Restriction Map of ALG12/YNR030W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ALG12/YNR030W on chromosome XIV from coordinates 678799 to 680454.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.14918

Tsp4CI* Tsp4CI* | TspRI |TspDTI HphI \ \ \\ \ ATGCGTTGGTCTGTCCTTGATACAGTGCTATTGACCGTGATTTCCTTTCATCTAATCCAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGCAACCAGACAGGAACTATGTCACGATAACTGGCACTAAAGGAAAGTAGATTAGGTT / / / / | Tsp4CI* Tsp4CI* SetI TspRI TspDTI HphI M R W S V L D T V L L T V I S F H L I Q C V G L S L I Q C Y * P * F P F I * S K A L V C P * Y S A I D R D F L S S N P S ----:----|----:----|----:----|----:----|----:----|----:----| X R Q D T R S V T S N V T I E K * R I W X A N T Q G Q Y L A I S R S K R E D L G H T P R D K I C H * Q G H N G K M * D L MseI | MboII | | SspI | | |TspDTI | | || CviJI StyI | | || | FatI SecI* | | || | BspHI | OliI | | || | |CviAII AluI | MslI | | || | |Hpy178III* CviJI | |Ksp632I* | | || | || NlaIII | SetI | || SetI | | || | || | MseI SfeI* \ \ \ \\ \ \ \ \\ \ \\ \ \ \ GCTCCATTCACCAAGGTGGAAGAGAGTTTTAATATTCAAGCCATTCATGATATTTTAACC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGGTAAGTGGTTCCACCTTCTCTCAAAATTATAAGTTCGGTAAGTACTATAAAATTGG / / / / //// / / // / CviJI | | Ksp632I* |||SspI | | |BspHI MseI AluI | SecI* ||TspDTI | | |FatI SetI | StyI |MseI | | Hpy178III* MslI MboII | | CviAII OliI | NlaIII SetI CviJI A P F T K V E E S F N I Q A I H D I L T L H S P R W K R V L I F K P F M I F * P S I H Q G G R E F * Y S S H S * Y F N L ----:----|----:----|----:----|----:----|----:----|----:----| A G N V L T S S L K L I * A M * S I K V L E M * W P P L S N * Y E L W E H Y K L S W E G L H F L T K I N L G N M I N * G ApoI BslFI TspEI | PfoI | BssKI | EcoRII | | ScrFI SetI EcoRV | | BseBI MaeI \ \ \ \ \ \ TACAGCGTATTTGATATCTCCCAATATGACCACTTGAAATTTCCTGGAGTAGTCCCTAGA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTCGCATAAACTATAGAGGGTTATACTGGTGAACTTTAAAGGACCTCATCAGGGATCT / / / / / / SfeI* EcoRV | | EcoRII MaeI | | BssKI | | PfoI | BseBI | ScrFI TspEI BslFI ApoI Y S V F D I S Q Y D H L K F P G V V P R T A Y L I S P N M T T * N F L E * S L E Q R I * Y L P I * P L E I S W S S P * N ----:----|----:----|----:----|----:----|----:----|----:----| * L T N S I E W Y S W K F N G P T T G L R C R I Q Y R G I H G S S I E Q L L G * V A Y K I D G L I V V Q F K R S Y D R S CviRI* | Hin4I | | BsmAI | | Eco31I | | | BsrDI | | | | TaqI GsuI | | | | |Hpy178III* BcgI BinI* Eco57MI BcgI | | | | || SetI | SmlI | Hin4I \ \ \ \ \ \ \\ \ \ \ \ \ ACATTCGTTGGTGCTGTGATTATTGCAATGCTTTCGAGACCTTATCTTTACTTGAGTTCT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAAGCAACCACGACACTAATAACGTTACGAAAGCTCTGGAATAGAAATGAACTCAAGA / / / / / / /// / // / Eco57MI BcgI | | | | ||SetI BcgI || BinI* GsuI | | | | |Hpy178III* |SmlI | | | | TaqI Hin4I | | | Eco31I | | | BsmAI | | BsrDI | CviRI* Hin4I T F V G A V I I A M L S R P Y L Y L S S H S L V L * L L Q C F R D L I F T * V L I R W C C D Y C N A F E T L S L L E F F ----:----|----:----|----:----|----:----|----:----|----:----| V