Restriction Map of PHM7/YOL084W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

PHM7/YOL084W on chromosome XV from coordinates 162356 to 165331.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.7490

CviJI |MboII || Tsp4CI* || | TaqI Tsp4CI* || | | TspDTI BceAI | AciI \\ \ \ \ \ \ \ ATGGCTGACAGTTCTTCGACTTCGGCGTTCATTTCAACCCTGATTATCTACGGTCTTACC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGACTGTCAAGAAGCTGAAGCCGCAAGTAAAGTTGGGACTAATAGATGCCAGAATGG / / / / / / | | | TaqI | Tsp4CI* | | TspDTI BceAI | Tsp4CI* CviJI MboII M A D S S S T S A F I S T L I I Y G L T W L T V L R L R R S F Q P * L S T V L P G * Q F F D F G V H F N P D Y L R S Y R ----:----|----:----|----:----|----:----|----:----|----:----| X A S L E E V E A N M E V R I I * P R V X P Q C N K S K P T * K L G S * R R D * H S V T R R S R R E N * G Q N D V T K G AciI MwoI |BisI ||BlsI ||AsuI* |||TauI |||CviJI |||HaeIII |||BmgT120I |||| Ksp632I* |||| | Hin4I |||| | | AccI |||| | | |BssNAI |||| | | |Hpy166II |||| | | || MboII Hpy99I CviJI MwoI |||| | | || |CviJI \ \ \ \\\\ \ \ \\ \\ GCCGTCGTGTTTGTCTGGCTCTTTTTGCTATTGCGGCCCAAGAATAGAAGAGTATACGAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCAGCACAAACAGACCGAGAAAAACGATAACGCCGGGTTCTTATCTTCTCATATGCTC // / / / ////// // // / / |Hpy99I | MwoI | |||||AsuI* |Ksp632I* || | CviJI AciI CviJI | ||||| Hin4I || MboII | ||||BmgT120I |AccI | |||HaeIII Hpy166II | |||CviJI BssNAI | ||BisI | ||AciI | |BlsI | TauI MwoI A V V F V W L F L L L R P K N R R V Y E P S C L S G S F C Y C G P R I E E Y T S R R V C L A L F A I A A Q E * K S I R A ----:----|----:----|----:----|----:----|----:----|----:----| A T T N T Q S K K S N R G L F L L T Y S R R R T Q R A R K A I A A W S Y F L I R G D H K D P E K Q * Q P G L I S S Y V L SecI* Hin4I DsaI* | Hpy188I MboII | Tsp4CI* | | MnlI |NlaIV | | SmlI | | | BetI* || BsrI | | AflII | | | BspMII* || |XmnI | | |MseI | | | |HpaII || || Hin4II* | | |BsmAI | | | |Hpy178III* || || | AlwNI | | |Eco31I | | | ||Ksp632I* || || | Hpy178III* \ \ \\ \ \ \ \\\ \\ \\ \ \ CCACGGTCTCTTAAGGACATTCAGACTATTCCGGAGGAAGAGAGAACGGAACCAGTTCCT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGCCAGAGAATTCCTGTAAGTCTGATAAGGCCTCCTTCTCTCTTGCCTTGGTCAAGGA // //// / / /// / / /// // |DsaI* |||Hin4I | MnlI ||Ksp632I* | | ||| |Hpy178III* |SecI* ||Eco31I Hpy188I |BspMII* | | ||| TspGWI Tsp4CI* ||BsmAI |BetI* | | ||AlwNI |AflII Hpy178III* | | |Hin4II* |SmlI HpaII | | XmnI MseI | NlaIV | BsrI MboII P R S L K D I Q T I P E E E R T E P V P H G L L R T F R L F R R K R E R N Q F L T V S * G H S D Y S G G R E N G T S S * ----:----|----:----|----:----|----:----|----:----|----:----| G R D R L S M * V I G S S S L V S G T G A V T E * P C E S * E P P L S F P V L E W P R K L V N L S N R L F L S R F W N R Hpy178III* TspGWI Eco57I | FokI | CviJI Eco57MI |TaqI AciI BseGI \ \ \ \\ \ \ GAAGGCTACTTCGGGTGGGTTGAATATCTACTCTCGAAACCGCACTCGTTTCTCATCCAG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCCGATGAAGCCCACCCAACTTATAGATGAGAGCTTTGGCGTGAGCAAAGAGTAGGTC / / // / / / CviJI Eco57MI |TaqI | FokI BseGI Eco57I | AciI Hpy178III* E G Y F G W V E Y L L S K P H S F L I Q K A T S G G L N I Y S R N R T R F S S S R L L R V G * I S T L E T A L V S H P A ----:----|----:----|----:----|----:----|----:----|----:----| S P * K P H T S Y R S E F G C E N R M W Q L S S R T P Q I D V R S V A S T E * G F A V E P P N F I * E R F R V R K E D L Hpy166II MseI OliI | MwoI | BceAI MslI | | CviJI | | PsrI Hpy166II \ \ \ \ \ \ \ \ CACACAAGCGTGGACGGCTATTTTCTGTTAAGATATATCGGTATCGTGGGTTCACTTTCG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTGTTCGCACCTGCCGATAAAAGACAATTCTATATAGCCATAGCACCCAAGTGAAAGC / // / / / / / / | || CviJI | | BceAI | PsrI | |Hpy166II | MseI Hpy166II | MwoI PsrI MslI OliI H T S V D G Y F L L R Y I G I V G S L S T Q A W T A I F C * D I S V S W V H F R H K R G R L F S V K I Y R Y R G F T F V ----:----|----:----|----:----|----:----|----:----|----:----| C V L T S P * K R N L Y I P I T P E S E A C L R P R S N E T L I Y R Y R P N V K V C A H V A I K Q * S I D T D H T * K R PsrI MaeIII | CviJI Hpy166II Tsp4CI* \ \ \ \ TTTGTGGGCTGTTTGCTTCTTTTACCGATATTGCTTCCCGTGAACGCTACCAACGGTAAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AAACACCCGACAAACGAAGAAAATGGCTATAACGAAGGGCACTTGCGATGGTTGCCATTG / / / / CviJI Hpy166II | MaeIII Tsp4CI* F V G C L L L L P I L L P V N A T N G N L W A V C F F Y R Y C F P * T L P T V T C G L F A S F T D I A S R E R Y Q R * Q ----:----|----:----|----:----|----:----|----:----|----:----| N T P Q K S R K G I N S G T F A V L P L T Q P S N A E K V S I A E R S R * W R Y K H A T Q K K * R Y Q K G H V S G V T V CviJI MaeIII SetI | Hin4II* | PsrI SetI \ \ \ \ \ \ AACCTTCAAGGCTTTGAACTGCTATCATTTTCAAATGTTACCAACAAGAACAGGTTTTAC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGAAGTTCCGAAACTTGACGATAGTAAAAGTTTACAATGGTTGTTCTTGTCCAAAATG / // / / / SetI |Hin4II* PsrI MaeIII SetI CviJI N L Q G F E L L S F S N V T N K N R F Y T F K A L N C Y H F Q M L P T R T G F T P S R L * T A I I F K C Y Q Q E Q V L R ----:----|----:----|----:----|----:----|----:----|----:----| L R * P K S S S D N E F T V L L F L N * C G E L S Q V A I M K L H * W C S C T K V K L A K F Q * * K * I N G V L V P K V Hin6I FnuDII* |GlaI ||HhaI ||| MaeII ||| | SetI ||| | TaiI ||| | | PsrI ||| | | | BsiI* ||| | | | | MboI ||| | | | | XhoII ||| | | | | | DpnI ||| | | | | | MnlI ||| | | | | | |BstKTI ||| | | | | | || BinI* ||| | | | | | || | HphI ||| | | | | | || | | CviJI ||| | | | | | || | | HaeIII ||| | | | | | || | | | Hpy166II AluI ||| | | | | | || | | | | SetI CviJI \\\ \ \ \ \ \ \\ \ \ \ \ \ \ GCGCACGTTTTCCTCTCGTGGATCTTTTTTGGCCTGTTCACCTATGTCATCTACAAGGAG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CGCGTGCAAAAGGAGAGCACCTAGAAAAAACCGGACAAGTGGATACAGTAGATGTTCCTC //// / / // / / / // / / |||| MaeII | || | | | |SetI | CviJI |||| PsrI | || | | | Hpy166II | AluI |||TaiI | || | | HaeIII SetI |||SetI | || | | CviJI ||Hin6I | || | BinI* |GlaI | || | HphI FnuDII* | || XhoII HhaI | || MboI | |DpnI | BstKTI | MnlI BsiI* A H V F L S W I F F G L F T Y V I Y K E R T F S S R G S F L A C S P M S S T R S A R F P L V D L F W P V H L C H L Q G A ----:----|----:----|----:----|----:----|----:----|----:----| A C T K R E H I K K P R N V * T M * L S R A R K G R T S R K Q G T * R H * R C P R V N E E R P D K K A Q E G I D D V L L FatI |CviAII MaeII || NspI | SetI || NlaIII MboII | TaiI || | EcoP15I BbvII* SetI | | Hpy99I || | | CviRI* | PshAI \ \ \ \ \\ \ \ \ \ \ CTGTATTACTACGTCGTGTTTAGACATGCTATGCAGACAACACCACTCTATGACGGACTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GACATAATGATGCAGCACAAATCTGTACGATACGTCTGTTGTGGTGAGATACTGCCTGAC // / / // // / / || MaeII | || |CviRI* | BbvII* |Hpy99I | || EcoP15I | PshAI TaiI | |FatI MboII SetI | CviAII NlaIII NspI L Y Y Y V V F R H A M Q T T P L Y D G L C I T T S C L D M L C R Q H H S M T D C V L L R R V * T C Y A D N T T L * R T A ----:----|----:----|----:----|----:----|----:----|----:----| S Y * * T T N L C A I C V V G S * S P S A T N S R R T * V H * A S L V V R H R V Q I V V D H K S M S H L C C W E I V S Q Tsp4CI* | MaeIII | Tsp45I | | BtgZI | | |TspEI | | || BplI MnlI | | || BplI | SmlI MaeI | | || | Bce83I* | | Hpy178III* TspGWI | | || | |CviRI* | | |SfaNI \ \ \ \\ \ \\ \ \ \\ CTGTCTTCTAGGACGGTTATCGTCACAGAATTGCACAAGAGCATCGCTCAAGAGGGGGAG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GACAGAAGATCCTGCCAATAGCAGTGTCTTAACGTGTTCTCGTAGCGAGTTCTCCCCCTC / / / // //// / / / / | | Tsp4CI* || |||CviRI* MnlI | | BplI | MaeI || ||TspEI | | BplI TspGWI || |BtgZI | SfaNI || Bce83I* Hpy178III* |Tsp45I SmlI |MaeIII BplI BplI L S S R T V I V T E L H K S I A Q E G E C L L G R L S S Q N C T R A S L K R G R V F * D G Y R H R I A Q E H R S R G G D ----:----|----:----|----:----|----:----|----:----|----:----| S D E L V T I T V S N C L L M A * S P S A T K * S P * R * L I A C S C R E L P P Q R R P R N D D C F Q V L A D S L L P L CviJI HaeIII | FnuDII* | | MboI | | Hin4II* | | | DpnI | | | |BstKTI StyI | | | || DdeI BplI SecI* | | | || AjuI BplI | AjuI | | | || | Hpy188I |CviRI* | | CviJI | | | || | | CviRI* \\ \ \ \ \ \ \ \\ \ \ \ ATGCAAATGCGTTTCCCCAAGGCTTCCAATGTGGCCTTCGCGTATGATCTCTCAGACTTG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTTTACGCAAAGGGGTTCCGAAGGTTACACCGGAAGCGCATACTAGAGAGTCTGAAC / / // / / / // / // / CviRI* AjuI |CviJI | | | || | |DdeI CviRI* SecI* | | | || | Hpy188I StyI | | | || MboI | | | |DpnI | | | BstKTI | | | AjuI | | Hin4II* | FnuDII* HaeIII CviJI M Q M R F P K A S N V A F A Y D L S D L C K C V S P R L P M W P S R M I S Q T C A N A F P Q G F Q C G L R V * S L R L A ----:----|----:----|----:----|----:----|----:----|----:----| I C I R K G L A E L T A K A Y S R E S K S A F A N G W P K W H P R R T H D R L S H L H T E G L S G I H G E R I I E * V Q BbvI | AluI | CviJI | |DdeI | ||SetI TseI | ||| MwoI AluI | ||| | TseI CviJI TspEI | ||| | |BisI |BisI BspCNI | ||| | ||BbvI Csp6I ||BlsI |BseMII | ||| | ||BlsI |RsaI ||SetI \\ \ \\\ \ \\\ \\ \\\ CAAGAATTGTGTAAAGAAAGAGCTAAGAACGCTGCGAAGTACGAAGCTGCGTTGAATAAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTAACACATTTCTTTCTCGATTCTTGCGACGCTTCATGCTTCGACGCAACTTATTC // / / / // /// / // / //// / || TspEI | | |DdeI ||| | || | |||TseI SetI |BseMII | | MwoI ||| | || | ||BisI BspCNI | CviJI ||| | || | |BlsI | AluI ||| | || | CviJI | BbvI ||| | || | AluI SetI ||| | || SetI ||| | |Csp6I ||| | RsaI ||| BbvI ||TseI |BisI BlsI Q E L C K E R A K N A A K Y E A A L N K K N C V K K E L R T L R S T K L R * I R R I V * R K S * E R C E V R S C V E * G ----:----|----:----|----:----|----:----|----:----|----:----| C S N H L S L A L F A A F Y S A A N F L A L I T Y L F L * S R Q S T R L Q T S Y L F Q T F F S S L V S R L V F S R Q I L TatI Bsp1407I SetI |Csp6I \ \\ GTTCTAAACAAGTGCGTGAAAATGACCCGAAACAAGACCCAAAAGCAACTTGACAAGTTG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGATTTGTTCACGCACTTTTACTGGGCTTTGTTCTGGGTTTTCGTTGAACTGTTCAAC V L N K C V K M T R N K T Q K Q L D K L F * T S A * K * P E T R P K S N L T S C S K Q V R E N D P K Q D P K A T * Q V V ----:----|----:----|----:----|----:----|----:----|----:----| T R F L H T F I V R F L V W F C S S L N P E L C T R S F S G F C S G F A V Q C T N * V L A H F H G S V L G L L L K V L Q Acc65I HgiCI* Tsp4CI* |Csp6I ||RsaI MaeII Hin6I ||NlaIV |BsaAI |GlaI ||| KpnI || SetI ||HhaI RsaI ||| | CviJI BsmAI || TaiI |||HaeII \ \\\ \ \ \ \\ \ \\\\ TACAATAACGGTACCAAGCCAAAGGACGATTTAGAGACATACGTGCCACATAAAAAGCGC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTATTGCCATGGTTCGGTTTCCTGCTAAATCTCTGTATGCACGGTGTATTTTTCGCG /// // /// / / / // //// ||| || ||| CviJI BsmAI | |MaeII |||Hin6I ||| || ||HgiCI* | BsaAI ||GlaI ||| || ||Acc65I TaiI |HhaI ||| || |Csp6I SetI HaeII ||| || NlaIV ||| || RsaI ||| |KpnI ||| Tsp4CI* ||Bsp1407I ||TatI |Csp6I RsaI Y N N G T K P K D D L E T Y V P H K K R T I T V P S Q R T I * R H T C H I K S A Q * R Y Q A K G R F R D I R A T * K A P ----:----|----:----|----:----|----:----|----:----|----:----| Y L L P V L G F S S K S V Y T G C L F R T C Y R Y W A L P R N L S M R A V Y F A V I V T G L W L V I * L C V H W M F L A MaeI AciI | AciI BisI | |BisI MaeII |BlsI | ||BlsI | SetI TspEI ||TauI | |||TauI MseI | TaiI \ \\\ \ \\\\ \ \ \ CCTAAACATCGTTTGGGAAAATTGCCGCTTTGTCTAGGCGGCAAAAAAGTTAATACGTTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGATTTGTAGCAAACCCTTTTAACGGCGAAACAGATCCGCCGTTTTTTCAATTATGCAAC ///// / /// / / / ||||AciI | ||BisI | | MaeII |||BisI | ||AciI | TaiI ||BlsI | |BlsI | SetI |TauI | TauI MseI TspEI MaeI P K H R L G K L P L C L G G K K V N T L L N I V W E N C R F V * A A K K L I R C * T S F G K I A A L S R R Q K S * Y V V ----:----|----:----|----:----|----:----|----:----|----:----| G