Restriction Map of SMF1/YOL122C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SMF1/YOL122C on chromosome XV from coordinates 91419 to 89692.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.21720

EMBOSS_001 Hpy166II | AclI | MaeII | | SetI | | TaiI | | |BbvI | | ||AsuI* | | ||AvaII | | |||BmgT120I | | |||| FatI | | |||| |CviAII MwoI | | |||| || TseI | NheI | | |||| || NlaIII | |MaeI | | |||| || |BisI | ||Cac8I | | |||| || |SfeI* | ||BseGI | | |||| || |Hin4II* | ||| BmtI | | |||| || ||BlsI | ||| | MwoI | | |||| || |||CviRI* | ||| | | FokI | | |||| || |||| PstI | ||| | | CviJI | | |||| || |||| SfaNI | ||| | | |MwoI | | |||| || |||| |MwoI | ||| | | ||AciI | | ||||HphI || |||| || AlwNI | ||| | | ||Cac8I \ \ \\\\\ \\ \\\\ \\ \ \ \\\ \ \ \\\ ATGGTGAACGTTGGTCCTTCTCATGCTGCAGTTGCTGTGGATGCTAGCGAAGCCCGCAAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCACTTGCAACCAGGAAGAGTACGACGTCAACGACACCTACGATCGCTTCGGGCGTTT // / /// / ///// // / / / /// / / / / || | ||| | ||||| || | MwoI | ||| | | | FokI || | ||| | ||||| || SfaNI | ||| | | | AciI || | ||| | ||||| |AlwNI | ||| | | Cac8I || | ||| | ||||| SfeI* | ||| | CviJI || | ||| | ||||CviRI* | ||| MwoI || | ||| | ||||MwoI | ||NheI || | ||| | ||||TseI | |MwoI || | ||| | |||BisI | |MaeI || | ||| | ||BlsI | Cac8I || | ||| | ||PstI BseGI || | ||| | |Hin4II* BmtI || | ||| | |FatI || | ||| | CviAII || | ||| NlaIII || | ||AvaII || | ||AsuI* || | ||BbvI || | |BmgT120I || | HphI || MaeII || AclI |TaiI |SetI Hpy166II M V N V G P S H A A V A V D A S E A R K W * T L V L L M L Q L L W M L A K P A K G E R W S F S C C S C C G C * R S P Q K ----:----|----:----|----:----|----:----|----:----|----:----| X T F T P G E * A A T A T S A L S A R L X P S R Q D K E H Q L Q Q P H * R L G C H H V N T R R M S C N S H I S A F G A F Hpy188I | BseMII TfiI | |BspCNI HinfI | || MnlI | SfeI* | || TaqI | | Tsp4CI* | || AsuII | | | MnlI SspI | || | MboII | | | | TspEI FauI XmnI | || | | DdeI | | | | TspRI \ \ \ \\ \ \ \ \ \ \ \ \ AGAAATATTTCAGAAGAAGTATTCGAACTGAGGGATAAGAAAGATTCTACAGTGGTAATT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTATAAAGTCTTCTTCATAAGCTTGACTCCCTATTCTTTCTAAGATGTCACCATTAA / / / // / // / // // / / | XmnI | || | |AsuII DdeI || || MnlI TspEI | SspI | || | |TaqI || |SfeI* FauI | || | MboII || Tsp4CI* | || MnlI |TspRI | |BspCNI HinfI | BseMII TfiI Hpy188I R N I S E E V F E L R D K K D S T V V I E I F Q K K Y S N * G I R K I L Q W * L K Y F R R S I R T E G * E R F Y S G N * ----:----|----:----|----:----|----:----|----:----|----:----| L F I E S S T N S S L S L F S E V T T I F F Y K L L L I R V S P Y S L N * L P L S I N * F F Y E F Q P I L F I R C H Y N AluI CviJI | SetI | |MaeI CviJI | || MaeIII |BssKI | || | FatI |SecI* | || | |CviAII || HpaII | || | || MnlI || ScrFI | || | || |NlaIII || CauII* | || | || ||BaeI || | HphI BsrI | || | || |||BciVI TsoI \\ \ \ \ \ \\ \ \\ \\\\ \ GAGGGTGAAGCCCCGGTAAGAACTTTTACCAGTAGCTCTAGTAACCATGAAAGAGAGGAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCCACTTCGGGGCCATTCTTGAAAATGGTCATCGAGATCATTGGTACTTTCTCTCCTA / /// / / / / / //// / / | ||BssKI BsrI | | MaeI | |||BciVI | TspDTI | |SecI* | CviJI | ||FatI | TaiI | |HpaII | AluI | |CviAII | SetI | |HphI SetI | MnlI TsoI | CauII* MaeIII | ScrFI NlaIII CviJI BaeI E G E A P V R T F T S S S S N H E R E D R V K P R * E L L P V A L