N T P A T I I A I S E L G * R * K L E F M R Q H Q S * Q L A K S V K D K S S N C E N T S H N N C H K R S R I K V Q T R Bce83I* |BssKI |EcoRII || ScrFI || BseBI || | StuI || | CviJI || | HaeIII || | | MaeII MboI || | | | SetI | DpnI || | | | TaiI MfeI | |BstKTI || | | | |SfeI* TspEI HphI \ \\ \\ \ \ \ \\ \ \ TTGATCCAAACTTCCAGGCCTACGTCTATAGATGTTCAATTGGTCGTTAGGGGGATTGTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAGGTTTGAAGGTCCGGATGCAGATATCTACAAGTTAACCAGCAATCCCCCTAACAA // / / / / / / / / / || | | | | | MaeII SfeI* TspEI HphI || | | | | TaiI MfeI || | | | | SetI || | | | EcoRII || | | | HaeIII || | | | BssKI || | | | CviJI || | | | StuI || | | BseBI || | | ScrFI || | Bce83I* || MboI |DpnI BstKTI L I Q T S R P T S I D V Q L V V R G I V * S K L P G L R L * M F N W S L G G L L D P N F Q A Y V Y R C S I G R * G D C W ----:----|----:----|----:----|----:----|----:----|----:----| K I W V E L G V D I S T * N T T L P I T K S G F K W A * T * L H E I P R * P S Q Q D L S G P R R R Y I N L Q D N P P N N MseI CviJI MnlI |AhaIII* HaeIII | CviJI || TspEI CviRI* \ \ \ \\ \ \ GGCCTCACCAATGGGCTTTCTTTTATCTATTTAAAGAATTGTTTGCAAGATATGTTTGAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CCGGAGTGGTTACCCGAAAGAAAATAGATAAATTTCTTAACAAACGTTCTATACAAACTA / / / // / / HaeIII | CviJI |MseI | CviRI* CviJI MnlI AhaIII* TspEI G L T N G L S F I Y L K N C L Q D M F D A S P M G F L L S I * R I V C K I C L M P H Q W A F F Y L F K E L F A R Y V * * ----:----|----:----|----:----|----:----|----:----|----:----| P R V L P S E K I * K F F Q K C S I N S Q G * W H A K K * R N L S N N A L Y T Q A E G I P K R K D I * L I T Q L I H K I MboII | BbvII* Hin6I TspRI | | MboII |GlaI | TspDTI | | |TspDTI |Eco47III \ \ \ \ \\ \\ GAAATCACTGAAAAGAAAAAGGAAGAAAATGAAGACAAGGATATATACATTTACGATAGC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAGTGACTTTTCTTTTTCCTTCTTTTACTTCTGTTCCTATATATGTAAATGCTATCG / / / / /// TspRI TspDTI MboII TspDTI ||Eco47III BbvII* ||GlaI MboII |HhaI HaeII E I T E K K K E E N E D K D I Y I Y D S K S L K R K R K K M K T R I Y T F T I A N H * K E K G R K * R Q G Y I H L R * R ----:----|----:----|----:----|----:----|----:----|----:----| S I V S F F F S S F S S L S I Y M * S L H F * Q F S F P L F H L C P Y I C K R Y F D S F L F L F F I F V L I Y V N V I A HhaI |HaeII FatI || Csp6I SetI || |RsaI |CviAII || ||FatI || NlaIII MlyI || |||CviAII MseI || | SfeI* PleI || |||| NlaIII |TspEI || | |MnlI | MaeI \\ \\\\ \ \\ \\ \ \\ \ \ GCTGGTACATGGTTTCTTTTATTTTTAATTGGCAGTTTCCACCTCATGTTCTACAGCACT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CGACCATGTACCAAAGAAAATAAAAATTAACCGTCAAAGGTGGAGTACAAGATGTCGTGA / // // / / / / // / / // | || |FatI | TspEI | | || | | |PleI | || CviAII MseI | | || | | MlyI | |NlaIII | | || | SfeI* | |Csp6I | | || MnlI | RsaI | | |FatI Hin6I | | CviAII | NlaIII SetI A G T W F L L F L I G S F H L M F Y S T L V H G F F Y F * L A V S T S C S T A L W Y M V S F I F N W Q F P P H V L Q H * ----:----|----:----|----:----|----:----|----:----|----:----| A