Restriction Map of PHO80/YOL001W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

PHO80/YOL001W on chromosome XV from coordinates 325249 to 326130.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.4750

Hpy178III* | AclI | MaeII | | SetI | | TaiI | | | Hpy188I | | | | MnlI | | | | | FatI | | | | | |CviAII | | | | | || NlaIII | | | | | || | MboI | | | | | || | | DpnI | | | | | || | | BciVI | | | | | || | | |BstKTI | | | | | || | | || BinI* \ \ \ \ \ \\ \ \ \\ \ ATGGAAAGCACATCAGGAGAACGTTCCGAAAATATACATGAGGATCAAGGGATACCAAAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTTCGTGTAGTCCTCTTGCAAGGCTTTTATATGTACTCCTAGTTCCCTATGGTTTT / / / / / / // // / / | | | | | | || || MboI BinI* | | | | | | || |DpnI | | | | | | || BstKTI | | | | | | || BciVI | | | | | | |FatI | | | | | | CviAII | | | | | NlaIII | | | | MnlI | | | Hpy188I | | MaeII | | AclI | TaiI | SetI Hpy178III* M E S T S G E R S E N I H E D Q G I P K W K A H Q E N V P K I Y M R I K G Y Q K G K H I R R T F R K Y T * G S R D T K S ----:----|----:----|----:----|----:----|----:----|----:----| X S L V D P S R E S F I C S S * P I G F X P F C M L L V N R F Y V H P D L S V L H F A C * S F T G F I Y M L I L P Y W F AciI Cac8I | NspBII* XbaI SduI | | FauI |MaeI MaeI HgiAI* TspEI | | | MseI |Hpy178III* |SetI | Hpy178III* \ \ \ \ \ \\ \\ \ \ GTAATTCTGCCCGCTGATTTTAATAAATGCTCTAGAACTGACCTAGTGGTGCTCATATCA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CATTAAGACGGGCGACTAAAATTATTTACGAGATCTTGACTGGATCACCACGAGTATAGT / / / / / // / / / | | | | MseI |XbaI SetI | HgiAI* | | | FauI Hpy178III* | SduI | | NspBII* MaeI MaeI | | AciI | Cac8I TspEI V I L P A D F N K C S R T D L V V L I S * F C P L I L I N A L E L T * W C S Y H N S A R * F * * M L * N * P S G A H I T ----:----|----:----|----:----|----:----|----:----|----:----| T I R G A S K L L H E L V S R T T S M D L L E A R Q N * Y I S * F Q G L P A * I Y N Q G S I K I F A R S S V * H H E Y * BdaI BdaI ApoI BdaI BdaI BsaBI TspEI | TspDTI Hpy188I \ \ \ \ \ \ CGAATGTTAGTATCGCTGATAGCAATCAATGAAAATTCAGCAACAAAGAAATCTGATGAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GCTTACAATCATAGCGACTATCGTTAGTTACTTTTAAGTCGTTGTTTCTTTAGACTACTG / / / // / / | BdaI BsaBI || TspDTI Hpy188I | BdaI |BdaI Hpy178III* |BdaI TspEI ApoI R M L V S L I A I N E N S A T K K S D D E C * Y R * * Q S M K I Q Q Q R N L M T N V S I A D S N Q * K F S N K E I * * P ----:----|----:----|----:----|----:----|----:----|----:----| R I N T D S I A I L S F E A V F F D S S V F T L I A S L L * H F N L L L S I Q H S H * Y R Q Y C D I F I * C C L F R I V DdeI | TfiI MboII TspEI MseI | HinfI | MnlI TspDTI \ \ \ \ \ \ \ CAAATTACTTTAACACGATACCATTCTAAGATTCCTCCAAACATATCAATCTTCAACTAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTAATGAAATTGTGCTATGGTAAGATTCTAAGGAGGTTTGTATAGTTAGAAGTTGATA / / / / / / / TspEI MseI | HinfI | MnlI TspDTI | TfiI MboII DdeI Q I T L T R Y H S K I P P N I S I F N Y K L L * H D T I L R F L Q T Y Q S S T I N Y F N T I P F * D S S K H I N L Q L F ----:----|----:----|----:----|----:----|----:----|----:----| W I V K V R Y W E L I G G F M D I K L * G F * K L V I G N * S E E L C I L R * S L N S * C S V M R L N R W V Y * D E V I MnlI \ TTCATACGACTGACAAAGTTTTCCTCTTTAGAACATTGTGTGCTTATGACATCACTCTAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTATGCTGACTGTTTCAAAAGGAGAAATCTTGTAACACACGAATACTGTAGTGAGATA / MnlI F I R L T K F S S L E H C V L M T S L Y S Y D * Q S F P L * N I V C L * H H S I H T T D K V F L F R T L C A Y D I T L L ----:----|----:----|----:----|----:----|----:----|----:----| K M R S V F N E E K S C Q T S I V D S * N * V V S L T K R K L V N H A * S M V R E Y S Q C L K G R * F M T H K H C * E I CviRI* | Tsp4CI* TaqI | | Hpy178III* MseI HindII ClaI | | | BciVI |TspEI Hpy166II \ \ \ \ \ \\ \ TATATCGATTTATTGCAAACTGTGTATCCTGATTTTACGCTTAATTCGTTGACTGCCCAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ATATAGCTAAATAACGTTTGACACATAGGACTAAAATGCGAATTAAGCAACTGACGGGTA / / / / / / / / / ClaI | Tsp4CI* | BciVI | | Hpy166II SetI TaqI CviRI* Hpy178III* | | HindII | TspEI MseI Y I D L L Q T V Y P D F T L N S L T A H I S I Y C K L C I L I L R L I R * L P I Y R F I A N C V S * F Y A * F V D C P * ----:----|----:----|----:----|----:----|----:----|----:----| * I S K N C V T Y G S K V S L E N V A W N Y R N I A F Q T D Q N * A * N T S Q G I D I * Q L S H I R I K R K I R Q S G M Hin4I TfiI SetI MseI CviJI Tsp4CI* |CviJI HinfI MmeI \ \ \ \ \\ \ \ AGGTTTTTATTAACAGCCACCACAGTCGCAACAAAAGGCTTATGTGATTCGTTCTCAACA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TCCAAAAATAATTGTCGGTGGTGTCAGCGTTGTTTTCCGAATACACTAAGCAAGAGTTGT / / / / / / / | CviJI Tsp4CI* Hin4I CviJI HinfI MmeI MseI TfiI R F L L T A T T V A T K G L C D S F S T G F Y * Q P P Q S Q Q K A Y V I R S Q Q V F I N S H H S R N K R L M * F V L N K ----:----|----:----|----:----|----:----|----:----|----:----| L N K N V A V V T A V F P K H S E N E V Y T K I L L W W L R L L L S I H N T R L P K * * C G G C D C C F A * T I R E * C MaeIII Hin4I Tsp45I |MwoI | Hpy178III* || CviRI* Csp6I | |BseRI || | MnlI |RsaI | || TspEI BsrI \\ \ \ \\ \ \\ \ \ AACGCCCATTATGCAAAAGTTGGAGGAGTACGATGTCACGAATTGAATATACTGGAGAAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCGGGTAATACGTTTTCAACCTCCTCATGCTACAGTGCTTAACTTATATGACCTCTTG / / / / // / / / / | MwoI | MnlI |Csp6I | | TspEI BsrI Hin4I CviRI* RsaI | Hpy178III* | Tsp45I | MaeIII BseRI N A H Y A K V G G V R C H E L N I L E N T P I M Q K L E E Y D V T N * I Y W R T R P L C K S W R S T M S R I E Y T G E R ----:----|----:----|----:----|----:----|----:----|----:----| F A W * A F T P P T R H * S N F I S S F L R G N H L L Q L L V I D R I S Y V P S V G M I C F N S S Y S T V F Q I Y Q L V AciI SecI* DsaI* | AciI | FnuDII* MseI | NspBII* |AhaIII* | |SacII || GsuI | || MboI || Eco57MI | || | DpnI || | Hpy166II | || | |BstKTI || | | SfeI* | || | || BinI* || | | | TfiI | || | || | MaeII || | | | HinfI | || | || | | SetI || | | | | FauI | || | || | | TaiI \\ \ \ \ \ \ \ \\ \ \\ \ \ \ GATTTTTTAAAGAGAGTAAACTACAGAATCATTCCGCGGGATCATAACATTACGTTATGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAAAAATTTCTCTCATTTGATGTCTTAGTAAGGCGCCCTAGTATTGTAATGCAATACA // / / / / / // / // / / / / || | | | | | || | || MboI | | MaeII || | | | | | || | |DpnI | TaiI || | | | | | || | BstKTI | SetI || | | | | | || DsaI* BinI* || | | | | | || SecI* || | | | | | || AciI || | | | | | |NspBII* || | | | | | |FnuDII* || | | | | | |AciI || | | | | | SacII || | | | | FauI || | | | HinfI || | | | TfiI || | | SfeI* || | Hpy166II || Eco57MI || GsuI |MseI AhaIII* D F L K R V N Y R I I P R D H N I T L C I F * R E * T T E S F R G I I T L R Y V F F K E S K L Q N H S A G S * H Y V M * ----:----|----:----|----:----|----:----|----:----|----:----| S K K F L T F * L I M G R S * L M V N H R N K L S L L S C F * E A P D Y C * T I I K * L S Y V V S D N R P I M V N R * T Hpy178III* |TaqI |BsmAI |Eco31I \\ AGTATAGAGCAAAAACAGAAAAAGTTTGTCATAGATAAAAACGCATTAGGGTCTCTCGAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TCATATCTCGTTTTTGTCTTTTTCAAACAGTATCTATTTTTGCGTAATCCCAGAGAGCTA // / || Eco31I || BsmAI |TaqI Hpy178III* S I E Q K Q K K F V I D K N A L G S L D V * S K N R K S L S * I K T H * G L S I Y R A K T E K V C H R * K R I R V S R F ----:----|----:----|----:----|----:----|----:----|----:----| L I S C F C F F N T M S L F A N P D R S Y Y L A F V S F T Q * L Y F R M L T E R T Y L L F L F L K D Y I F V C * P R E I MaeII | MseI XbaI TfiI | SetI PflMI |MaeI HinfI | TaiI AloI BsiYI* |Hpy178III* \ \ \ \ \ \\ TTGGATTCTTATTCTTACGTTAATCGTCCAAAAAGTGGATATAATGTTCTAGATAAATAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTAAGAATAAGAATGCAATTAGCAGGTTTTTCACCTATATTACAAGATCTATTTATG / / / / / / // / HinfI | | | AloI BsiYI* || AloI TfiI | | MseI PflMI |XbaI | MaeII Hpy178III* TaiI MaeI SetI L D S Y S Y V N R P K S G Y N V L D K Y W I L I L T L I V Q K V D I M F * I N T G F L F L R * S S K K W I * C S R * I L ----:----|----:----|----:----|----:----|----:----|----:----| K S E * E * T L R G F L P Y L T R S L Y N P N K N K R * D D L F H I Y H E L Y I Q I R I R V N I T W F T S I I N * I F V MboII |AluI |CviJI |PvuII NlaIV AloI |NspBII* | HphI | TaqI || SetI | MseI SetI \ \ \\ \ \ \ \ TATCGAAGAATAGTTCAGCTGGTGGGTTCCTTTAACGCTTCACCTGATAAGAGTAGAAAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGCTTCTTATCAAGTCGACCACCCAAGGAAATTGCGAAGTGGACTATTCTCATCTTTC / / / / / / / / TaqI | NspBII* | | MseI SetI SetI | PvuII | HphI | CviJI NlaIV | AluI MboII SetI Y R R I V Q L V G S F N A S P D K S R K I E E * F S W W V P L T L H L I R V E R S K N S S A G G F L * R F T * * E * K G ----:----|----:----|----:----|----:----|----:----|----:----| * R L I T * S T P E K L A E G S L L L F S D F F L E A P P N R * R K V Q Y S Y F I S S Y N L Q H T G K V S * R I L T S L FauI CviJI SetI AciI |SspI |NlaIV \ \ \\ \\ GTTGATTATGTTCTCCCGCCAAATATTGATATAGTGAGTGAAAGTGGCTCCCAAACTACT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTAATACAAGAGGGCGGTTTATAACTATATCACTCACTTTCACCGAGGGTTTGATGA / // // AciI |FauI |NlaIV SspI CviJI V D Y V L P P N I D I V S E S G S Q T T L I M F S R Q I L I * * V K V A P K L L * L C S P A K Y * Y S E * K W L P N Y S ----:----|----:----|----:----|----:----|----:----|----:----| T S * T R G G F I S I T L S L P E W V V P Q N H E G A L Y Q Y L S H F H S G F * N I I N E R W I N I Y H T F T A G L S S TaqII | Ksp632I* | | BseMII TspEI | | |BspCNI DdeI HphI | MboII | | || MnlI |Hpy188I \ \ \ \ \ \\ \ \\ CAACTAAAGGGGTCGTCATCACCCAATTCTCACTCTTCACAAAAGCGATATTCTGAGGCA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGATTTCCCCAGCAGTAGTGGGTTAAGAGTGAGAAGTGTTTTCGCTATAAGACTCCGT / / / / // / / / HphI | TspEI TaqII || MnlI | DdeI