V T M K E R I G * S P G K N F Y Q * L * * P * K R G Y ----:----|----:----|----:----|----:----|----:----|----:----| S P S A G T L V K V L L E L L W S L S S Q P H L G P L F K * W Y S * Y G H F L P L T F G R Y S S K G T A R T V M F S L I MaeII |BsaAI |SnaBI |TspDTI || SetI SetI || TaiI BspMI BaeI TspDTI \\ \ \ \ \ ACGTATGTTTCTAAAAGGCAGGTAATGAGAGATATTTTTGCTAAATACTTGAAGTTCATT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGCATACAAAGATTTTCCGTCCATTACTCTCTATAAAAACGATTTATGAACTTCAAGTAA // / // / |MaeII | |SetI TspDTI SnaBI | BaeI BsaAI BspMI T Y V S K R Q V M R D I F A K Y L K F I R M F L K G R * * E I F L L N T * S S L V C F * K A G N E R Y F C * I L E V H W ----:----|----:----|----:----|----:----|----:----|----:----| V Y T E L L C T I L S I K A L Y K F N M Y T H K * F A P L S L Y K Q * I S S T * R I N R F P L Y H S I N K S F V Q L E N CviJI | BinI* | | TaqI AsuI* | | ClaI AvaII | | |MboI |BmgT120I | | || DpnI ||BssKI | | || |BssKI ||EcoRII | | || |BstKTI |||TsoI | | || || HpaII BcgI ||||ScrFI | | || || ScrFI | SfaNI ||||BseBI | | || || CauII* | | AarI |||||BccI | | || || | BceAI | | BspMI |||||SetI | | || || | | TspEI | | | TaqI \\\\\\ \ \ \\ \\ \ \ \ \ \ \ \ GGACCTGGATTGATGGTTAGTGTGGCTTACATCGATCCCGGTAATTACTCTACTGCCGTC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCTGGACCTAACTACCAATCACACCGAATGTAGCTAGGGCCATTAATGAGATGACGGCAG /// /// / / // / //// // // // ||| ||EcoRII | | || | |||| |BcgI || |BspMI ||| ||BssKI | | || | |||| TspEI || |AarI ||| |BccI | | || | |||BceAI || MwoI ||| BseBI | | || | ||BssKI |Hpy99I ||| ScrFI | | || | |HpaII SfaNI ||AvaII | | || | CauII* ||AsuI* | | || | ScrFI |BmgT120I | | || MboI SetI | | |DpnI TsoI | | BstKTI | | ClaI | | TaqI | BinI* CviJI G P G L M V S V A Y I D P G N Y S T A V D L D * W L V W L T S I P V I T L L P S T W I D G * C G L H R S R * L L Y C R R ----:----|----:----|----:----|----:----|----:----|----:----| P G P N I T L T A * M S G P L * E V A T Q V Q I S P * H P K C R D R Y N S * Q R S R S Q H N T H S V D I G T I V R S G D MwoI Hpy99I | CviRI* | | HgiCI* TspEI | | | SetI | MnlI | | | NlaIV | | BcgI \ \ \ \ \ \ \ GATGCAGGTGCCTCTAATCAATTTTCCCTACTTTGTATCATTTTGTTATCAAACTTTATT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTACGTCCACGGAGATTAGTTAAAAGGGATGAAACATAGTAAAACAATAGTTTGAAATAA / // / / // / | || | HgiCI* || TspEI | || NlaIV |BcgI | |SetI MnlI | CviRI* TaqI D A G A S N Q F S L L C I I L L S N F I M Q V P L I N F P Y F V S F C Y Q T L L C R C L * S I F P T L Y H F V I K L Y C ----:----|----:----|----:----|----:----|----:----|----:----| S A P A E L * N E R S Q I M K N D F K I R H L H R * D I K G V K Y * K T I L S * I C T G R I L K G * K T D N Q * * V K N FalI FalI |MaeI || MboI || BglII || XhoII || | DpnI || | |BstKTI || | ||DdeI NlaIV || | ||| BslFI CviRI* BsrDI TspGWI | MaeIII || | ||| |TaqI \ \ \ \ \ \\ \ \\\ \\ GCCATATTTTTGCAATGTCTGTGTATCAAGTTGGGTTCCGTTACGGGACTAGATCTAAGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTATAAAAACGTTACAGACACATAGTTCAACCCAAGGCAATGCCCTGATCTAGATTCA / / / / // /// / / | BsrDI TspGWI NlaIV |MaeIII ||| | DdeI CviRI* FalI ||| XhoII FalI ||| BglII ||| MboI ||DpnI |BstKTI MaeI A I F L Q C L C I K L G S V T G L D L S P Y F C N V C V S S W V P L R D * I * V H I F A M S V Y Q V G F R Y G T R S K S ----:----|----:----|----:----|----:----|----:----|----:----| A M N