P V H N R K N K I P L K W R M N * L V R Q Y M T E K I K L Q C N G G * T R C C S T C P K K * K * N A T E V E H E V A S TspEI | Hin4I MnlI | | MlyI MaeII | | PleI | SetI | | | FatI | TaiI | | | BspHI | |XcmI | | | |CviAII | ||Hpy99I | | | |Hpy178III* | |||Hin4I | | | || HinfI | |||| MslI HinfI | | | || NlaIII | |||| TsoI \ \ \ \ \\ \ \ \\\\ \ AGGACTCTGCCTAATTTTGTCATGACTCTGCCTCTAACCAACGTCGCATTGGGGTGGGTT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTGAGACGGATTAAAACAGTACTGAGACGGAGATTGGTTGCAGCGTAACCCCACCCAA / / / / /// // / ///// / / MaeI | Hin4I | ||| || HinfI ||||XcmI | MslI HinfI | ||| |BspHI |||MaeII TsoI | ||| |FatI ||Hin4I | ||| Hpy178III* |Hpy99I | ||| CviAII MnlI | ||NlaIII TaiI | |PleI SetI | MlyI TspEI R T L P N F V M T L P L T N V A L G W V G L C L I L S * L C L * P T S H W G G F D S A * F C H D S A S N Q R R I G V G F ----:----|----:----|----:----|----:----|----:----|----:----| L V R G L K T M V R G R V L T A N P H T * S E A * N Q * S E A E L W R R M P T P P S Q R I K D H S Q R * G V D C Q P P N TseI Hin6I CviRI* |GlaI |BisI ||HhaI ||BlsI |||BsiI* |||AluI |||| MwoI |||CviJI |||| | MfeI PsiI |||| SetI BbvI |||| | TspEI \ \\\\ \ \ \\\\ \ \ TTATTGGGTCGTTATAATGCAGCTATATTCCTATCTGCGCTCGTGGCAATTGTATTTAGA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AATAACCCAGCAATATTACGTCGATATAAGGATAGACGCGAGCACCGTTAACATAAATCT / //// / //// / / PsiI |||CviJI | |||| BsiI* TspEI |||TseI | |||MwoI MfeI |||AluI | ||Hin6I ||BisI | |GlaI |BlsI | HhaI |SetI BbvI CviRI* L L G R Y N A A I F L S A L V A I V F R Y W V V I M Q L Y S Y L R S W Q L Y L D I G S L * C S Y I P I C A R G N C I * T ----:----|----:----|----:----|----:----|----:----|----:----| K N P R * L A A I N R D A S T A I T N L K I P D N Y H L * I G I Q A R P L Q I * * Q T T I I C S Y E * R R E H C N Y K S AluI TspRI CviJI | MwoI | SetI | |BspCNI | |DdeI | ||HgaI Hpy178III* BsrI | || MwoI | ||BseMII MboII | SfaNI \ \ \\ \ \ \\\ \ \ \ CTGGAAGTGTCAGCTCTCAGTGCTGGTATTGCTCTATTTAGCGTCATCTTCAAGAAGATT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GACCTTCACAGTCGAGAGTCACGACCATAACGAGATAAATCGCAGTAGAAGTTCTTCTAA / / / // / / // / / / BsrI | | || DdeI | |BseMII | MboII Hpy178III* | | |MwoI | BspCNI HgaI | | TspRI MwoI | CviJI | AluI SetI L E V S A L S A G I A L F S V I F K K I W K C Q L S V L V L L Y L A S S S R R F G S V S S Q C W Y C S I * R H L Q E D F ----:----|----:----|----:----|----:----|----:----|----:----| S S T D A R L A P I A R N L T M K L F I V P L T L E * H Q Y Q E I * R * R * S S Q F H * S E T S T N S * K A D D E L L N NlaIV | AciI MboII ApoI CviJI | | BslFI | TaqI TspEI | EciI | | |HphI \ \ \ \ \ \ \ \\ TCTTTATTCGATGCTATCAAATTCGGTATCTTTGGCTTGGGACTTGGTTCCGCCATCAGT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAATAAGCTACGATAGTTTAAGCCATAGAAACCGAACCCTGAACCAAGGCGGTAGTCA // / / / / / // / / || TaqI TspEI | EciI | || | TspDTI |MboII ApoI CviJI | || BslFI SfaNI | |HphI | AciI NlaIV S L F D A I K F G I F G L G L G S A I S L Y S M L S N S V S L A W D L V P P S V F I R