Restriction Map of RPB11/YOL005C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RPB11/YOL005C on chromosome XV from coordinates 316175 to 315813.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.24476

EMBOSS_001 BsmI |Hpy178III* || TspDTI || |TfiI || |HinfI Hin4II* || || TaqI | Hin4II* || || AsuII | | TfiI AluI || || | TaqII | | HinfI CviJI || || | |Tsp4CI* | | | HphI | SetI \\ \\ \ \\ \ \ \ \ \ \ ATGAATGCTCCAGACAGATTCGAACTGTTCCTTCTGGGTGAAGGGGAATCCAAGCTAAAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTACGAGGTCTGTCTAAGCTTGACAAGGAAGACCCACTTCCCCTTAGGTTCGATTTC / / / / // / / / // / / BsmI | | | || Tsp4CI* | Hin4II* || | CviJI | | | |TaqII Hin4II* || | AluI | | | AsuII || SetI | | | TaqI |HinfI | | HinfI |TfiI | | TfiI HphI | TspDTI Hpy178III* M N A P D R F E L F L L G E G E S K L K * M L Q T D S N C S F W V K G N P S * R E C S R Q I R T V P S G * R G I Q A K D ----:----|----:----|----:----|----:----|----:----|----:----| X F A G S L N S S N R R P S P S D L S F X S H E L C I R V T G E P H L P I W A L H I S W V S E F Q E K Q T F P F G L * L AclI MaeII | Hin4II* AsuI* | |SetI AvaII | |TaiI |BmgT120I CviJI MwoI | || MnlI || AflIII \ \ \ \\ \ \\ \ ATTGACCCCGACACCAAAGCCCCCAACGCAGTAGTGATAACGTTTGAGAAGGAGGACCAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTGGGGCTGTGGTTTCGGGGGTTGCGTCATCACTATTGCAAACTCTTCCTCCTGGTG / / / // / // / | MwoI | || MnlI || BsiYI* CviJI | |MaeII || PflMI | |AclI || TaiI | Hin4II* || SetI TaiI |AvaII SetI |AsuI* BmgT120I I D P D T K A P N A V V I T F E K E D H L T P T P K P P T Q * * * R L R R R T T * P R H Q S P Q R S S D N V * E G G P H ----:----|----:----|----:----|----:----|----:----|----:----| I S G S V L A G L A T T I V N S F S S W S Q G R C W L G W R L L S L T Q S P P G N V G V G F G G V C Y H Y R K L L L V V MaeII AciI | PflMI BisI | BsiYI* SetI |BlsI | |SetI |TfiI ||TauI | |TaiI |HinfI CviRI* Hpy188I BsgI |||FokI \ \\ \\ \ \ \ \\\\ ACGTTGGGAAACCTGATTCGTGCAGAACTTCTGAACGACAGAAAAGTGCTGTTTGCCGCT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGCAACCCTTTGGACTAAGCACGTCTTGAAGACTTGCTGTCTTTTCACGACAAACGGCGA / / / / / / //// AflIII SetI | CviRI* Hpy188I BsgI |||AciI MaeII HinfI ||BisI TfiI |BlsI TauI T L G N L I R A E L L N D R K V L F A A R W E T * F V Q N F * T T E K C C L P L V G K P D S C R T S E R Q K S A V C R L ----:----|----:----|----:----|----:----|----:----|----:----| V N P F R I R A S S R F S L F T S N A A C T P F G S E H L V E S R C F L A T Q R R Q S V Q N T C F K Q V V S F H Q K G S AluI SetI Hin4II* CviJI | MboII |BseMII |DdeI | BseGI SfaNI ||BspCNI ||SetI MnlI SecI* CviJI \ \ \ \\\ \\\ \ \ \ TACAAGGTTGAGCATCCCTTCTTCGCTCGTTTCAAGCTGAGAATACAGACCACCGAGGGC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTCCAACTCGTAGGGAAGAAGCGAGCAAAGTTCGACTCTTATGTCTGGTGGCTCCCG // // /// / / / / // / |SetI |MboII ||BspCNI | | DdeI MnlI || CviJI FokI BseGI |Hin4II* | CviJI |SecI* |BseMII | AluI FalI SfaNI SetI FalI Y K V E H P F F A R F K L R I Q T T E G T R L S I P S S L V S S * E Y R P P R A Q G * A S L L R S F Q A E N T D H R G L ----:----|----:----|----:----|----:----|----:----|----:----| * L T S C G K K A R K L S L I C V V S P K C P Q A D R R R E N * A S F V S W R P V L N L M G E E S T E L Q S Y L G G L A MseI | SfaNI | | HindIII | | | AluI | | | CviJI | | | | SetI | | | | | KasI | | | | | HgiCI* | | | | | |AcyI | | | | | |NarI | | | | | |Hin6I | | | | | ||GlaI FalI | | | | | ||DinI FalI MaeIII | | | | | ||NlaIV | SfaNI | FalI | | | | | |||HhaI | Hin4II* BseGI FokI | FalI | | | | | ||||HaeII \ \ \ \ \ \ \ \ \ \ \ \\\\\ TACGACCCGAAGGATGCCTTGAAAAACGCCTGTAACAGCATCATTAACAAGCTTGGCGCC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTGGGCTTCCTACGGAACTTTTTGCGGACATTGTCGTAGTAATTGTTCGAACCGCGG / / / // / / / / / ///// | SfaNI BseGI |FokI MaeIII | | | | ||||HgiCI* Hin4II* FalI | | | | ||||KasI FalI | | | | |||Hin6I | | | | |||NarI | | | | |||AcyI | | | | ||NlaIV | | | | ||DinI | | | | ||GlaI | | | | |HhaI | | | | HaeII | | | HindIII | | SfaNI | | CviJI | | AluI | SetI MseI Y D P K D A L K N A C N S I I N K L G A T T R R M P * K T P V T A S L T S L A P R P E G C L E K R L * Q H H * Q A W R P ----:----|----:----|----:----|----:----|----:----|----:----| * S G F S A K F F A Q L L M M L L S P A S R G S P H R S F R R Y C C * * C A Q R V V R L I G Q F V G T V A D N V L K A G Eco57I Eco57MI | NlaIV | | SetI | | |CviRI* | | || BspMI ApoI | | || | MaeI TspEI | | || | | CviJI |BbvII* | | || | | |AciI || TaqI | | || | | |BisI MwoI || AsuII | | || | | ||BlsI Hpy99I || |MboII | | || | | |||TauI | Hpy99I \\ \\ \ \ \\ \ \ \\\\ \ \ CTGAAGACAAATTTCGAAACCGAGTGGAACCTGCAAACTCTAGCCGCCGACGACGCATTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GACTTCTGTTTAAAGCTTTGGCTCACCTTGGACGTTTGAGATCGGCGGCTGCTGCGTAAA // / / / / ////// // || | Eco57MI | CviRI* |||||| |Hpy99I || | Eco57I NlaIV |||||| MwoI || AsuII SetI |||||Hpy99I || TaqI ||||AciI |BbvII* |||BisI |MboII ||BlsI TspEI |CviJI ApoI |TauI BspMI MaeI L K T N F E T E W N L Q T L A A D D A F * R Q I S K P S G T C K L * P P T T H F E D K F R N R V E P A N S S R R R R I L ----:----|----:----|----:----|----:----|----:----|----:----| R F V F K S V S H F R C V R A A S S A N G S S L N R F R T S G A F E L R R R R M Q L C I E F G L P V Q L S * G G V V C K TGA --- ACT * X X --- Q K S # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AluI 3 AluBI ApoI 1 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 1 BseGI 2 BstF5I,BtsCI BseMII 1 BsgI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 1 BspMI 1 BfuAI,Acc36I,BveI CviJI 6 CviKI-1 CviRI* 2 HpyCH4V DdeI 1 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI Eco57I 1 AcuI Eco57MI 1 FalI 2 FokI 2 GlaI 1 HaeII 1 BstH2I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 5 HpyAV Hin6I 1 HinP1I,HspAI HindIII 1 HinfI 3 HphI 1 AsuHPI Hpy178III* 1 Hpy188III Hpy188I 1 Hpy99I 2 KasI 1 MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 1 MboII 2 MnlI 2 MseI 1 Tru1I,Tru9I MwoI 2 HpyF10VI,BstMWI NarI 1 Mly113I NlaIV 2 BspLI,BmiI,PspN4I PflMI 1 BasI,AccB7I,Van91I SecI* 1 BseDI,BssECI,BsaJI SetI 8 SfaNI 3 LweI TaiI 2 TaqI 2 TaqII 1 TauI 2 TfiI 3 PfeI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 1 TasI,Tsp509I,Sse9I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvI BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BsePI BseRI BseSI BseYI BsiI* BslFI BsmAI BsmFI Bsp120I Bsp1407I BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviAII CviQI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I Esp3I EspI* FaqI FatI FauI FnuDII* FseI FspAI GsaI GsuI HaeIII HgaI HgiAI* HgiJII* Hin4I HindII HpaI HpaII Hpy166II Hpy8I KpnI Ksp632I* MauBI MboI McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MslI MstI* MvaI NaeI NcoI NdeI NgoMIV NheI NlaIII NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SexAI SfeI* SfiI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TatI TseI TsoI Tsp45I TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769