K C H R H I L N P E T V P S S R L Q W I K A I D T Y * T P N R * P V L D L G Y K Q L T Q T D L Q T G N R S * I * T FalI AluI FalI CviJI | SecI* | SetI | DsaI* | Cac8I | | Tsp4CI* | | CviRI* | | | CviJI BsrI BceAI CviRI* \ \ \ \ \ \ \ \ \ \ CGAGCTTGCAGAGAGTATTTACCACGGTGGCTCAACTGGACATTGTATTTTTTTGCAGAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GCTCGAACGTCTCTCATAAATGGTGCCACCGAGTTGACCTGTAACATAAAAAAACGTCTT /// / / / // / / / / / ||| | CviRI* FalI || CviJI BsrI | | BstAPI ||| Cac8I FalI |DsaI* | | MwoI ||CviJI |SecI* | CviRI* ||AluI Tsp4CI* BceAI |BslFI TaqI SetI R A C R E Y L P R W L N W T L Y F F A E E L A E S I Y H G G S T G H C I F L Q N S L Q R V F T T V A Q L D I V F F C R M ----:----|----:----|----:----|----:----|----:----|----:----| R A Q L S Y K G R H S L Q V N Y K K A S D L K C L T N V V T A * S S M T N K Q L S S A S L I * W P P E V P C Q I K K C F AluI CviJI FalI MwoI MwoI | SetI Csp6I Eco57I FalI BstAPI | CviJI | TsoI |RsaI Eco57MI |Hpy178III* \ \ \ \ \ \\ \ \\ TGTGCCGTTATAGCCACCGATATAGCTGAAGTGATTGGTACAGCGATTGCCTTGAATATC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ACACGGCAATATCGGTGGCTATATCGACTTCACTAACCATGTCGCTAACGGAACTTATAG / / / / // / / MwoI CviJI | CviJI || Eco57MI FalI | TsoI || Eco57I FalI | AluI |Csp6I SetI RsaI C A V I A T D I A E V I G T A I A L N I V P L * P P I * L K * L V Q R L P * I S C R Y S H R Y S * S D W Y S D C L E Y P ----:----|----:----|----:----|----:----|----:----|----:----| H A T I A V S I A S T I P V A I A K F I I H R * L W R Y L Q L S Q Y L S Q R S Y T G N Y G G I Y S F H N T C R N G Q I D BsiYI* |AciI |NspBII* || Cac8I || |Hin4II* || || MwoI || || |CfrI || || || BalI MboI || || || FalI BclI SduI || || || FalI | DpnI BseSI || || || CviJI XcmI | |BstKTI |FauI || || || HaeIII Tsp4CI* BseGI FokI \ \\ \\ \\ \\ \\ \ \ \ \ CTGATCAAAGTGCCCCTTCCAGCGGGCGTGGCCATTACTGTTGTGGATGTGTTTTTGATT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GACTAGTTTCACGGGGAAGGTCGCCCGCACCGGTAATGACAACACCTACACAAAAACTAA /// / / // / /// / / / / ||| | BseSI || | ||FalI | CfrI Tsp4CI* BseGI ||| | SduI || | ||FalI HaeIII XcmI ||| BclI || | |MwoI CviJI ||| MboI || | | BalI ||DpnI || | Hin4II* |BstKTI || | Cac8I Hpy178III* || | AciI || NspBII* |BsiYI* FauI L I K V P L P A G V A I T V V D V F L I * S K C P F Q R A W P L L L W M C F * L D Q S A P S S G R G H Y C C G C V F D Y ----:----|----:----|----:----|----:----|----:----|----:----| R I L T G R G A P T A M V T T S T N K I G S * L A G E L P R P W * Q Q P H T K S Q D F H G K W R A H G N S N H I H K Q N Hpy166II | HgaI | | BssKI | | SexAI | | EcoRII | | | ScrFI | | | BseBI TspDTI | | | |SetI | TspEI SetI SspI \ \ \ \\ \ \ \ \ ATGTTTACATATAAACCTGGTGCGTCATCAATTAGGTTCATTAGAATATTTGAATGTTTT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TACAAATGTATATTTGGACCACGCAGTAGTTAATCCAAGTAATCTTATAAACTTACAAAA / / / / / / / / / | Hpy166II | | | | TspDTI TspEI SspI FokI | | | EcoRII SetI | | | SexAI | | | BssKI | | BseBI | | ScrFI | HgaI SetI M F T Y K P G A S S I R F I R I F E C F C L H I N L V R H Q L G S L E Y L N V L V Y I * T W C V I N * V H * N I * M F C ----:----|----:----|----:----|----:----|----:----|----:----| I N V Y L G P A D D I L N M L I N S H K * T * M Y V Q H T M L * T * * F I Q I N H K C I F R T R * * N P E N S Y K F T K Ksp632I* BcgI | Hpy178III* CviRI* BcgI CviRI* TspEI