L C R K P F N G S Q R P P L F T L V N G * V D N P F I A A K D L R C F L * Y T R F M T Q S F Q R K T * A A F F N I R Q XmnI |TfiI |HinfI || FatI || BspHI || |CviAII TspEI || |Hpy178III* | Ksp632I* || || MboII CviJI MaeI | | TspDTI || || NlaIII | TspDTI \ \ \ \ \\ \\ \ \ \ TCTTATTCTAGTAAAAGGATTGGGGAATTGAACGAAGAGATTCATGAAAAACAAGCCGAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AGAATAAGATCATTTTCCTAACCCCTTAACTTGCTTCTCTAAGTACTTTTTGTTCGGCTA / / / / / // / // MaeI | | | | |BspHI | |MwoI | | | | |FatI | |BglI | | | | | | TspDTI | | | | | CviJI | | | | Hpy178III* | | | | CviAII | | | | MboII | | | NlaIII | | | HinfI | | | TfiI | | XmnI | Ksp632I* TspDTI TspEI S Y S S K R I G E L N E E I H E K Q A D L I L V K G L G N * T K R F M K N K P I L F * * K D W G I E R R D S * K T S R L ----:----|----:----|----:----|----:----|----:----|----:----| D * E L L L I P S N F S S I * S F C A S T K N * Y F S Q P I S R L S E H F V L R R I R T F P N P F Q V F L N M F F L G I BsrI |BsmAI BglI || MlyI MwoI || PleI |AsuI* || | TaqI ||BmgT120I || | |Hpy178III* SfaNI |||CviJI SetI || | || HinfI | Hin6I |||HaeIII | Cac8I || | || | MfeI | |GlaI ||||BsrI | | BspMI || | || | TspEI | ||HhaI \\\\\ \ \ \ \\ \ \\ \ \ \ \\\ TGGGCCAGTAATGATAGGCAACCTGCCTGCTTTATCCAGTTCGAGACTCAATTGGAAGCG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCGGTCATTACTATCCGTTGGACGGACGAAATAGGTCAAGCTCTGAGTTAACCTTCGC /// / / / /// // / / /// ||AsuI* SetI Cac8I | ||| || | | ||Hin6I |BmgT120I | ||| || | | |SfaNI |HaeIII | ||| || | | |GlaI |CviJI | ||| || | | HhaI BsrI | ||| || | TspEI | ||| || | MfeI | ||| || HinfI | ||| |Hpy178III* | ||| TaqI | ||BsmAI | |PleI | MlyI BspMI BsrI W A S N D R Q P A C F I Q F E T Q L E A G P V M I G N L P A L S S S R L N W K R G Q * * * A T C L L Y P V R D S I G S A ----:----|----:----|----:----|----:----|----:----|----:----| Q A L L S L C G A Q K I W N S V * N S A N P W Y H Y A V Q R S * G T R S E I P L P G T I I P L R G A K D L E L S L Q F R ApoI PflMI TspEI BsiYI* |HgaI TsoI \ \\ \ CAAAGATGCTACCAATCTGTGGAAGCAATCTTGGGTAAGAAAAATTTTGGTAAGCGTCTT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCTACGATGGTTAGACACCTTCGTTAGAACCCATTCTTTTTAAAACCATTCGCAGAA / / / / BsiYI* | | TsoI PflMI | HgaI TspEI ApoI Q R C Y Q S V E A I L G K K N F G K R L K D A T N L W K Q S W V R K I L V S V L K M L P I C G S N L G * E K F W * A S Y ----:----|----:----|----:----|----:----|----:----|----:----| C L H * W D T S A I K P L F F K P L R R A F I S G I Q P L L R P Y S F N Q Y A D L S A V L R H F C D Q T L F I K T L T K MaeII | MseI | SetI | TaiI | BbvII* | |HpaI | |HindII | |Hpy166II | || HgaI | || MboII | || | BsrI | || | |TseI | || | ||BisI | || | |||BlsI | || | ||||FatI | || | |||||BfiI | || | |||||CviAII | || | ||||||Cac8I | || | ||||||| SphI | || | ||||||| NspI | || | ||||||| NlaIII | || | ||||||| | DdeI | || | ||||||| | |BbvI | || | ||||||| | || BplI | || | ||||||| | || BplI | || | ||||||| | || BsmAI | || | ||||||| | || Esp3I | || | ||||||| | || | GsuI | || | ||||||| | || | Eco57MI | || | ||||||| | || | | BsmAI | || | ||||||| | || | | | BspCNI CviJI | || | ||||||| | || | | | |BseMII \ \ \\ \ \\\\\\\ \ \\ \ \ \ \\ ATTGGCTACTCGCCAGAAGACGTTAACTGGGGCAGCATGCGTCTCAGTTCAAAGGAGAGA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TAACCGATGAGCGGTCTTCTGCAATTGACCCCGTCGTACGCAGAGTCAAGTTTCCTCTCT / / / // / / /// /// / / / / // CviJI | | || | | ||| ||| BplI | | | |BseMII | | || | | ||| ||| BplI | | | |BsmAI | | || | | ||| ||FatI | | | BspCNI | | || | | ||| |CviAII | | Esp3I | | || | | ||| Cac8I | | BsmAI | | || | | ||NlaIII | BbvI | | || | | ||BfiI Eco57MI | | || | | ||TseI DdeI | | || | | ||NspI GsuI | | || | | ||SphI | | || | | |BisI | | || | | BlsI | | || | | HgaI | | || | BsrI | | || BbvII* | | || MboII | | |MseI | | Hpy166II | | HindII | | HpaI | MaeII TaiI SetI I G Y S P E D V N W G S M R L S S K E R L A T R Q K T L T G A A C V S V Q R R D W L L A R R R * L G Q H A S Q F K G E T ----:----|----:----|----:----|----:----|----:----|----:----| I P * E G S S T L Q P L M R R L E F S L * Q S S A L L R * S P C C A D * N L P S N A V R W F V N V P A A H T E T * L L S XcmI PfoI |AluI BssKI |CviJI EcoRII || SetI FatI | ScrFI || | BplI |CviAII | BseBI || | BplI || NlaIII CviJI \ \ \\ \ \ \\ \ \ CACTCCAGGAGAGCTGTGGCAAATACAATCATGGTGTTATTGATTATCTTTTGGGCTTTC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GTGAGGTCCTCTCGACACCGTTTATGTTAGTACCACAATAACTAATAGAAAACCCGAAAG / / / / / // / | | | CviJI | |FatI CviJI | | | BplI | CviAII | | | BplI NlaIII | | | AluI | | XcmI | | SetI | EcoRII | BssKI | PfoI BseBI ScrFI H S R R A V A N T I M V L L I I F W A F T P G E L W Q I Q S W C Y * L S F G L S L Q E S C G K Y N H G V I D Y L L G F P ----:----|----:----|----:----|----:----|----:----|----:----| C E L L A T A F V I M T N N I I K Q A K V S W S L Q P L Y L * P T I S * R K P K V G P S S H C I C D H H * Q N D K P S E MaeII | SetI | TaiI MmeI AjuI | |TspEI |AjuI TspDTI \ \ \\ \\ \ CCCGTTGCTGTGGTTGGTATCATCTCCAACGTCAATTTCCTTACCGATAAAGTTCCCTTC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GGGCAACGACACCAACCATAGTAGAGGTTGCAGTTAAAGGAATGGCTATTTCAAGGGAAG / / / / / / / AjuI | MaeII TspEI | MmeI TspDTI TaiI AjuI SetI P V A V V G I I S N V N F L T D K V P F P L L W L V S S P T S I S L P I K F P S R C C G W Y H L Q R Q F P Y R * S S L L ----:----|----:----|----:----|----:----|----:----|----:----| G T A T T P I M E L T L K R V S L T G K G R Q Q P Q Y * R W R * N G * R Y L E R G N S H N T D D G V D I E K G I F N G E FatI |CviAII || BdaI || BdaI || NspI || NlaIII || | TaqII || | | BccI MaeII || | | |SetI | SetI || | | || XcmI BsrI | TaiI || | | || Hpy178III* | BdaI | Hin4II* || | | || | Hin4II* | BdaI \ \ \\ \ \ \\ \ \ \ \ TTACGTTTCATCAACAACATGCCCACCTTCCTGATGGGTGTCATTACTGGTTTGTTGCCT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AATGCAAAGTAGTTGTTGTACGGGTGGAAGGACTACCCACAGTAATGACCAAACAACGGA / / / /// // // / / / / | Hin4II* | ||| || || | Hin4II* | BdaI | MaeII | ||| || || Hpy178III* | BdaI TaiI | ||| || |XcmI BsrI SetI | ||| || BccI | ||| |SetI | ||| TaqII | ||FatI | |CviAII | BdaI | BdaI NlaIII NspI L R F I N N M P T F L M G V I T G L L P Y V S S T T C P P S * W V S L L V C C L T F H Q Q H A H L P D G C H Y W F V A Y ----:----|----:----|----:----|----:----|----:----|----:----| K R K M L L M G V K R I P T M V P K N G R V N * * C C A W R G S P H * * Q N T A * T E D V V H G G E Q H T D N S T Q Q R MaeI |BsmAI SetI TstI HgaI \\ \ \ \ ACTATTGCGTTGGTCGTTTTGATGTCTCTAGTGCCACCTTTTATCGTAATGTTGGGGAAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TGATAACGCAACCAGCAAAACTACAGAGATCACGGTGGAAAATAGCATTACAACCCCTTT / / / / | | SetI TstI | BsmAI MaeI T I A L V V L M S L V P P F I V M L G K L L R W S F * C L * C H L L S * C W G N Y C V G R F D V S S A T F Y R N V G E T ----:----|----:----|----:----|----:----|----:----|----:----| V I A N T T K I D R T G G K I T I N P F * * Q T P R K S T E L A V K * R L T P S S N R Q D N Q H R * H W R K D Y H Q P F MboI XhoII | DpnI | |BstKTI | || BinI* | || | TspGWI MaeIII | || | | FatI Tsp45I | || | | |CviAII | MaeI | || | | |BsiYI* | | TstI | || | | || NlaIII DdeI | | | Hin4I | || | | || | Hin4I \ \ \ \ \ \ \\ \ \ \\ \ \ CTTAGTGGTTGCGTCACTAGGCAAGAAACGGATCTATACTCCCAAGCATGGTATTACGCT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GAATCACCAACGCAGTGATCCGTTCTTTGCCTAGATATGAGGGTTCGTACCATAATGCGA // / / / // / / / / / // |HgaI | | MaeI || | | | | | |FatI DdeI | Tsp45I || | | | | | CviAII | MaeIII || | | | | | Hin4I | Hin4I || | | | | NlaIII TstI || | | | BsiYI* || | | TspGWI || | BinI* || XhoII || MboI |DpnI BstKTI L S G C V T R Q E T D L Y S Q A W Y Y A L V V A S L G K K R I Y T P K H G I T L * W L R H * A R N G S I L P S M V L R F ----:----|----:----|----:----|----:----|----:----|----:----| S L P Q T V L C S V S R Y E W A H Y * A V * H N R * * A L F P D I S G L M T N R K T T A D S P L F R I * V G L C P I V S MlyI SetI PleI MaeIII |MboII SfaNI TfiI Tsp45I || Ksp632I* | Tsp4CI* HinfI | AciI || |CviRI* | | HindII | BsaBI HphI | MboII || || MnlI | | Hpy166II \ \ \ \ \ \\ \\ \ \ \ \ TTCGCTGTGATTCAAATCTTTTTAGTTGTCACCGCTACCTCTTCTGCATCTTCCACCGTT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCGACACTAAGTTTAGAAAAATCAACAGTGGCGATGGAGAAGACGTAGAAGGTGGCAA // / // / / / /// // // |BsaBI HphI || | | MboII ||| || |Hpy166II HinfI || | SetI ||| || |HindII TfiI || AciI ||| || SfaNI |Tsp45I ||| |Tsp4CI* |MaeIII ||| |PleI MboII ||| MlyI ||Ksp632I* |MnlI CviRI* F A V I Q I F L V V T A T S S A S S T V S L * F K S F * L S P L P L L H L P P L R C D S N L F S C H R Y L F C I F H R * ----:----|----:----|----:----|----:----|----:----|----:----| K A T I * I K K T T V A V E E A D E V T K R Q S E F R K L Q * R * R K Q M K W R E S H N L D K * N D G S G R R C R G G N EciI | BinI* | | MboI | | XhoII | | | DpnI | | | |BstKTI | | | ||AciI | | | ||| FatI | | | ||| |CviAII HinfI | | | ||| || NlaIII | TaqI | | | ||| || | XcmI FokI \ \ \ \ \ \\\ \\ \ \ \ GACTCGATTATTGACAGACCAAGATCCGCCATGACACTATTGGCAAATAACTTGCCAAAG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAGCTAATAACTGTCTGGTTCTAGGCGGTACTGTGATAACCGTTTATTGAACGGTTTC / / / / // / // // / / / | TaqI EciI | || | || || XcmI FokI BseGI HinfI | || | || |FatI | || | || CviAII | || | |NlaIII | || | AciI | || XhoII | || MboI | |DpnI | BstKTI BinI* D S I I D R P R S A M T L L A N N L P K T R L L T D Q D P P * H Y W Q I T C Q R L D Y * Q T K I R H D T I G K * L A K G ----:----|----:----|----:----|----:----|----:----|----:----| S E I I S L G L D A M V S N A F L K G F Q S S * Q C V L I R W S V I P L Y S A L V R N N V S W S G G H C * Q C I V Q W L AsuI* |CviJI SfaNI |HaeIII | TspDTI |BmgT120I | | FatI ||BsrI | | |CviAII ||NlaIV | | || TatI ||| FatI | | || |Csp6I ||| |CviAII | | || |NlaIII SetI ||| || NlaIII BseGI | | || ||RsaI MmeI |MseI ||| || | MboI \ \ \ \\ \\\ \ \\ \\\ \\ \ \ GCATCCAACTTTTATATCATGTACTTCATATTGAAAGGTTTAACTGGCCCCACATGGACG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAGGTTGAAAATATAGTACATGAAGTATAACTTTCCAAATTGACCGGGGTGTACCTGC // / ///// / / / //// / // / || | ||||| MmeI SetI | |||| | || BstKTI || | ||||TatI | |||| | |FatI || | |||Csp6I | |||| | CviAII || | ||RsaI | |||| NlaIII || | |FatI | |||AsuI* || | CviAII | ||BmgT120I || NlaIII | ||NlaIV |SfaNI | |HaeIII TspDTI | |CviJI | BsrI MseI A S N F Y I M Y F I L K G L T G P T W T H P T F I S C T S Y * K V * L A P H G R I Q L L Y H V L H I E R F N W P H M D D ----:----|----:----|----:----|----:----|----:----|----:----| A D L K * I M Y K M N F P K V P G V H V P M W S K Y * T S * I S L N L Q G W M S C G V K I D H V E Y Q F T * S A G C P R MseI |HpaI |HindII |Hpy166II DpnI || TseI |BstKTI || |BisI StyI || CviRI* || ||BlsI AvrII || | BbvI || ||| DdeI SecI* TfiI || | Cac8I || ||| | MmeI |MaeI SetI HinfI \\ \ \ \\ \\\ \ \ \\ \ \ ATCTTGCAGGCAGTTAACTTGCTGCTAAGTAAAGTCCTAGGTAGAGTGTTGGATTCTACC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAACGTCCGTCAATTGAACGACGATTCATTTCAGGATCCATCTCACAACCTAAGATGG / / / / / // /// // /// / | | | | | |MseI ||| |DdeI ||SecI* HinfI | | | | | | ||| MmeI ||AvrII TfiI | | | | | | ||TseI ||StyI | | | | | | |BisI |MaeI | | | | | | BlsI SetI | | | | | Hpy166II | | | | | HindII | | | | | HpaI | | | | BbvI | | | Cac8I | | CviRI* | MboI DpnI I L Q A V N L L L S K V L G R V L D S T S C R Q L T C C * V K S * V E C W I L P L A G S * L A A K * S P R * S V G F Y P ----:----|----:----|----:----|----:----|----:----|----:----| I K C A T L K S S L L T R P L T N S E V S R A P L * S A A L Y L G L Y L T P N * D Q L C N V Q Q * T F D * T S H Q I R G CfrI | BalI | CviJI | HaeIII | | AciI | | BisI | | |BlsI | | ||TauI | | ||XcmI | | ||Hin6I | | ||FnuDII* | | |||GlaI | | ||||FatI | | ||||HhaI Hpy166II | | |||||CviAII | BssKI StyI NlaIV | | ||||||BsiYI* | SecI* SecI* XcmI | AciI | | ||||||| NlaIII | EcoRII \ \ \ \ \ \ \\\\\\\ \ \ \ CCAAGGCAAAAATGGAACCGCTACAATACTTTGGCCACGCCGCGCATGGGCATTGTTTAC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTCCGTTTTTACCTTGGCGATGTTATGAAACCGGTGCGGCGCGTACCCGTAACAAATG / / / / / / ////// // / | XcmI | AciI | | |||||| |FatI Hpy166II SecI* NlaIV | | |||||| CviAII StyI | | |||||NlaIII | | |||||Hin6I | | ||||BsiYI* | | ||||GlaI | | |||FnuDII* | | |||AciI | | |||HhaI | | ||XcmI | | ||BisI | | |BlsI | | TauI | CfrI HaeIII CviJI BalI P R Q K W N R Y N T L A T P R M G I V Y Q G K N G T A T I L W P R R A W A L F T K A K M E P L Q Y F G H A A H G H C L P ----:----|----:----|----:----|----:----|----:----|----:----| G L C F H F R * L V K A V G R M P M T * G L A F I S G S C Y K P W A A C P C Q K W P L F P V A V I S Q G R R A H A N N V ScrFI ApoI MaeIII BseBI TspEI CviRI* | TaqI \ \ \ \ \ CCAGGCATTGAAATTCTGGTTTGCATTTATATCTGTTACTCGATTATCGCCCCTATACTG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCCGTAACTTTAAGACCAAACGTAAATATAGACAATGAGCTAATAGCGGGGATATGAC /// / / / / ||EcoRII TspEI CviRI* | TaqI ||BssKI ApoI MaeIII |SecI* BseBI ScrFI P G I E I L V C I Y I C Y S I I A P I L Q A L K F W F A F I S V T R L S P L Y C R H * N S G L H L Y L L L D Y R P Y T A ----:----|----:----|----:----|----:----|----:----|----:----| G P M S I R T Q M * I Q * E I I A G I S G L C Q F E P K C K Y R N S S * R G * V W A N F N Q N A N I D T V R N D G R Y Q TatI Bsp1407I |Csp6I ||RsaI Csp6I ||| TspEI |RsaI HindII ||| | MseI || Tsp4CI* Hpy166II HgaI ||| | |AhaIII* \\ \ \ \ \\\ \ \\ CTATTTTTCAGTACCGTAATGTTGACGCTACTTTATGTGGCGTATTTGTACAATTTAAAC 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GATAAAAAGTCATGGCATTACAACTGCGATGAAATACACCGCATAAACATGTTAAATTTG /// / / /// /// ||Tsp4CI* Hpy166II HgaI ||| ||MseI |Csp6I HindII ||| |AhaIII* RsaI ||| TspEI ||Bsp1407I ||TatI |Csp6I RsaI L F F S T V M L T L L Y V A Y L Y N L N Y F S V P * C * R Y F M W R I C T I * T I F Q Y R N V D A T L C G V F V Q F K L ----:----|----:----|----:----|----:----|----:----|----:----| S N K L V T I N V S S * T A Y K Y L K F A I K * Y R L T S A V K H P T N T C N L * K E T G Y H Q R * K I H R I Q V I * V MseI |AhaIII* MaeII ||Hin4II* AflIII ||| Hin6I MmeI |BsaAI ||| |GlaI | SduI || SetI ||| ||HhaI | HgiAI* || TaiI CviJI TaqI ||| |||TspEI | | Hpy178III* \\ \ \ \ \\\ \\\\ \ \ \ TACGTGTTTGGCTTCTCCTTCGATTTAAAGGGGCGCAATTATCCAAGAGCACTTTTCCAG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCACAAACCGAAGAGGAAGCTAAATTTCCCCGCGTTAATAGGTTCTCGTGAAAAGGTC / // / / / // /// / // / | || | CviJI | |MseI ||| TspEI |HgiAI* Hpy178III* | || AflIII | | ||Hin6I |SduI | |MaeII | | |GlaI MmeI | BsaAI | | HhaI TaiI | Hin4II* SetI | AhaIII* TaqI Y V F G F S F D L K G R N Y P R A L F Q T C L A S P S I * R G A I I Q E H F S R R V W L L L R F K G A Q L S K S T F P D ----:----|----:----|----:----|----:----|----:----|----:----| * T N P K E K S K F P R L * G L A S K W S R T Q S R R R N L P A C N D L L V K G V H K A E G E I * L P A I I W S C K E L Bce83I* | Tsp4CI* | | FatI ApoI Hin4I | | |CviAII XcmI TspEI SmlI Hin4I | | || NlaIII \ \ \ \ \ \ \\ \ ATTTTTGTTGGAATTTACTTGAGTGAAGTATGTCTGCTTGGACTGTTTATCATGGCAAAA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAACAACCTTAAATGAACTCACTTCATACAGACGAACCTGACAAATAGTACCGTTTT / / / / / / / // // XcmI TspEI SmlI Hin4I | | | |FatI |SetI ApoI Hin4I | | | | Hin4I | | | | Hin4I | | | CviAII | | NlaIII | Tsp4CI* Bce83I* I F V G I Y L S E V C L L G L F I M A K F L L E F T * V K Y V C L D C L S W Q K F C W N L L E * S M S A W T V Y H G K N ----:----|----:----|----:----|----:----|----:----|----:----| I K T P I * K L S T H R S P S N I M A F S K Q Q F K S S H L I D A Q V T * * P L N K N S N V Q T F Y T Q K S Q K D H C F BssKI EcoRII |SecI* ||ScrFI ||BseBI |||SetI |||Hin4I |||Hin4I |||| AsuI* |||| AvaII |||| DraII |||| PpuMI |||| |NlaIV |||| |BmgT120I |||| || AsuI* |||| || AvaII MboI |||| || |BmgT120I | DpnI |||| || ||PfoI | |BstKTI TspRI |||| || ||BssKI | || MaeIII |MaeI |||| || ||EcoRII | || Tsp45I || AluI |||| || ||| ScrFI | || |BinI* || CviJI |||| || ||| BseBI | || ||BtsI || | SetI \\\\ \\ \\\ \ \ \\ \\\ \\ \ \ ACCTGGGGTCCTTTGGTCCTGGAAGTGTTTTGGATCGTGGTCACTGCCCTAGCTCATATA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TGGACCCCAGGAAACCAGGACCTTCACAAAACCTAGCACCAGTGACGGGATCGAGTATAT / / /// // / / // / / / / /// | | ||PpuMI || | EcoRII || | | | | ||CviJI | | ||DraII || | BssKI || | | | | ||AluI | | ||AvaII || | PfoI || | | | | |MaeI | | ||AsuI* || BseBI || | | | | SetI | | || || ScrFI || | | | Tsp45I | | || |AvaII || | | | MaeIII | | || |AsuI* || | | BinI* | | || BmgT120I || | TspRI | | |BmgT120I || | BtsI | | NlaIV || MboI | EcoRII |DpnI | BssKI BstKTI | SecI* BseBI ScrFI T W G P L V L E V F W I V V T A L A H I P G V L W S W K C F G S W S L P * L I Y L G S F G P G S V L D R G H C P S S Y I ----:----|----:----|----:----|----:----|----:----|----:----| V Q P G K T R S T N Q I T T V A R A * I F R P D K P G P L T K S R P * Q G L E Y G P T R Q D Q F H K P D H D S G * S M Y Hpy99I | HgaI | | MseI | | | Hin6I | | | |GlaI | | | ||HhaI | | | |||HaeII ApoI | | | |||| Hpy188I TspEI | | | |||| | FatI Ksp632I* | MboII | | | |||| | |MnlI |MnlI | |TspDTI | | | |||| | |BccI || TspDTI | || AciI TaqI | | | |||| | |CviAII \\ \ \ \\ \ \ \ \ \ \\\\ \ \\ TATATGAAGAGGAAATTCATACCGCTATTCGACGCAGTTCCTTTAAGCGCCATCAGACAT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| ATATACTTCTCCTTTAAGTATGGCGATAAGCTGCGTCAAGGAAATTCGCGGTAGTCTGTA / / / / / / ///// / / // | Ksp632I* TspDTI AciI | TaqI ||||| | | |CviAII | TspDTI MboII Hpy99I ||||| | | BccI MnlI TspEI ||||| | NlaIII ApoI ||||| | NspI ||||| | MnlI ||||| Hpy188I ||||Hin6I |||GlaI ||HhaI |HaeII HgaI MseI Y M K R K F I P L F