Restriction Map of ZPS1/YOL154W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ZPS1/YOL154W on chromosome XV from coordinates 34658 to 35407.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.20544

MaeI MwoI | AluI HpaII CviRI* | CviJI |Ksp632I* | MwoI | | SetI MboII ||TspDTI | BstAPI | | | MwoI \ \\\ \ \ \ \ \ \ ATGAAGTTCTCTTCCGGCAAATCTATCATCTTTGCAACTATTGCTTCTCTAGCTTTGAGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTCAAGAGAAGGCCGTTTAGATAGTAGAAACGTTGATAACGAAGAGATCGAAACTCA / / / / / / / /// / / MboII | | Ksp632I* | BstAPI | ||| | HgiAI* | HpaII | MwoI | ||| | SduI TspDTI CviRI* | ||| MwoI | ||CviJI | ||AluI | |MaeI | SetI MwoI M K F S S G K S I I F A T I A S L A L S * S S L P A N L S S L Q L L L L * L * V E V L F R Q I Y H L C N Y C F S S F E C ----:----|----:----|----:----|----:----|----:----|----:----| X F N E E P L D I M K A V I A E R A K L X S T R K R C I * * R Q L * Q K E L K S H L E R G A F R D D K C S N S R * S Q T MmeI EcoP15I | SmlI | SduI DdeI | | Hpy178III* | HgiAI* | MaeIII | | |Hin4II* | | MaeIII BseMII | | TspDTI | | ||Hin4I | | Tsp45I |BspCNI | | Bce83I* | | ||| ApoI | | |Hin4I ||Hin4I | | |Hin4I | | ||| TspEI \ \ \\ \\\ \ \ \\ \ \ \\\ \ GCTCCTGTCACTTACGACACCAACTCTACTGCTGAGTTACAATCTCCTTCATCTCAAGAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGGACAGTGAATGCTGTGGTTGAGATGACGACTCAATGTTAGAGGAAGTAGAGTTCTT // / /// /// / / / / / |EcoP15I Tsp45I ||BspCNI ||| MaeIII MmeI | | Hpy178III* Hin4I MaeIII |BseMII ||Bce83I* | | SmlI Hin4I ||TspDTI | Hin4II* |DdeI Hin4I Hin4I A P V T Y D T N S T A E L Q S P S S Q E L L S L T T P T L L L S Y N L L H L K K S C H L R H Q L Y C * V T I S F I S R N ----:----|----:----|----:----|----:----|----:----|----:----| A G T V * S V L E V A S N C D G E D * S H E Q * K R C W S * Q Q T V I E K M E L S R D S V V G V R S S L * L R R * R L F HinfI SetI |MaeIII PleI Esp3I |Tsp45I |MlyI BsmAI \\ \\ \ ATTCTGGGTTGGAGTCACGCAACTTTTCCTACCATTTACCAAACCTGTAATGAGACGAAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGACCCAACCTCAGTGCGTTGAAAAGGATGGTAAATGGTTTGGACATTACTCTGCTTG / / / / / / TspEI | | PleI SetI BsmAI ApoI | | MlyI Esp3I | Tsp45I | MaeIII HinfI I L G W S H A T F P T I Y Q T C N E T N F W V G V T Q L F L P F T K P V M R R T S G L E S R N F S Y H L P N L * * D E R ----:----|----:----|----:----|----:----|----:----|----:----| I R P Q L * A V K G V M * W V Q L S V F F E P N S D R L K E * W K G F R Y H S S N Q T P T V C S K R G N V L G T I L R V TseI CviRI* |BisI ||BlsI ||BsmI |||AluI |||CviJI BbvI |||| SetI | AciI AciI |||| BciVI | |HphI | FalI |||| | MseI | ||NspBII* | FalI \\\\ \ \ \ \\\ \ \ GCAAGAATGTTGAATGCAGCTTTTAAGGATACCGCTGAAATCACCGCTTATGGTAAAGAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTCTTACAACTTACGTCGAAAATTCCTATGGCGACTTTAGTGGCGAATACCATTTCTA ///// / / / / / ||||| MseI | NspBII* | AciI ||||BciVI | AciI FalI |||CviJI BbvI FalI |||TseI