CviJI | | TspGWI \ \ \ \ \ \ \ \ GTTGCAGTATTAGTTGTTGGCGTGTGCATTTGTTTCGCAATAGAATTGGCTTATATCCCG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGTCATAATCAACAACCGCACACGTAAACAAAGCGTTATCTTAACCGAATATAGGGC / / / / / // CviRI* BcgI CviRI* | CviJI |Hpy178III* TspEI Ksp632I* BcgI TspGWI V A V L V V G V C I C F A I E L A Y I P L Q Y * L L A C A F V S Q * N W L I S R C S I S C W R V H L F R N R I G L Y P E ----:----|----:----|----:----|----:----|----:----|----:----| T A T N T T P T H M Q K A I S N A * I G Q Q L I L Q Q R T C K N R L L I P K Y G N C Y * N N A H A N T E C Y F Q S I D R Csp6I |RsaI ||MaeII ||| SetI ||| TaiI ||| | MboII ||| | | MseI MnlI Hpy188I BccI \\\ \ \ \ \ \ \ AAGAGTACGTCCGTTAAACAAGTGTTCAGAGGATTTGTGCCATCTGCCCAAATGTTTGAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTCATGCAGGCAATTTGTTCACAAGTCTCCTAAACACGGTAGACGGGTTTACAAACTG // / / / / / / || | | MseI MnlI Hpy188I BccI || | MboII || MaeII |Csp6I RsaI TaiI SetI K S T S V K Q V F R G F V P S A Q M F D R V R P L N K C S E D L C H L P K C L T E Y V R * T S V Q R I C A I C P N V * P ----:----|----:----|----:----|----:----|----:----|----:----| F L V D T L C T N L P N T G D A W I N S S S Y T R * V L T * L I Q A M Q G F T Q L T R G N F L H E S S K H W R G L H K V DdeI | BccI | | SetI | | | CspCI AciI | | | | Tsp4CI* \ \ \ \ \ \ CACAATGGTATTTATACCGCTATTTCCATCTTAGGTGCTACTGTTATGCCACATTCGTTG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTTACCATAAATATGGCGATAAAGGTAGAATCCACGATGACAATACGGTGTAAGCAAC / // // / AciI || || Tsp4CI* || |CspCI || BccI |DdeI SetI H N G I Y T A I S I L G A T V M P H S L T M V F I P L F P S * V L L L C H I R C Q W Y L Y R Y F H L R C Y C Y A T F V V ----:----|----:----|----:----|----:----|----:----|----:----| W L P I * V A I E M K P A V T I G C E N G C H Y K Y R * K W R L H * Q * A V N T V I T N I G S N G D * T S S N H W M R Q TseI CviRI* |BisI ||BlsI |||CviJI ||||StyI BsgI ||||SecI* | MaeII NlaIV ||||| MwoI | | MseI | AciI ||||| | CviJI | | SetI Tsp4CI* | | CspCI ||||| | | BbvI | | TaiI | TspEI \ \ \ \\\\\ \ \ \ \ \ \ \ \ TTTTTGGGTTCCGCTTTAGTGCAGCCAAGGCTTTTAGATTATGACGTTAAACACGGTAAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAACCCAAGGCGAAATCACGTCGGTTCCGAAAATCTAATACTGCAATTTGTGCCATTA / / / //// // // / / / / | | AciI |||| |CviJI |BsgI | | MseI Tsp4CI* | CspCI |||| SecI* BbvI | MaeII NlaIV |||| StyI TaiI |||CviJI SetI |||MwoI |||TseI ||BisI |BlsI CviRI* F L G S A L V Q P R L L D Y D V K H G N F W V P L * C S Q G F * I M T L N T V I F G F R F S A A K A F R L * R * T R * L ----:----|----:----|----:----|----:----|----:----|----:----| N K P E A K T C G L S K S * S T L C P L T K P N R K L A A L A K L N H R * V R Y K Q T G S * H L W P K * I I V N F V T I Tsp4CI* Eco57I Ksp632I* | Hpy188I MboII Eco57MI | TspRI \ \ \ \ \ \ TATACTGTTTCTGAAGAACAAGATAAAGTGAAAAAATCTAAATCCACTGAAGAGATTATG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ATATGACAAAGACTTCTTGTTCTATTTCACTTTTTTAGATTTAGGTGACTTCTCTAATAC / / / / / / / / | | Hpy188I MboII Eco57MI | Ksp632I* MboII | Tsp4CI* Eco57I TspRI TspEI Y T V S E E Q D K V K K S K S T E E I M I L F L K N K I K * K N L N P L K R L W Y C F * R T R * S E K I * I H * R D Y G ----:----|----:----|----:----|----:----|----:----|----:----| * V T E S S C S L T F F D L D V S S I I N Y Q K Q L V L Y L S F I * I W Q L S * I S N R F F L I F H F