C Y Q I R Y L W L G T W F R H Q Y ----:----|----:----|----:----|----:----|----:----|----:----| E K N S A I L N P I K P K P S P E A M L K K I R H * * I R Y R Q S P V Q N R W * R * E I S D F E T D K A Q S K T G G D T BseMII |BspCNI || MnlI || AccI || |Hpy166II BccI || || DdeI |TspDTI || || SauI* || Tsp4CI* || || |SetI || | TfiI || || ||BccI || | HinfI || || ||| SetI \\ \ \ \\ \\ \\\ \ ATCACCGTTGATTCATATTTCTGGCAAGAATGGTGTCTACCTGAGGTAGATGGTTTCTTG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTGGCAACTAAGTATAAAGACCGTTCTTACCACAGATGGACTCCATCTACCAAAGAAC / / / // / // // | Tsp4CI* HinfI || | |AccI |SauI* BccI TfiI || | |SetI |DdeI || | | |BccI || | | SetI || | Hpy166II || MnlI |BspCNI BseMII I T V D S Y F W Q E W C L P E V D G F L S P L I H I S G K N G V Y L R * M V S C H R * F I F L A R M V S T * G R W F L V ----:----|----:----|----:----|----:----|----:----|----:----| I V T S E Y K Q C S H H R G S T S P K K Y * R Q N M N R A L I T D V Q P L H N R D G N I * I E P L F P T * R L Y I T E Q NlaIV MaeII |CviJI |FauI AciI ||BsrI || SetI | MaeIII ||| MaeIII || TaiI | | MwoI XcmI ||| | AlwNI \\ \ \ \ \ \ \\\ \ \ TTCAACGTGGTTGCGGGTTACGCTTCCAAGTGGGGTGTGGAGCCAGTTACTGCTTATTTC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTGCACCAACGCCCAATGCGAAGGTTCACCCCACACCTCGGTCAATGACGAATAAAG / // // / / // / / | |FauI |MwoI MaeIII XcmI || | MaeIII | MaeII AciI || AlwNI TaiI |CviJI SetI NlaIV BsrI F N V V A G Y A S K W G V E P V T A Y F S T W L R V T L P S G V W S Q L L L I S Q R G C G L R F Q V G C G A S Y C L F H ----:----|----:----|----:----|----:----|----:----|----:----| N L T T A P * A E L H P T S G T V A * K T * R P Q P N R K W T P H P A L * Q K N E V H N R T V S G L P T H L W N S S I E Bce83I* TspEI SmlI | Tsp4CI* | XmnI CviJI \ \ \ \ \ \ ACGCATTACTTGAGAATGATGTTTATGCCACCAACTGTTTTACTATTGAATTACTTCGGC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TGCGTAATGAACTCTTACTACAAATACGGTGGTTGACAAAATGATAACTTAATGAAGCCG / / / / / SmlI | Tsp4CI* TspEI CviJI Bce83I* XmnI T H Y L R M M F M P P T V L L L N Y F G R I T * E * C L C H Q L F Y Y * I T S A A L L E N D V Y A T N C F T I E L L R L ----:----|----:----|----:----|----:----|----:----|----:----| V C * K L I I N I G G V T K S N F * K P * A N S S F S T * A V L Q K V I S N S R R M V Q S H H K H W W S N * * Q I V E A SetI |CviRI* || TspEI || | AarI || | BspMI || | |MseI BsmAI TspEI || | || TspEI |MaeI SfaNI \ \\ \ \\ \ \\ \ TATAAATTAGCACCTGCAAAATTAAAAATTGTCTCACTAGCATCTCTTTTCCACATTATC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTTAATCGTGGACGTTTTAATTTTTAACAGAGTGATCGTAGAGAAAAGGTGTAATAG / / / /// / // / | SetI CviRI* ||| TspEI |BsmAI SfaNI TspEI ||BspMI MaeI ||AarI |MseI TspEI Y K L A P A K L K I V S L A S L F H I I I N * H L Q N * K L S H * H L F S T L S * I S T C K I K N C L T S I S F P H Y R ----:----|----:----|----:----|----:----|----:----|----:----| * L N A G A F N F I T E S A D R K W M I S Y I L V Q L I L F Q R V L M E K G C * I F * C R C F * F N D * * C R K E V N D Hin4I Hin4I Hin4I Hin4I | FatI |TspDTI