MboII |BspCNI Hpy188I Ksp632I* BseMII Q L K G S S S P N S H S S Q K R Y S E A N * R G R H H P I L T L H K S D I L R Q T K G V V I T Q F S L F T K A I F * G K ----:----|----:----|----:----|----:----|----:----|----:----| * S F P D D D G L E * E E C F R Y E S A E V L P T T M V W N E S K V F A I N Q P L * L P R * * G I R V R * L L S I R L C MboI | DpnI | |BstKTI | || MwoI MwoI HgaI | || | CviJI MseI \ \ \ \\ \ \ \ AAGGACGCACATATCTATAACAAGCGATCAAAGCCAGATTAA 850 860 870 880 ----:----|----:----|----:----|----:----|-- TTCCTGCGTGTATAGATATTGTTCGCTAGTTTCGGTCTAATT / / // / / / MwoI HgaI || | CviJI MseI || MboI |MwoI |DpnI BstKTI K D A H I Y N K R S K P D * R T H I S I T S D Q S Q I X G R T Y L * Q A I K A R L X ----:----|----:----|----:----|----:----|-- F S A C I * L L R D F G S * L P R V Y R Y C A I L A L N L V C M D I V L S * L W I L # Enzymes that cut Frequency Isoschizomers AciI 4 BspACI,SsiI AclI 1 Psp1406I AhaIII* 1 DraI AloI 1 AluI 1 AluBI ApoI 1 AcsI,XapI BciVI 2 BfuI BdaI 2 BinI* 2 AlwI,BspPI,AclWI BsaBI 1 Bse8I,BseJI BseMII 1 BseRI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BspCNI 1 BsrI 1 BseNI,Bse1I,BsrSI BstKTI 3 Cac8I 1 BstC8I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 1 CviQI,RsaNI CviAII 1 CviJI 5 CviKI-1 CviRI* 2 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 3 MalI DsaI* 1 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco57MI 1 FatI 1 FauI 3 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII GsuI 1 BpmI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I Hin4I 1 HindII 1 HincII HinfI 4 HphI 2 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 3 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 1 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MmeI 1 MnlI 5 MseI 8 Tru1I,Tru9I MwoI 3 HpyF10VI,BstMWI NlaIII 1 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 3 MspA1I PflMI 1 BasI,AccB7I,Van91I PvuII 1 RsaI 1 AfaI SacII 1 KspI,Cfr42I,Sfr303I,SgrBI,SstII SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 8 SfeI* 1 BstSFI,SfcI,BfmI SspI 1 TaiI 3 TaqI 3 TaqII 1 TfiI 4 PfeI Tsp45I 1 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 6 TasI,Tsp509I,Sse9I XbaI 2 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AflIII AgeI AjuI AlfI AlwNI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* BccI Bce83I* BceAI BcgI BclI BetI* BfiI BglI BglII BisI BlsI BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaXI BseBI BseGI BsePI BseSI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstF5I BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsCI BtsI CauII* Cfr10I Cfr9I CfrI CspCI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco47III Eco57I EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI Fnu4HI FokI FseI FspAI GlaI GsaI HaeII HaeIII HgiCI* HgiJII* HhaI Hin4II* Hin6I HindIII HinP1I HpaI HpaII Hpy99I HspAI KasI KpnI MauBI McrI* MfeI MluI MlyI Mph1103I MroNI MslI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacI SalI SanDI SapI SauI* ScaI SchI ScrFI SexAI SfaNI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I StyI SwaI TatI TauI TseI TsoI TspGWI TspMI TspRI TstI Tth111I VspI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769