F R F G S F L N H Eco57I SspI Eco57MI | FatI | SspI | CviRI* | | MboII TseI | |CviAII | | |MseI |BisI | || NlaIII MboII | | ||TspEI BbvI ||BlsI | || | SspI \ \ \ \\\ \ \\\ \ \\ \ \ GAAGAAAAATATTTTAATTATAGACCCACGAACGCTGCTATCAAATATTGCATGAAATAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTTTTATAAAATTAATATCTGGGTGCTTGCGACGATAGTTTATAACGTACTTTATA / / / / / / /// / / // / | | | | TspEI BbvI ||TseI | | || SspI | | | MseI |BisI | | |FatI | | MboII BlsI | | CviAII | SspI | CviRI* Eco57MI | NlaIII Eco57I SspI E E K Y F N Y R P T N A A I K Y C M K Y K K N I L I I D P R T L L S N I A * N I R K I F * L * T H E R C Y Q I L H E I F ----:----|----:----|----:----|----:----|----:----|----:----| S S F Y K L * L G V F A A I L Y Q M F Y P L F I N * N Y V W S R Q * * I N C S I F F F I K I I S G R V S S D F I A H F I Ksp632I* | MaeI | | Hin6I | | |GlaI TspDTI | | |Eco47III |TaqI | | ||HhaI || TspEI MboII | | |||HaeII MfeI || | MseI | HphI | | |||| FokI TspEI BseGI \\ \ \ \ \ \ \ \\\\ \ \ \ TCTATGGTCGAATTAAGCATAACTCTCTTCACCCTAGCGCTTTTCGTCAATTGTGCCATC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AGATACCAGCTTAATTCGTATTGAGAGAAGTGGGATCGCGAAAAGCAGTTAACACGGTAG / / // / / / //// / / / | | || | HphI | |||Hin6I FokI | BseGI | | || MboII | ||Eco47III TspEI | | |MseI | ||GlaI MfeI | | TspEI | |HhaI | TaqI | HaeII TspDTI | MaeI Ksp632I* S M V E L S I T L F T L A L F V N C A I L W S N * A * L S S P * R F S S I V P S Y G R I K H N S L H P S A F R Q L C H P ----:----|----:----|----:----|----:----|----:----|----:----| E I T S N L M V R K V R A S K T L Q A M N * P R I L C L E R * G L A K R * N H W R H D F * A Y S E E G * R K E D I T G D AciI | Cac8I | | CviJI | | |NlaIV MaeI | | ||SduI | FauI | | ||HgiJII* TspDTI | |BccI | | ||| HphI BccI MwoI | Hpy166II \ \\ \ \ \\\ \ \ \ \ \ CTAGTTGTTGCGGGCTCCACTCTATATAACTCACCAGAAGCAGATGGGGCAGATTTGTTT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GATCAACAACGCCCGAGGTGAGATATATTGAGTGGTCTTCGTCTACCCCGTCTAAACAAA / / / // / / / / / | BccI | |NlaIV HphI BccI MwoI | Hpy166II | FauI | CviJI TspDTI MaeI HgiJII* Cac8I SduI AciI L V V A G S T L Y N S P E A D G A D L F * L L R A P L Y I T H Q K Q M G Q I C L S C C G L H S I * L T R S R W G R F V Y ----:----|----:----|----:----|----:----|----:----|----:----| R T T A P E V R Y L E G S A S P A S K N G L Q Q P S W E I Y S V L L L H P L N T * N N R A G S * I V * W F C I P C I Q K Hpy178III* | HgiCI* | |BspMI | ||NlaIV | ||| AciI | ||| |BcgI | ||| ||TseI | ||| ||MwoI | ||| |||BisI | ||| ||||BlsI | ||| |||||BsiYI* | ||| |||||| FauI | ||| |||||| TspDTI | ||| |||||| | Csp6I | ||| |||||| | |RsaI FatI | ||| |||||| | |SetI BspHI | ||| |||||| | || BbvI |CviAII | ||| |||||| | || | FatI |Hpy178III* | ||| |||||| | || | |CviAII || TspEI | ||| |||||| | || | || NlaIII || NlaIII | TspDTI ||| |||||| | || | || | Cac8I \\ \ \ \ \\\ \\\\\\ \ \\ \ \\ \ \ ACTATTCATGAATTATTATCAAGAAATCTGGCACCCGCAGCAGGTACGATTTTCATGCTC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TGATAAGTACTTAATAATAGTTCTTTAGACCGTGGGCGTCGTCCATGCTAAAAGTACGAG / // / // / // ///// /// / // / | || TspEI || | || ||||| ||Csp6I | || Cac8I | |BspHI || | || ||||| |RsaI | |FatI | |FatI || | || ||||| FauI | CviAII | Hpy178III* || | || ||||SetI NlaIII | CviAII || | || |||TspDTI BbvI NlaIII || | || |||TseI || | || ||BisI || | || |BlsI || | || BsiYI* || | || AciI || | |BspMI || | HgiCI* || | MwoI || | BcgI || NlaIV |Hpy178III* TspDTI T I H E L L S R N L A P A A G T I F M L L F M N Y Y Q E I W H P Q Q V R F S C S Y S * I I I K K S G T R S R Y D F H A R ----:----|----:----|----:----|----:----|----:----|----:----| V I * S N N D L F R A G A A P V I K M S * * E H I I I L F D P V R L L Y S K * A S N M F * * * S I Q C G C C T R N E H E TatI EcoP15I |Csp6I | MseI AarI |Hpy166II TspEI | BcgI BspMI AciI SetI ||RsaI | MnlI \ \ \ \ \ \\\ \ \ GCACTTTTATTAAGTGGTCAATCCGCAGGTGTAGTGTGTACTATGTCGGGTCAAATTGTA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGAAAATAATTCACCAGTTAGGCGTCCACATCACACATGATACAGCCCAGTTTAACAT / / / / // //// // | | MseI | |SetI |||TatI |TspEI | EcoP15I | AciI ||Csp6I MnlI BcgI BspMI |RsaI AarI Hpy166II A L L L S G Q S A G V V C T M S G Q I V H F Y * V V N P Q V * C V L C R V K L * T F I K W S I R R C S V Y Y V G S N C K ----:----|----:----|----:----|----:----|----:----|----:----| A S K N L P * D A P T T H V I D P * I T R V K I L H D I R L H L T Y * T P D F Q C K * * T T L G C T Y H T S H R T L N Y TseI CviRI* |BisI ||BlsI |||CviJI ||||FatI ||||NcoI ||||StyI ||||SecI* CfrI ||||DsaI* | BalI |||||CviAII | CviJI MseI ||||||MwoI | HaeIII VspI ||||||| NlaIII | | MaeI |TspEI ||||||| | BbvI | | MboII \\ \\\\\\\ \ \ \ \ \ AGTGAGGGTCATATTAATTGGAAGTTGCAGCCATGGCAAAGAAGATTGGCCACTAGATGT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTCCCAGTATAATTAACCTTCAACGTCGGTACCGTTTCTTCTAACCGGTGATCTACA / / ///// // / / // / | TspEI ||||| |DsaI* BbvI | || MaeI VspI ||||| |SecI* | |MboII MseI ||||| |StyI | CfrI ||||| |NcoI HaeIII ||||| |FatI CviJI ||||| CviAII BalI ||||NlaIII |||CviJI |||MwoI |||TseI ||BisI |BlsI CviRI* S E G H I N W K L Q P W Q R R L A T R C V R V I L I G S C S H G K E D W P L D V * G S Y * L E V A A M A K K I G H * M Y ----:----|----:----|----:----|----:----|----:----|----:----| L S P * I L Q F N C G H C L L N A V L H L H P D Y * N S T A A M A F F I P W * I T L T M N I P L Q L W P L S S Q G S S T HindIII | AluI | CviJI TaqI BsiYI* | | SetI \ \ \ \ \ ATTTCGATAATCCCTTGTTTGGTCATCTCTATCTGTATCGGTAGAGAAGCTTTATCAAAG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGCTATTAGGGAACAAACCAGTAGAGATAGACATAGCCATCTCTTCGAAATAGTTTC / / / / / TaqI BsiYI* | | HindIII | CviJI | AluI SetI I S I I P C L V I S I C I G R E A L S K F R * S L V W S S L S V S V E K L Y Q R F D N P L F G H L Y L Y R * R S F I K G ----:----|----:----|----:----|----:----|----:----|----:----| I E I I G Q K T M E I Q I P L S A K D F Y K S L G K N P * R * R Y R Y L L K I L N R Y D R T Q D D R D T D T S F S * * L StuI CviJI SetI HaeIII MboII | MseI |MseI | | MwoI ||TspEI \ \ \ \\\ GCCTTAAATGCTTCCCAAGTTGTTTTATCCATAGTTCTGCCATTTTTGGTAGCACCTTTA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAATTTACGAAGGGTTCAACAAAATAGGTATCAAGACGGTAAAAACCATCGTGGAAAT / / / / / / | | MseI | | MseI | MwoI | MboII HaeIII SetI CviJI StuI A L N A S Q V V L S I V L P F L V A P L P * M L P K L F Y P * F C H F W * H L * L K C F P S C F I H S S A I F G S T F N ----:----|----:----|----:----|----:----|----:----|----:----| A K F A E W T T K D M T R G N K T A G K P R L H K G L Q K I W L E A M K P L V K G * I S G L N N * G Y N Q W K Q Y C R * TspEI | TspDTI | | Tsp4CI* FatI | | |SalI AflIII FatI | | ||TaqI BspLU11I* BspHI | | ||AccI |CviAII |CviAII | | |||HindII || NspI |Hpy178III* | | |||Hpy166II || NlaIII || NlaIII | | ||||Hpy99I \\ \ \\ \ \ \ \\\\\ ATTTTCTTCACATGTAAAAAATCAATCATGAAAACCGAAATTACCGTCGACCATACTGAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAGAAGTGTACATTTTTTAGTTAGTACTTTTGGCTTTAATGGCAGCTGGTATGACTT / / // / // // / /// TspEI | |BspLU11I* | |BspHI || | ||SalI | |AflIII | |FatI || | |AccI | |FatI | Hpy178III* || | |TaqI | CviAII | CviAII || | Hpy166II NlaIII NlaIII || | HindII NspI || Tsp4CI* || Hpy99I |TspEI TspDTI I F F T C K K S I M K T E I T V D H T E F S S H V K N Q S * K P K L P S T I L K F L H M * K I N H E N R N Y R R P Y * R ----:----|----:----|----:----|----:----|----:----|----:----| I K K V H L F D I M F V S I V T S W V S L K R * M Y F I L * S F R F * R R G Y Q N E E C T F F * D H F G F N G D V M S F TsoI | BspMI | | MboI CviJI | | BglII | MboII | | XhoII | | MboII | | | DpnI | | | Eco57I | | | |BstKTI | | | Eco57MI | | | ||SfeI* | | | | BcgI | | | ||| CviRI* TaqI | | | | | TsoI | | | ||| | PstI BcgI | | | | | |BccI | | | ||| | | SetI | BccI \ \ \ \ \ \\ \ \ \ \\\ \ \ \ \ \ GAAGATAGCCATAACCATCAAAATAACAACGATAGATCTGCAGGTAGCGTAATCGAGCAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTATCGGTATTGGTAGTTTTATTGTTGCTATCTAGACGTCCATCGCATTAGCTCGTT // / / / / / / // / /// / // || | | | | | TsoI || | ||SfeI* | |BccI || | | | | BccI || | |SetI | TaqI || | | | TsoI || | CviRI* BcgI || | | BcgI || XhoII || | Eco57MI || BglII || | Eco57I || MboI || MboII || PstI |MboII |DpnI CviJI BstKTI BspMI E D S H N H Q N N N D R S A G S V I E Q K I A I T I K I T T I D L Q V A * S S K R * P * P S K * Q R * I C R * R N R A R ----:----|----:----|----:----|----:----|----:----|----:----| S S L W L W * F L L S L D A P L T I S C L L Y G Y G D F Y C R Y I Q L Y R L R A F I A M V M L I V V I S R C T A Y D L L FatI |CviAII MaeI || NlaIII \ \\ \ GATGGTTCTAGTGGCATGGAGATAGAAAATGGAAAAGATGTCAAAATCGTTTATATGGCA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCAAGATCACCGTACCTCTATCTTTTACCTTTTCTACAGTTTTAGCAAATATACCGT / / // | | |FatI | | CviAII | NlaIII MaeI D G S S G M E I E N G K D V K I V Y M A M V L V A W R * K M E K M S K S F I W Q W F * W H G D R K W K R C Q N R L Y G K ----:----|----:----|----:----|----:----|----:----|----:----| S P E L P M S I S F P F S T L I T * I A L H N * H C P S L F H F L H * F R K Y P I T R T A H L Y F I S F I D F D N I H C MfeI Tsp4CI* AclI TspEI | TspRI TspEI CviJI MaeII \ \ \ \ \ \ AACAATTGGATTATCACTGTTATTGCTATAATTGTGTGGCTTTTCTTATCTTTACTGAAC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTAACCTAATAGTGACAATAACGATATTAACACACCGAAAAGAATAGAAATGACTTG / / / / / / | | Tsp4CI* TspEI CviJI TaiI | TspRI SetI TspEI MfeI N N W I I T V I A I I V W L F L S L L N T I G L S L L L L * L C G F S Y L Y * T Q L D Y H C Y C Y N C V A F L I F T E R ----:----|----:----|----:----|----:----|----:----|----:----| F L Q I I V T I A I I T H S K K D K S F L C N S * * Q * Q * L Q T A K R I K V S V I P N D S N N S Y N H P K E * R * Q V FatI |CviAII || NspI || NlaIII || | FatI || | |CviAII || | ||BsmAI SetI || | ||| NlaIII MseI TaiI TspEI || | ||| | EcoRV |HphI \ \ \\ \ \\\ \ \ \\ GTTTATGCCATTGTTCAATTAGGCATGTCTCATGGTGATATCAGTTAA 1690 1700 1710 1720 ----:----|----:----|----:----|----:----|----:--- CAAATACGGTAACAAGTTAATCCGTACAGAGTACCACTATAGTCAATT / / / // / // / / / / MaeII | | || | || | EcoRV | MseI AclI | | || | || BsmAI HphI | | || | |FatI | | || | CviAII | | || NlaIII | | |FatI | | CviAII | NlaIII | NspI TspEI V Y A I V Q L G M S H G D I S * F M P L F N * A C L M V I S V X L C H C S I R H V S W * Y Q L X ----:----|----:----|----:----|----:----|----:--- T * A M T * N P M D * P S I L * R K H W Q E I L C T E H H Y * N N I G N N L * A H R M T I D T L # Enzymes that cut Frequency Isoschizomers AarI 2 AccI 1 FblI,XmiI AciI 7 BspACI,SsiI AclI 2 Psp1406I AflIII 1 AluI 4 AluBI AlwNI 1 CaiI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 2 MlsI,MluNI,MscI,Msp20I BbvI 5 BseXI,BstV1I,Lsp1109I BccI 7 BceAI 2 BcgI 4 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BglII 2 BinI* 1 AlwI,BspPI,AclWI BisI 5 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 5 BmgT120I 2 BmtI 1 BspOI BsaAI 1 BstBAI,Ppu21I BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 1 BseSI 1 BaeGI,BstSLI BsgI 1 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BspCNI 1 BspHI 2 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 5 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstAPI 1 BstKTI 4 Cac8I 6 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I CfrI 2 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CspCI 1 CviAII 11 CviJI 19 CviKI-1 CviRI* 11 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 4 MalI DsaI* 2 BtgI,BstDSI Eco47III 1 Aor51HI,AfeI Eco57I 4 AcuI Eco57MI 4 EcoP15I 1 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FalI 4 FatI 11 FauI 4 SmuI FokI 3 GlaI 1 HaeII 1 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 2 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 1 HpaII 2 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 3 Hpy99I 2 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 7 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 2 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 10 MfeI 2 MunI MnlI 6 MseI 9 Tru1I,Tru9I MwoI 13 HpyF10VI,BstMWI NcoI 1 Bsp19I NheI 1 AsuNHI NlaIII 11 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 2 BstNSI,XceI PstI 2 RsaI 4 AfaI SalI 1 ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 19 SexAI 1 MabI SfaNI 2 LweI SfeI* 3 BstSFI,SfcI,BfmI SnaBI 1 Eco105I,BstSNI SspI 5 StuI 1 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 5 TaqI 8 TatI 1 TfiI 1 PfeI TseI 5 ApeKI TsoI 5 Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 8 TspEI 17 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 3 TscAI VspI 1 PshBI,AseI XcmI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AcyI AflII AgeI AhaIII* AjuI AlfI AloI ApaI ApaLI ApoI AscI Asp718I AvaI AvrII BamHI BarI BbvCI BbvII* Bce83I* BdaI BetI* BfiI BglI BmeT110I BplI Bpu10I BsaBI BsaXI BsePI BseRI BseYI BsiI* BsmI Bsp120I Bsp1407I BspMII* BsrBI BssNAI Bst1107I BstEII BstXI BstZ17I BtgZI BtrI BtsI Cfr10I Cfr9I DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I EcoICRI EcoNI EcoRI EcoT22I EgeI EheI Esp3I EspI* FnuDII* FseI FspAI GsaI GsuI HgiAI* Hin4I HpaI KasI KpnI MauBI McrI* MluI MlyI MmeI Mph1103I MroNI MslI MstI* NaeI NarI NdeI NgoMIV NmeAIII NotI NruI NsiI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SanDI SapI SauI* ScaI SchI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TaqII TauI Tsp45I TspMI TstI Tth111I XbaI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769