7 Bsc4I,BseLI,BslI,AfiI BslFI 4 BsmFI,FaqI BsmAI 8 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 12 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 3 BfuAI,Acc36I,BveI BsrDI 4 BseMI,Bse3DI BsrI 9 BseNI,Bse1I,BsrSI BssKI 11 BstSCI,StyD4I BssNAI 5 Bst1107I,BstZ17I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 19 BstXI 2 BtgZI 2 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 6 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I ClaI 3 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 24 CviQI,RsaNI CspCI 1 CviAII 23 CviJI 34 CviKI-1 CviRI* 23 HpyCH4V DdeI 22 BstDEI,HpyF3I DpnI 19 MalI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 3 AcuI Eco57MI 5 EcoNI 1 BstENI,XagI EcoP15I 1 EcoRI 2 EcoRII 11 AjnI,Psp6I,PspGI EcoRV 4 Eco32I EcoT22I 3 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI FalI 4 FatI 23 FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 13 GlaI 3 GsaI 1 GsuI 2 BpmI HaeII 2 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 3 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 25 Hin4II* 6 HpyAV Hin6I 3 HinP1I,HspAI HindII 7 HincII HinfI 36 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 13 AsuHPI Hpy166II 23 Hpy8I Hpy178III* 21 Hpy188III Hpy188I 21 Hpy99I 3 KpnI 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 12 FspBI,BfaI,XspI MaeII 12 HpyCH4IV MaeIII 11 MboI 19 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 23 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 9 SchI MmeI 6 MnlI 36 MseI 30 Tru1I,Tru9I MslI 7 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NdeI 2 FauNDI NlaIII 23 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspBII* 4 MspA1I NspI 6 BstNSI,XceI OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PfoI 1 PleI 9 PpsI PpiI 1 PsiI 2 AanI PspXI 2 PstI 2 PvuII 2 RsaI 24 AfaI SalI 1 SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 2 BmcAI,AssI,ZrmI ScrFI 11 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 9 BseDI,BssECI,BsaJI SetI 79 SexAI 1 MabI SfaNI 8 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 3 SmoI SnaBI 1 Eco105I,BstSNI SpeI 1 BcuI,AhlI SphI 3 PaeI,BbuI SplI* 1 Pfl23II,PspLI,BsiWI SspI 9 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 12 TaqI 24 TaqII 6 TatI 7 TfiI 27 PfeI TseI 3 ApeKI TsoI 1 Tsp45I 7 NmuCI Tsp4CI* 23 HpyCH4III,TaaI,Bst4CI TspDTI 31 TspEI 47 TasI,Tsp509I,Sse9I TspGWI 15 TspRI 7 TscAI TstI 1 VspI 2 PshBI,AseI XhoI 2 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 5 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AclI AcyI AflII AlfI AloI ApaI AscI AvrII BalI BamHI BcgI BglI BmtI BplI BsaBI BsePI BsgI Bsp120I Bsp1407I BspMII* BspOI BsrBI BstAPI CauII* Cfr9I CfrI DinI DraII DraIII Eam1105I EciI Ecl136II EcoICRI EgeI EheI EspI* FauI FseI FspAI HindIII KasI MauBI MluI MroNI MstI* NaeI NarI NcoI NgoMIV NheI NmeAIII NotI PacI PasI PmaCI PmeI PpuMI PshAI PspOMI PsrI PvuI RsrII SacI SacII SanDI SapI SfiI SfoI SgfI SgrAI SgrDI SmaI SrfI Sse232I* Sse8387I StuI SwaI TauI TspMI Tth111I XbaI XcmI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769