HphI |||AluI ||BisI |BlsI |SetI CviRI* BsmI A R M L N A A F K D T A E I T A Y G K D Q E C * M Q L L R I P L K S P L M V K I K N V E C S F * G Y R * N H R L W * R * ----:----|----:----|----:----|----:----|----:----|----:----| A L I N F A A K L S V A S I V A * P L S R L F T S H L K * P Y R Q F * R K H Y L C S H Q I C S K L I G S F D G S I T F I MaeII | SetI FalI | TaiI FalI | |Hpy166II |TaqI | || BccI HphI \\ \ \\ \ \ AGACTTTTGAACTATGGTGTCGATGACGTTTACTACAAAAGATGGTTTGGTAATGGTAGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGAAAACTTGATACCACAGCTACTGCAAATGATGTTTTCTACCAAACCATTACCATCA / / / / / / / FalI | | | | BccI HphI FalI | | | Hpy166II | | MaeII | TaiI | SetI TaqI R L L N Y G V D D V Y Y K R W F G N G S D F * T M V S M T F T T K D G L V M V V T F E L W C R * R L L Q K M V W * W * Y ----:----|----:----|----:----|----:----|----:----|----:----| L S K F * P T S S T * * L L H N P L P L Y V K S S H H R H R K S C F I T Q Y H Y S K Q V I T D I V N V V F S P K T I T T CviJI | StyI | SecI* | | HgiCI* | | | NlaIV | | | | FatI | | | | |CviAII TaqII | | | | || NlaIII | Tsp4CI* | | | | || |MslI | |MslI BccI | | | | || ||FatI | ||FatI |MfeI | | | | || ||BspHI | |||CviAII |TspEI | | | | || |||CviAII | |||| NlaIII || MnlI | | | | || |||Hpy178III* \ \\\\ \ \\ \ \ \ \ \ \\ \\\\ ATTTTCACCGTCATGGGTGTCTTTGAGCAATTGATGGAGGCTTCCAAGGGTGCCATGCTC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAGTGGCAGTACCCACAGAAACTCGTTAACTACCTCCGAAGGTTCCCACGGTACGAG / / // // // / / / / / //// TaqII | || |FatI || TspEI CviJI | | | |||NlaIII | || CviAII || MfeI | | | ||MslI | |NlaIII |MnlI | | | |FatI | MslI BccI | | | CviAII Tsp4CI* | | HgiCI* | | NlaIII | NlaIV SecI* StyI I F T V M G V F E Q L M E A S K G A M L F S P S W V S L S N * W R L P R V P C S F H R H G C L * A I D G G F Q G C H A H ----:----|----:----|----:----|----:----|----:----|----:----| I K V T M P T K S C N I S A E L P A M S Y K * R * P H R Q A I S P P K W P H W A N E G D H T D K L L Q H L S G L T G H E TseI CviRI* |BisI ||BlsI |||AluI |||CviJI BsgI GsuI NlaIII BccI CviJI |||| SetI BbvI | HphI Eco57MI \ \ \ \\\\ \ \ \ \ \ ATGAGATGTGATGATATTGATGGCTTGTGTGCAGCTAATCCAAACTATTACGCTGGTCAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCTACACTACTATAACTACCGAACACACGTCGATTAGGTTTGATAATGCGACCAGTA // / / //// // / / |BspHI BccI CviJI |||CviJI || HphI Eco57MI |FatI |||TseI |BsgI GsuI Hpy178III* |||AluI BbvI CviAII ||BisI |BlsI |SetI CviRI* M R C D D I D G L C A A N P N Y Y A G H * D V M I L M A C V Q L I Q T I T L V I E M * * Y * W L V C S * S K L L R W S S ----:----|----:----|----:----|----:----|----:----|----:----| M L H S S I S P K H A A L G F * * A P * * S I H H Y Q H S T H L * D L S N R Q D H S T I I N I A Q T C S I W V I V S T M AluI CviJI PvuII NspBII* Tsp4CI* | SetI Tsp4CI* CviJI \ \ \ \ \ CACCGTCAATCTGCTCCAGCTGAAACTGTTATTTGTGATTACTTCTACACTTCCAAAAAG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGCAGTTAGACGAGGTCGACTTTGACAATAAACACTAATGAAGATGTGAAGGTTTTTC / / / / / Tsp4CI* | | Tsp4CI* CviJI | NspBII* | PvuII | CviJI | AluI SetI H R Q S A P A E T V I C D Y F Y T S K K T V N L L Q L K L L F V I T S T L P K S P S I C S S * N C Y L * L L L H F Q K A ----:----|----:----|----:----|----:----|----:----|----:----| * R * D A G A S V T I Q S * K * V E L F D G D I Q E L Q F Q * K H N S R C K W F V T L R S W S F S N N T I V E V S G F L TspEI Csp6I AsuI* | Hin4II* |RsaI AvaII | |BaeI |SetI |BmgT120I | || TaqI || TaqII || BspMI | || AsuII || | TaqI || |BaeI CviRI* \ \\ \ \\ \ \ \\ \\ \ CCACTATCAACAATTTGTTTCGAAGGTACTATTGTCGATGTCGGTCCAAAACATTATGCA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGATAGTTGTTAAACAAAGCTTCCATGATAACAGCTACAGCCAGGTTTTGTAATACGT / / // /// / // / // | | || ||TaqII TaqI |AvaII | |SetI | | || |Csp6I |AsuI* | CviRI* | | || RsaI | BspMI | | |SetI BmgT120I | | AsuII BaeI | | TaqI | Hin4II* | TspEI BaeI P L S T I C F E G T I V D V G P K H Y A H Y Q Q F V S K V L L S M S V Q N I M Q T I N N L F R R Y Y C R C R S K T L C R ----:----|----:----|----:----|----:----|----:----|----:----| G S D V I Q K S P V I T S T P G F C * A A V I L L K N R L Y * Q R H R D L V N H W * * C N T E F T S N D I D T W F M I C FatI CviRI* |CviAII | MaeII || NlaIII MaeIII | |BtrI || |BccI | BslFI | || SetI || |MslI SetI | | MaeIII | || TaiI || || BstXI BseGI \ \ \ \ \ \\ \ \\ \\ \ \ GGTATTGATATGTTACATCGTTACTTGCACGTCCCTACCATGAGTATGGATGGATATGTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAACTATACAATGTAGCAATGAACGTGCAGGGATGGTACTCATACCTACCTATACAA / / / // // / //// / | | | || |MaeII | |||BccI BseGI | | | || BtrI | ||MslI | | | |TaiI | |FatI | | | |SetI | CviAII | | | CviRI* | BstXI | | MaeIII NlaIII | BslFI MaeIII G I D M L H R Y L H V P T M S M D G Y V V L I C Y I V T C T S L P * V W M D M L Y * Y V T S L L A R P Y H E Y G W I C W ----:----|----:----|----:----|----:----|----:----|----:----| P I S I N C R * K C T G V M L I S P Y T L Y Q Y T V D N S A R G * W S Y P H I H T N I H * M T V Q V D R G H T H I S I N Csp6I |RsaI || AciI Hpy166II TaqII FokI || FnuDII* Hpy178III* |MboII | MwoI \ \\ \ \ \\ \ \ GGCGAGTACGCGGAAACTCTTGAAGAAGTTGTGGACTACACCCAGAACAATGCTACTTAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCTCATGCGCCTTTGAGAACTTCTTCAACACCTGATGTGGGTCTTGTTACGATGAATG / // / / / / / / | || | AciI Hpy178III* Hpy166II | MwoI | || FnuDII* MboII TaqII | |Csp6I | RsaI FokI G E Y A E T L E E V V D Y T Q N N A T Y A S T R K L L K K L W T T P R T M L L T R V R G N S * R S C G L H P E Q C Y L R ----:----|----:----|----:----|----:----|----:----|----:----| P S Y A S V R S S T T S * V W F L A V * Q R T R P F E Q L L Q P S C G S C H * K A L V R F S K F F N H V V G L V I S S V MaeII | SetI | TaiI | |Hpy166II | || Tsp4CI* | || | TspRI \ \\ \ \ GCAGTTAGAAACACCGACAACTATCTTTACTATCTCGCTGACGTTTACAGTGCTTCTGTT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCAATCTTTGTGGCTGTTGATAGAAATGATAGAGCGACTGCAAATGTCACGAAGACAA / / / / | | | Tsp4CI* | | Hpy166II | | TspRI | MaeII TaiI SetI A V R N T D N Y L Y Y L A D V Y S A S V Q L E T P T T I F T I S L T F T V L L L S * K H R Q L S L L S R * R L Q C F C Y ----:----|----:----|----:----|----:----|----:----|----:----| A T L F V S L * R * * R A S T * L A E T R L * F C R C S D K S D R Q R K C H K Q C N S V G V V I K V I E S V N V T S R N BssKI SexAI EcoRII CviJI | ScrFI | MaeI | BseBI | | MaeIII | |SetI | | | SetI \ \\ \ \ \ \ ATACCTGGTGGCTGTCTAGGTAACTTGTAA 730 740 750 ----:----|----:----|----:----| TATGGACCACCGACAGATCCATTGAACATT / / / / // / | | | CviJI |MaeI MaeIII | | EcoRII SetI | | SexAI | | BssKI | BseBI | ScrFI SetI I P G G C L G N L * Y L V A V * V T C X T W W L S R * L V X ----:----|----:----|----:----| I G P P Q R P L K Y * V Q H S D L Y S T Y R T A T * T V Q L # Enzymes that cut Frequency Isoschizomers AciI 3 BspACI,SsiI AluI 4 AluBI ApoI 1 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BccI 4 Bce83I* 1 BpuEI BciVI 1 BfuI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 1 BsgI 1 BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 1 BspHI 1 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BssKI 1 BstSCI,StyD4I BstAPI 1 BstXI 1 BtrI 1 BmgBI,AjiI Csp6I 2 CviQI,RsaNI CviAII 4 CviJI 8 CviKI-1 CviRI* 5 HpyCH4V DdeI 1 BstDEI,HpyF3I Eco57MI 1 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI Esp3I 1 BsmBI FalI 2 FatI 4 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 GsuI 1 BpmI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I Hin4I 2 Hin4II* 2 HpyAV HinfI 1 HpaII 1 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 3 Hpy188III Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 6 MboII 2 MfeI 1 MunI MlyI 1 SchI MmeI 1 MnlI 1 MseI 1 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 2 MspA1I PleI 1 PpsI PvuII 1 RsaI 2 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 12 SexAI 1 MabI SmlI 1 SmoI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 3 TaqII 3 TseI 2 ApeKI Tsp45I 2 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 3 TasI,Tsp509I,Sse9I TspRI 1 TscAI # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BalI BamHI BarI BbvCI BbvII* BceAI BcgI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BsePI BseRI BseSI BseYI BsiI* BsiYI* Bsp120I Bsp1407I BspLU11I* BspMII* BspOI BsrBI BsrDI BsrI BssNAI Bst1107I BstEII BstKTI BstZ17I BtgZI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoRI EcoRV EcoT22I EgeI EheI EspI* FauI FseI FspAI GlaI GsaI HaeII HaeIII HgaI HgiJII* HhaI Hin6I HindII HindIII HinP1I HpaI Hpy188I Hpy99I HspAI KasI KpnI MauBI MboI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TatI TauI TfiI TsoI TspGWI TspMI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769