D A V P L S A I R H I * R G N S Y R Y S T Q F L * A P S D M Y E E E I H T A I R R S S F K R H Q T C ----:----|----:----|----:----|----:----|----:----|----:----| Y I F L F N M G S N S A T G K L A M L C I Y S S S I * V A I R R L E K L R W * V I H L P F E Y R * E V C N R * A G D S M SetI | BssKI | CviJI | | SduI PfoI | | HpaII BssKI | | ScrFI EcoRII | | CauII* GsuI | ScrFI NspI | | HgiJII* Eco57MI | BseBI CviRI* | | | CviJI | Hpy188I | BsmAI NlaIII | | | | HphI | | PshAI | Eco31I \ \ \ \ \ \ \ \ \ \ \ GCAAGAGGTGAGCCCGGCTATTCCTATCCTACATCGGACTTGGGTCTCCAGGAAATCAAG 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTCTCCACTCGGGCCGATAAGGATAGGATGTAGCCTGAACCCAGAGGTCCTTTAGTTC / / / / //// / / / / // / | SetI | | |||HphI | | PshAI | |Eco31I BsrDI CviRI* | | ||BssKI | Hpy188I | |BsmAI FatI | | ||CviJI Eco57MI | EcoRII | | |HpaII GsuI | BssKI | | CauII* | PfoI | | ScrFI BseBI | CviJI ScrFI HgiJII* SduI A R G E P G Y S Y P T S D L G L Q E I K Q E V S P A I P I L H R T W V S R K S R K R * A R L F L S Y I G L G S P G N Q G ----:----|----:----|----:----|----:----|----:----|----:----| A L P S G P * E * G V D S K P R W S I L H L L H A R S N R D * M P S P D G P F * C S T L G A I G I R C R V Q T E L F D L BsrDI | CviRI* | | BarI TspDTI | | | Hin4II* | TspDTI BarI AcyI \ \ \ \ \ \ \ \ GACATTGCAGATGAAATGAAGGGCAAATACGAACAAGACAATACACACGGGATTTTGACG 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTAACGTCTACTTTACTTCCCGTTTATGCTTGTTCTGTTATGTGTGCCCTAAAACTGC / / / / / / / | | Hin4II* | TspDTI BarI AcyI | CviRI* TspDTI BarI D I A D E M K G K Y E Q D N T H G I L T T L Q M K * R A N T N K T I H T G F * R H C R * N E G Q I R T R Q Y T R D F D A ----:----|----:----|----:----|----:----|----:----|----:----| S M A S S I F P L Y S C S L V C P I K V P C Q L H F S P C I R V L C Y V R S K S V N C I F H L A F V F L V I C V P N Q R TseI |BisI ||BlsI MaeIII |||AluI Tsp45I |||CviJI | HgaI FokI Hpy188I ||||DdeI | | StyI | CviJI | Hin4I |||||SetI | | SecI* BseGI | HaeIII | | BccI |||||| Hpy188I \ \ \ \ \ \ \ \ \ \\\\\\ \ CCCGTGACCAAGGATGATTTGAAAAAGGCCAATCTGATACCAGATAACGATGGCAGCTCA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| GGGCACTGGTTCCTACTAAACTTTTTCCGGTTAGACTATGGTCTATTGCTACCGTCGAGT / // / // // / /// // | || BseGI |FokI |Hin4I BccI ||| |DdeI | |SecI* | Hpy188I ||| Hpy188I | |StyI HaeIII ||CviJI | HgaI CviJI ||TseI Tsp45I ||AluI MaeIII |BisI BlsI SetI P V T K D D L K K A N L I P D N D G S S P * P R M I * K R P I * Y Q I T M A A Q R D Q G * F E K G Q S D T R * R W Q L R ----:----|----:----|----:----|----:----|----:----|----:----| G T V L S S K F F A L R I G S L S P L E A R S W P H N S F P W D S V L Y R H C S G H G L I I Q F L G I Q Y W I V I A A * BbvI | Tsp4CI* | |Csp6I | ||RsaI PleI | |||BspCNI |MlyI | ||||BseMII || Hpy188I Hpy178III* | |||||Hin4I || | MaeII |MnlI | |||||| MaeI || | | SetI ||MboI | |||||| | MaeIII HinfI || | | TaiI ||| DpnI \ \\\\\\ \ \ \ \\ \ \ \ \\\ \ GAGAACGGTACTCCTAGTAACCCCTTTGAGTCTGGTTCTGAACGTGCCTCTCTCTCTGGA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTGCCATGAGGATCATTGGGGAAACTCAGACCAAGACTTGCACGGAGAGAGAGACCT ///// / / / // / / / /// ||||Csp6I MaeI MaeIII HinfI || | MaeII | ||DpnI |||BseMII || TaiI | |BstKTI |||BbvI || SetI | Hpy178III* |||RsaI |Hpy188I MnlI ||BspCNI PleI BplI |Hin4I MlyI BplI Tsp4CI* E N G T P S N P F E S G S E R A S L S G R T V L L V T P L S L V L N V P L S L D E R Y S * * P L * V W F * T C L S L W I ----:----|----:----|----:----|----:----|----:----|----:----| S F P V G L L G K S D P E S R A E R E P L S R Y E * Y G R Q T Q N Q V H R E R Q L V T S R T V G K L R T R F T G R E R S BplI BplI TaqI BstKTI | BinI* | | MlyI | | PleI | | | MaeIII | | | Tsp45I | | | | HinfI | | | | | TaqI | | | | | |MboI | | | | | || DpnI | | | | | || |BstKTI | | | | | || ||Hpy178III* | | | | | || ||| TspEI | | | | | || ||| | MseI | | | | | || ||| | | BplI BseRI | | | | | || ||| | | BplI Tsp4CI* | BseRI \ \ \ \ \ \\ \\\ \ \ \ \ \ \ TCGAACGCAGAGAGTGACTCGATCAAGAAATTAAATGATACTGTTATCAAAAAATCAAGC 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTTGCGTCTCTCACTGAGCTAGTTCTTTAATTTACTATGACAATAGTTTTTTAGTTCG // / // // // / / / // / / / || | |PleI || || | | | |MseI Tsp4CI* | BseRI || | MlyI || || | | | TspEI BseRI || BinI* || || | | BplI |TaqI || || | | BplI MboI || || | Hpy178III* || || MboI || |DpnI || BstKTI || TaqI |HinfI Tsp45I MaeIII S N A E S D S I K K L N D T V I K K S S R T Q R V T R S R N * M I L L S K N Q A E R R E * L D Q E I K * Y C Y Q K I K H ----:----|----:----|----:----|----:----|----:----|----:----| D F A S L S E I L F N F S V T I L F D L I S R L S H S S * S I L H Y Q * * F I L R V C L T V R D L F * I I S N D F F * A StyI SecI* |MnlI TfiI MnlI || MnlI HinfI | Hpy178III* XmnI \\ \ \ \ \ \ ACTCTCTCCTCCTCTACCAAGGACAACAACGAATCTACTTTTGTTCCAGAGGGTGAAAAG 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGAGAGGAGGAGATGGTTCCTGTTGTTGCTTAGATGAAAACAAGGTCTCCCACTTTTC / // / / / / | |SecI* HinfI MnlI Hpy178III* XmnI | |StyI TfiI | MnlI MnlI T L S S S T K D N N E S T F V P E G E K L S P P L P R T T T N L L L F Q R V K S S L L L Y Q G Q Q R I Y F C S R G * K V ----:----|----:----|----:----|----:----|----:----|----:----| V R E E E V L S L L S D V K T G S P S F C E R R R * W P C C R I * K Q E L P H F S E G G R G L V V V F R S K N W L T F L Hin6I |BdaI |BdaI |GlaI ||HhaI |||HaeII HphI SfeI* MnlI BtgZI |||| MnlI \ \ \ \ \\\\ \ TTTCGCAAGTTTCACTACAGCGATGTTGAGGCATTGAGAAATAAGCGCCCTTATGATGAG 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGCGTTCAAAGTGATGTCGCTACAACTCCGTAACTCTTTATTCGCGGGAATACTACTC / // / //// / HphI |MnlI | |||| MnlI SfeI* | |||Hin6I | ||GlaI | |HhaI | HaeII | BdaI | BdaI BtgZI F R K F H Y S D V E A L R N K R P Y D E F A S F T T A M L R H * E I S A L M M R S Q V S L Q R C * G I E K * A P L * * G ----:----|----:----|----:----|----:----|----:----|----:----| N