Restriction Map of YOL164W-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YOL164W-A on chromosome XV from coordinates 4130 to 4312.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.28444

DdeI EspI* | HindIII MaeII | | AluI |MaeIII | | CviJI AciI || SetI ApoI | | | SetI FnuDII* || TaiI TspEI BsrDI \ \ \ \ \ \\ \ \ \ ATGTTTGCTAAGCTTTATCGCGGTCTTACTTACGTTACCAACAAAATTCTATCTACATTG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAAACGATTCGAAATAGCGCCAGAATGAATGCAATGGTTGTTTTAAGATAGATGTAAC /// / / / / / / / / ||| | | AciI | | MaeIII | BsrDI ||| | FnuDII* | MaeII TspEI ||| HindIII TaiI ApoI ||CviJI SetI ||AluI |EspI* |DdeI SetI M F A K L Y R G L T Y V T N K I L S T L C L L S F I A V L L T L P T K F Y L H C V C * A L S R S Y L R Y Q Q N S I Y I A ----:----|----:----|----:----|----:----|----:----|----:----| X N A L S * R P R V * T V L L I R D V N X T Q * A K D R D * K R * W C F E I * M H K S L K I A T K S V N G V F N * R C Q CviRI* | ApoI MseI TspEI | TspEI | CviJI | MboII \ \ \ \ \ \ CTATCACATCATTCCATACATTATTGCATAAATTCCTTTAAGCCGACTACATTGGCAATT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GATAGTGTAGTAAGGTATGTAATAACGTATTTAAGGAAATTCGGCTGATGTAACCGTTAA / / / / / / CviRI* TspEI | CviJI | TspEI ApoI MseI MboII L S H H S I H Y C I N S F K P T T L A I Y H I I P Y I I A * I P L S R L H W Q L I T S F H T L L H K F L * A D Y I G N Y ----:----|----:----|----:----|----:----|----:----|----:----| S D C * E M C * Q M F E K L G V V N A I A I V D N W V N N C L N R * A S * M P L * * M M G Y M I A Y I G K L R S C Q C N Hpy166II BseGI PsiI |FokI CviRI* |TspEI BceAI |SfaNI | EcoT22I MseI \\ \ \\ \ \ \ ATAATTCTTCTACACCCCTGTTGCCGTTGTAATGTTTACATTATTAGATGCATCCACCAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TATTAAGAAGATGTGGGGACAACGGCAACATTACAAATGTAATAATCTACGTAGGTGGTA / / / / / / / PsiI | BceAI | SfaNI | CviRI* TspEI | FokI EcoT22I Hpy166II BseGI I I L L H P C C R C N V Y I I R C I H H * F F Y T P V A V V M F T L L D A S T I N S S T P L L P L * C L H Y * M H P P L ----:----|----:----|----:----|----:----|----:----|----:----| I I R R C G Q Q R Q L T * M I L H M W W * L E E V G R N G N Y H K C * * I C G G Y N K * V G T A T T I N V N N S A D V M TAA --- ATT / MseI * X X --- * N L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AluI 1 AluBI ApoI 2 AcsI,XapI BceAI 1 BseGI 1 BstF5I,BtsCI BsrDI 1 BseMI,Bse3DI CviJI 2 CviKI-1 CviRI* 2 HpyCH4V DdeI 1 BstDEI,HpyF3I EcoT22I 1 Mph1103I,NsiI,Zsp2I EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 HindIII 1 Hpy166II 1 Hpy8I MaeII 1 HpyCH4IV MaeIII 1 MboII 1 MseI 2 Tru1I,Tru9I PsiI 1 AanI SetI 2 SfaNI 1 LweI TaiI 1 TspEI 4 TasI,Tsp509I,Sse9I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* BccI Bce83I* BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BisI BlsI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviAII CviQI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EgeI EheI Esp3I FalI FaqI FatI FauI Fnu4HI FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin4II* Hin6I HindII HinfI HinP1I HpaI HpaII HphI Hpy178III*Hpy188I Hpy99I HspAI KasI KpnI Ksp632I* MaeI MauBI MboI McrI* MfeI MluI MlyI MmeI MnlI MroNI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NlaIV NmeAIII NotI NruI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SecI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaqI TaqII TatI TauI TfiI TseI TsoI Tsp45I Tsp4CI* TspDTI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769