R L N * * L S T S A N L F L R G * S S T E C T E S C R H Q P M S F Y A G K H H K A L K V V A I N L C Q S I L A R I I L FokI Hpy166II | FatI | |BceAI | |CviAII | || AsuI* | || AvaII | || NlaIII | || Hin4II* | || |BdaI | || |BdaI MboI | || |BmgT120I BclI | || || SetI Hpy166II | DpnI | || || | HgiCI* | Eco57I AciI | |BseGI | || || | | SetI | Eco57MI FnuDII* | |BstKTI | || || | | NlaIV BsrI | |FauI | HgaI \ \\ \ \\ \\ \ \ \ \ \ \\ \ \ GATGATCATAGTAAACATGGACCTGAAGGTGCCGTGCCAGTAAACGCTGACGCGGGAGTT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTAGTATCATTTGTACCTGGACTTCCACGGCACGGTCATTTGCGACTGCGCCCTCAA // / / / ////// / / / / / / / / || BclI | | |||||| | | | BsrI | FauI | AciI || MboI | | |||||| | | HgiCI* Hpy166II FnuDII* |DpnI | | |||||| | NlaIV Eco57MI BstKTI | | |||||| SetI Eco57I BseGI | | |||||AvaII | | |||||AsuI* | | ||||BmgT120I | | |||SetI | | ||FatI | | |Hin4II* | | |CviAII | | |BceAI | | |BdaI | | |BdaI | | FokI | NlaIII Hpy166II D D H S K H G P E G A V P V N A D A G V M I I V N M D L K V P C Q * T L T R E L * S * * T W T * R C R A S K R * R G S Y ----:----|----:----|----:----|----:----|----:----|----:----| S S * L L C P G S P A T G T F A S A P T P H D Y Y V H V Q L H R A L L R Q R P L I I M T F M S R F T G H W Y V S V R S N BinI* | Tsp4CI* | | MboI | | | DpnI | | | |TspRI | | | |BstKTI | | | ||HpaII | | | ||| TseI | | | ||| |BisI | | | ||| ||BlsI | | | ||| |||AluI | | | ||| |||CviJI | | | ||| |||PvuII | | | ||| |||NspBII* | | | ||| |||| SetI | | | ||| |||| | FatI | | | ||| |||| | BspHI | | | ||| |||| | |CviAII | | | ||| |||| | |Hpy178III* | | | ||| |||| | || NlaIII | | | ||| |||| | || | CviJI | | | ||| |||| | || | | DdeI | | | ||| |||| | || | | SauI* | | | ||| |||| | || | | | TspDTI | | | ||| |||| | || | | | | MnlI | | | ||| |||| | || | | | | | BetI* | | | ||| |||| | || | | | | | BspCNI | | | ||| |||| | || | | | | | BspMII* | | | ||| |||| | || | | | | | |HpaII | | | ||| |||| | || | | | | | |BseMII | | | ||| |||| | || | | | | | |Hpy178III* | | | ||| |||| | || | | | | | || MnlI | | | ||| |||| | || |BbvI | | | | || |BseGI \ \ \ \\\ \\\\ \ \\ \\ \ \ \ \ \\ \\ ATTTACAGTGATCCGGCAGCTGTCATGAAAGAGCCTCAGGCATTTCCTCCGGATGTTTTG 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TAAATGTCACTAGGCCGTCGACAGTACTTTCTCGGAGTCCGTAAAGGAGGCCTACAAAAC / // // / / /// / // // / / // // / | || || | | ||| | || || | | || || BseGI | || || | | ||| | || || | | || || MnlI | || || | | ||| | || || | | || |BspMII* | || || | | ||| | || || | | || |BetI* | || || | | ||| | || || | | || Hpy178III* | || || | | ||| | || || | | || HpaII | || || | | ||| | || || | | |BseMII | || || | | ||| | || || | | BspCNI | || || | | ||| | || || | MnlI | || || | | ||| | || || TspDTI | || || | | ||| | || || SauI* | || || | | ||| | || || DdeI | || || | | ||| | || |CviJI | || || | | ||| | || BbvI | || || | | ||| | |BspHI | || || | | ||| | |FatI | || || | | ||| | Hpy178III* | || || | | ||| | CviAII | || || | | ||| NlaIII | || || | | ||NspBII* | || || | | ||PvuII | || || | | ||CviJI | || || | | ||TseI | || || | | ||AluI | || || | | |BisI | || || | | BlsI | || || | | SetI | || || | HpaII | || || MboI | || |DpnI | || BstKTI | |Tsp4CI* | BinI* TspRI HgaI I Y S D P A A V M K E P Q A F P P D V L F T V I R Q L S * K S L R H F L R M F W L Q * S G S C H E R A S G I S S G C F G ----:----|----:----|----:----|----:----|----:----|----:----| I * L S G A A T M F S G * A N G G S T K * K C H D P L Q * S L A E P M E E P H K N V T I R C S D H F L R L C K R R I N Q ApoI TspEI EcoRI | MboII PflMI | | TspEI FokI BsiYI* | | |MboII Hin4II* SetI \ \ \ \ \\ \ \ GAAACCAATACTTGGACAAGAAGAATTCTACAATTCTTCAACCCAAGAAGGTCGTATCCT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGGTTATGAACCTGTTCTTCTTAAGATGTTAAGAAGTTGGGTTCTTCCAGCATAGGA / // / / / / BsiYI* || | | Hin4II* SetI PflMI || | TspEI FokI || MboII |EcoRI |TspEI |ApoI MboII E T N T W T R R I L Q F F N P R R S Y P K P I L G Q E E F Y N S S T Q E G R I L N Q Y L D K K N S T I L Q P K K V V S F ----:----|----:----|----:----|----:----|----:----|----:----| S V L V Q V L L I R C N K L G L L D Y G P F W Y K S L F F E V I R * G L F T T D F G I S P C S S N * L E E V W S P R I R TaqI | BciVI | | Tsp4CI* | | Tth111I | | | TspRI | | | Hpy178III* | | | | TfiI | | | | HinfI | | | | BseGI FokI TaqI SfaNI \ \ \ \ \ \ \ \ TTCGACAGTGTCAGGATGAGATTCCCACTTGTTTTCAACACCAGCATCGAATACGATGAA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTGTCACAGTCCTACTCTAAGGGTGAACAAAAGTTGTGGTCGTAGCTTATGCTACTT // / / / / / / / / || | | | | HinfI FokI TaqI SfaNI || | | | | TfiI || | | | BseGI || | | Hpy178III* || | Tth111I || Tsp4CI* |BciVI |TaqI TspRI F D S V R M R F P L V F N T S I E Y D E S T V S G * D S H L F S T P A S N T M K R Q C Q D E I P T C F Q H Q H R I R * R ----:----|----:----|----:----|----:----|----:----|----:----| K S L T L I L N G S T K L V L M S Y S S K R C H * S S I G V Q K * C W C R I R H E V T D P H S E W K N E V G A D F V I F MboII |AluI |CviJI |TspDTI |Ecl136II || SetI || SduI || SacI || HgiAI* || HgiJII* || | BinI* || | | MboI || | | | DpnI || | | | |BstKTI || | | | ||FatI || | | | |||CviAII || | | | |||| NlaIII || | | | |||| | Hpy188I || | | | |||| | | BinI* || | | | |||| | | | MboI || | | | |||| | | | XhoII || | | | |||| | | | | DpnI PflMI SspI || | | | |||| | | | | |BstKTI BsiYI* \ \\ \ \ \ \\\\ \ \ \ \ \\ \ GAATATTTGAGCTCTGCTTATACCGATCCATGTGTCAGAGAGAAAGATCCCATTGTGTGG 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATAAACTCGAGACGAATATGGCTAGGTACACAGTCTCTCTTTCTAGGGTAACACACC / / / / // / // / / // / / / SspI | Ecl136II | || | || | | || | BsiYI* TspGWI | CviJI | || | || | | || | PflMI | AluI | || | || | | || XhoII HgiJII* | || | || | | || MboI TspDTI | || | || | | |DpnI HgiAI* | || | || | | BstKTI MboII | || | || | BinI* SacI | || | || Hpy188I SduI | || | |FatI SetI | || | CviAII | || NlaIII | || MboI | |DpnI | BstKTI BinI* E Y L S S A Y T D P C V R E K D P I V W N I * A L L I P I H V S E R K I P L C G I F E L C L Y R S M C Q R E R S H C V V ----:----|----:----|----:----|----:----|----:----|----:----| S Y K L E A * V S G H T L S F S G M T H L I N S S Q K Y R D M H * L S L D W Q T F I Q A R S I G I W T D S L F I G N H P TspGWI | BinI* | | MboI Hin4I | | BamHI |ApoI | | XhoII |TspEI | | | DpnI ||MnlI | | | NlaIV ||| Hpy178III* | | | |BstKTI ||| | CviJI CviJI | | | || BinI* ||| | |MaeI SetI |DdeI \ \ \ \\ \ \\\ \ \\ \ \\ TGCTGTAAGGATCCGTTAGGAGTTTCAAAACAGCAAATTCAAGAGGCTAGGTCTAATGGC 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| ACGACATTCCTAGGCAATCCTCAAAGTTTTGTCGTTTAAGTTCTCCGATCCAGATTACCG / // / / / / / / / // / | || | BinI* Hin4I | | | | |MaeI CviJI | || XhoII | | | | SetI | || BamHI | | | CviJI | || MboI | | Hpy178III* | |NlaIV | TspEI | |DpnI | ApoI | BstKTI MnlI BinI* C C K D P L G V S K Q Q I Q E A R S N G A V R I R * E F Q N S K F K R L G L M A L * G S V R S F K T A N S R G * V * W L ----:----|----:----|----:----|----:----|----:----|----:----| H Q L S G N P T E F C C I * S A L D L P T S Y P D T L L K L V A F E L P * T * H A T L I R * S N * F L L N L L S P R I A Csp6I |RsaI Hin4I |SetI TspDTI \ \\ \ TTAGATGTAAGAGATGATTTCACAAGGTACGATGAAAAAGGAAAAGTCATATTCACTTAC 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTACATTCTCTACTAAAGTGTTCCATGCTACTTTTTCCTTTTCAGTATAAGTGAATG / / / // / | DdeI | |Csp6I TspDTI Hin4I | RsaI SetI L D V R D D F T R Y D E K G K V I F T Y * M * E M I S Q G T M K K E K S Y S L T R C K R * F H K V R * K R K S H I H L Q ----:----|----:----|----:----|----:----|----:----|----:----| K S T L S S K V L Y S S F P F T M N V * S L H L L H N * L T R H F L F L * I * K * I Y S I I E C P V I F F S F D Y E S V Hpy178III* DdeI | BseMII SauI* | |BspCNI |SetI | || MnlI || CviJI | || |MnlI || | TspDTI \ \\ \\ \\ \ \ AACCCTCCTGATTATGAACCTGAGGCTAAAAAATGA 2950 2960 2970 ----:----|----:----|----:----|----:- TTGGGAGGACTAATACTTGGACTCCGATTTTTTACT // // / / / / || || SetI | | TspDTI || |MnlI | CviJI || MnlI SauI* |BspCNI DdeI Hpy178III* BseMII N P P D Y E P E A K K * T L L I M N L R L K N X P S * L * T * G * K M X ----:----|----:----|----:----|----:- L G G S * S G S A L F H C G E Q N H V Q P * F I V R R I I F R L S F F S # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 11 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 1 AhaIII* 2 DraI AjuI 2 AluI 8 AluBI AlwNI 1 CaiI ApoI 6 AcsI,XapI AsuI* 6 Cfr13I,PspPI,Sau96I,AspS9I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 1 BarI 1 BbvI 6 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 2 BpuEI BceAI 3 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BdaI 4 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglI 1 BinI* 10 AlwI,BspPI,AclWI BisI 10 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 10 BmgT120I 6 BplI 6 BsaAI 2 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 5 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 5 BseRI 2 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BsmAI 7 Alw26I,BstMAI Bsp1407I 2 BsrGI,BstAUI BspCNI 5 BspHI 2 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BspMII* 2 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 1 BseMI,Bse3DI BsrI 7 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 13 BtgZI 2 BtsI 1 Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI Csp6I 8 CviQI,RsaNI CviAII 15 CviJI 34 CviKI-1 CviRI* 9 HpyCH4V DdeI 9 BstDEI,HpyF3I DpnI 13 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI EciI 1 Ecl136II 1 EcoICRI Eco31I 2 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 4 EcoP15I 1 EcoRI 1 EcoRII 5 AjnI,Psp6I,PspGI Esp3I 1 BsmBI FatI 15 FauI 1 SmuI FnuDII* 4 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 GlaI 7 GsuI 2 BpmI HaeII 3 BstH2I HaeIII 7 BsnI,BsuRI,BshFI,PhoI HgaI 7 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 7 BstHHI,CfoI,AspLEI Hin4I 6 Hin4II* 9 HpyAV Hin6I 7 HinP1I,HspAI HindII 4 HincII HinfI 9 HpaI 2 KspAI HpaII 4 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 12 Hpy8I Hpy178III* 16 Hpy188III Hpy188I 8 Hpy99I 3 KpnI 1 Ksp632I* 5 Eam1104I,EarI,Bst6I MaeI 9 FspBI,BfaI,XspI MaeII 9 HpyCH4IV MaeIII 10 MboI 13 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 12 MfeI 1 MunI MlyI 4 SchI MmeI 4 MnlI 17 MseI 10 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NlaIII 15 Hin1II,Hsp92II,FaeI NlaIV 7 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 4 BstNSI,XceI OliI 1 AleI PflMI 3 BasI,AccB7I,Van91I PfoI 3 PleI 4 PpsI PpuMI 1 Psp5II,PspPPI PshAI 2 BstPAI,BoxI PsrI 2 PvuII 1 RsaI 8 AfaI SacI 1 Psp124BI,SstI SauI* 2 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 6 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 8 BseDI,BssECI,BsaJI SetI 35 SfaNI 5 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 3 SmoI SphI 1 PaeI,BbuI SspI 1 StyI 5 Eco130I,EcoT14I,ErhI,BssT1I TaiI 9 TaqI 11 TaqII 1 TatI 3 TauI 4 TfiI 5 PfeI TseI 6 ApeKI TsoI 1 Tsp45I 6 NmuCI Tsp4CI* 13 HpyCH4III,TaaI,Bst4CI TspDTI 13 TspEI 16 TasI,Tsp509I,Sse9I TspGWI 4 TspRI 3 TscAI TstI 1 Tth111I 1 PflFI,PsyI,AspI XcmI 6 XhoII 5 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AgeI AlfI AloI ApaI ApaLI AscI AsuII AvaI BaeI BbvCI BcgI BglII BmeT110I BmtI Bpu10I BsaXI BsePI BseSI BseYI BsgI BslFI BsmFI BsmI Bsp120I BspLU11I* BspOI BsrBI BstAPI BstEII BstXI BtrI Cfr10I Cfr9I ClaI CspCI DinI DraIII DrdI Eam1105I Eco47III EcoNI EcoRV EcoT22I EgeI EheI EspI* FalI FaqI FseI FspAI GsaI HindIII KasI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI PacI PasI PmaCI PmeI PpiI PsiI PspOMI PspXI PstI PvuI RsrII SacII SalI SanDI SapI ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI VspI XbaI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769