TfiI | |BccI SetI || MnlI HinfI | |CviAII \ \\ \ \ \ \\ GTCTTATCCTTTCAACCTCACAAAGAATGGAGATTCATCATCTACGCTGTTCCATCTATC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAATAGGAAAGTTGGAGTGTTTCTTACCTCTAAGTAGTAGATGCGACAAGGTAGATAG / / / / / / / | | | MnlI HinfI Hin4I NlaIII | | TspDTI TfiI Hin4I | Hin4I | Hin4I SetI V L S F Q P H K E W R F I I Y A V P S I S Y P F N L T K N G D S S S T L F H L S L I L S T S Q R M E I H H L R C S I Y H ----:----|----:----|----:----|----:----|----:----|----:----| T K D K * G * L S H L N M M * A T G D I R R I R E V E C L I S I * * R R Q E M * D * G K L R V F F P S E D D V S N W R D NlaIII | MaeI MwoI | | HgiCI* | TseI | | | SetI | |BisI MslI | | | NlaIV | ||BlsI | BbvI TspDTI \ \ \ \ \ \\\ \ \ \ ATGTTGCTAGGTGCCACAGGAGCAGCACATCTATGGGAGAATATGAAAGTAAAAAAGATT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TACAACGATCCACGGTGTCCTCGTCGTGTAGATACCCTCTTATACTTTCATTTTTTCTAA /// // / / / /// / / / ||FatI || | | MwoI ||TseI MslI BbvI TspDTI || || | HgiCI* |BisI || || NlaIV BlsI || |MaeI || SetI |CviAII BccI M L L G A T G A A H L W E N M K V K K I C C * V P Q E Q H I Y G R I * K * K R L V A R C H R S S T S M G E Y E S K K D Y ----:----|----:----|----:----|----:----|----:----|----:----| M N S P A V P A A C R H S F I F T F F I * T A L H W L L L V D I P S Y S L L F S H Q * T G C S C C M * P L I H F Y F L N TspDTI MnlI TsoI CviJI | SetI | MslI \ \ \ \ \ \ ACCAATGTTTTATGTTTGGCTATATTGCCCTTATCTATAATGACCTCCTTTTTCATTTCA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTACAAAATACAAACCGATATAACGGGAATAGATATTACTGGAGGAAAAAGTAAAGT / / / / / / TsoI CviJI | SetI MnlI MslI TspDTI T N V L C L A I L P L S I M T S F F I S P M F Y V W L Y C P Y L * * P P F S F Q Q C F M F G Y I A L I Y N D L L F H F N ----:----|----:----|----:----|----:----|----:----|----:----| V L T K H K A I N G K D I I V E K K M E * W H K I N P * I A R I * L S R R K * K G I N * T Q S Y Q G * R Y H G G K E N * BssKI EcoRII | ScrFI | BseBI | |MnlI | || AciI | || |BisI | || ||BlsI | || ||TspDTI Hpy178III* | || ||| CviJI | TspEI | || |||TauI | MseI MseI \ \ \ \\ \\\\ \ \ \ ATGGCGTTCTTGTATATATCAAGAATGAATTATCCAGGCGGCGAGGCTTTAACTTCTTTT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGCAAGAACATATATAGTTCTTACTTAATAGGTCCGCCGCTCCGAAATTGAAGAAAA / / // /// / / | | || ||BisI | MseI | | || ||AciI CviJI | | || |BlsI | | || TspDTI | | || EcoRII | | || BssKI | | || TauI | | |BseBI | | |ScrFI | | MnlI | TspEI Hpy178III* M A F L Y I S R M N Y P G G E A L T S F W R S C I Y Q E * I I Q A A R L * L L L G V L V Y I K N E L S R R R G F N F F * ----:----|----:----|----:----|----:----|----:----|----:----| I A N K Y I D L I F * G P P S A K V E K L P T R T Y I L F S N D L R R P K L K K H R E Q I Y * S H I I W A A L S * S R K FatI |CviAII TspDTI BdaI || NlaIII | SfeI* BdaI || |MslI SspI | | Tsp4CI* | SetI \\ \\ \ \ \ \ \ \ AATGACATGATTGTGGAAAAAAATATTACAAACGCTACAGTTCATATCAGCATACCTCCT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTGTACTAACACCTTTTTTTATAATGTTTGCGATGTCAAGTATAGTCGTATGGAGGA / / /// / / // // | | ||MslI SspI TspDTI |SfeI* |SetI | | |FatI Tsp4CI* BdaI | | CviAII BdaI | NlaIII MseI N D M I V E K N I T N A T V H I S I P P M T * L W K K I L Q T L Q F I S A Y L L * H D C G K K Y Y K R Y S S Y Q H T S L ----:----|----:----|----:----|----:----|----:----|----:----| L S M I T S F F I V F A V T * I L M G G * H C S Q P F F Y * L R * L E Y * C V E I V H N H F F I N C V S C N M D A Y R R FatI CviRI* |CviAII || MnlI || |NlaIII HphI || || PshAI | Tsp4CI* || || | SetI BdaI | | Csp6I || || | MaeIII BdaI | | Hpy166II TspEI || || | Tsp45I TspEI | | |RsaI | SfaNI \\ \\ \ \ \ \ \ \\ \ \ TGCATGACAGGTGTCACTTTATTTGGTGAATTGAACTACGGTGTGTACGGCATCAATTAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| ACGTACTGTCCACAGTGAAATAAACCACTTAACTTGATGCCACACATGCCGTAGTTAATG / /// / / / / / / / /// / | ||| | PshAI Tsp45I BdaI | | | ||Csp6I TspEI | ||| SetI MaeIII BdaI | | | |RsaI | ||FatI | | | Hpy166II | |CviAII | | Tsp4CI* | MnlI | HphI CviRI* TspEI NlaIII C M T G V T L F G E L N Y G V Y G I N Y A * Q V S L Y L V N * T T V C T A S I T H D R C H F I W * I E L R C V R H Q L R ----:----|----:----|----:----|----:----|----:----|----:----| Q M V P T V K N P S N F * P T Y P M L * K C S L H * K I Q H I S S R H T R C * N A H C T D S * K T F Q V V T H V A D I V HphI MnlI AsuI* | Hpy178III* |CviJI | | MboI SfeI* |HaeIII | | BclI BceAI | CviRI* |BmgT120I | | | DpnI | BcgI | | PstI ||BcgI | | | |BstKTI \ \ \ \ \ \\\ \ \ \ \\ GATAAGACTGAAAATACGACTTTACTGCAGGAAATGTGGCCCTCCTTTGATTTCTTGATC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTCTGACTTTTATGCTGAAATGACGTCCTTTACACCGGGAGGAAACTAAAGAACTAG /// / / / //// / /// / ||BceAI | | SfeI* |||AsuI* MnlI ||| BclI |BcgI | CviRI* ||BmgT120I HphI ||| MboI SfaNI PstI |HaeIII ||DpnI |CviJI |BstKTI BcgI Hpy178III* D K T E N T T L L Q E M W P S F D F L I I R L K I R L Y C R K C G P P L I S * S * D * K Y D F T A G N V A L L * F L D H ----:----|----:----|----:----|----:----|----:----|----:----| S L V S F V V K S C S I H G E K S K K I R Y S Q F Y S K V A P F T A R R Q N R S I L S F I R S * Q L F H P G G K I E Q D BsiI* | CviJI MfeI | | AciI TspEI TaqI PflMI AluI | | | TaqII | MnlI |Hpy178III* BsiYI* CviJI \ \ \ \ \ \ \\ \ \ ACCCACGAGCCAACCGCCTCTCAATTGCCATTCGAGAATAAGACTACCAACCATTGGGAG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TGGGTGCTCGGTTGGCGGAGAGTTAACGGTAAGCTCTTATTCTGATGGTTGGTAACCCTC // / / / // / / / || | AciI TspEI |Hpy178III* BsiYI* | CviJI || TaqII MnlI TaqI PflMI | AluI |CviJI MfeI SetI BsiI* T H E P T A S Q L P F E N K T T N H W E P T S Q P P L N C H S R I R L P T I G S P R A N R L S I A I R E * D Y Q P L G A ----:----|----:----|----:----|----:----|----:----|----:----| V W S G V A E * N G N S F L V V L W Q S * G R A L R R E I A M R S Y S * W G N P G V L W G G R L Q W E L I L S G V M P L MaeI |SetI || MseI || |HpaI || |HindII Hpy166II SetI || |Hpy166II | BsrI | MseI \\ \\ \ \ \ \ CTAGTTAACACAACAAAGATGTTTACTGGATTTGACCCAACCTACATTAAGAACTTTGTT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GATCAATTGTGTTGTTTCTACAAATGACCTAAACTGGGTTGGATGTAATTCTTGAAACAA / // / / / / | |MseI | BsrI SetI MseI | Hpy166II Hpy166II | HindII | HpaI MaeI L V N T T K M F T G F D P T Y I K N F V * L T Q Q R C L L D L T Q P T L R T L F S * H N K D V Y W I * P N L H * E L C F ----:----|----:----|----:----|----:----|----:----|----:----| S T L V V F I N V P N S G V * M L F K T A L * C L L S T * Q I Q G L R C * S S Q * N V C C L H K S S K V W G V N L V K N MboI | DpnI | |BstKTI BsmAI | || TaqI \ \ \\ \ TTCCAAGAGAGAGTGAATGTTTTGTCTCTACTCAAACAGATCATTTTCGACAAGACCCCT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTTCTCTCTCACTTACAAAACAGAGATGAGTTTGTCTAGTAAAAGCTGTTCTGGGGA / // / / BsmAI || MboI TaqI |DpnI BstKTI F Q E R V N V L S L L K Q I I F D K T P S K R E * M F C L Y S N R S F S T R P L P R E S E C F V S T Q T D H F R Q D P Y ----:----|----:----|----:----|----:----|----:----|----:----| K W S L T F T K D R S L C I M K S L V G K G L S L S H K T E V * V S * K R C S G E L L S H I N Q R * E F L D N E V L G R MseI CfrI BceAI | CviJI | MboII | HaeIII | BbvII* | | TspEI | | MboII Tsp4CI* TspEI | | | TaqI | | | HphI BtgZI \ \ \ \ \ \ \ \ \ \ \ ACCGTTTTTTTGAAAGAATTGACGGCCAATTCGATTGTTAAAAGCGATGTCTTCTTCACC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCAAAAAAACTTTCTTAACTGCCGGTTAAGCTAACAATTTTCGCTACAGAAGAAGTGG / / / / / / // / // / Tsp4CI* | | | | TaqI || | |HphI SetI | | | TspEI || | BbvII* | | CfrI || MboII | HaeIII |MboII | CviJI BceAI TspEI MseI T V F L K E L T A N S I V K S D V F F T P F F * K N * R P I R L L K A M S S S P R F F E R I D G Q F D C * K R C L L H L ----:----|----:----|----:----|----:----|----:----|----:----| V T K K F S N V A L E I T L L S T K K V * R K K S L I S P W N S Q * F R H R R * G N K Q F F Q R G I R N N F A I D E E G TfiI SetI HinfI TspDTI \ \ \ TATAAGAGAATCAAACAAGATGAAAAAACTGATTGA 1630 1640 1650 ----:----|----:----|----:----|----:- ATATTCTCTTAGTTTGTTCTACTTTTTTGACTAACT / / / BtgZI HinfI TspDTI TfiI Y K R I K Q D E K T D * I R E S N K M K K L I X * E N Q T R * K N * L X ----:----|----:----|----:----|----:- * L L I L C S S F V S Q R Y S F * V L H F F Q N I L S D F L I F F S I S # Enzymes that cut Frequency Isoschizomers AarI 1 AccI 1 FblI,XmiI AciI 4 BspACI,SsiI AhaIII* 1 DraI AluI 4 AluBI AlwNI 1 CaiI ApoI 2 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 2 BpuEI BceAI 2 BcgI 2 BclI 1 FbaI,Ksp22I BdaI 2 BinI* 1 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 1 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseMII 2 BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BspCNI 2 BspHI 2 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstKTI 3 BtgZI 1 CfrI 1 AcoI,EaeI Csp6I 2 CviQI,RsaNI CviAII 7 CviJI 16 CviKI-1 CviRI* 6 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 3 MalI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57MI 1 EcoRII 3 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FatI 7 FauI 1 SmuI GlaI 2 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 4 Hin6I 2 HinP1I,HspAI HindII 1 HincII HinfI 5 HpaI 1 KspAI HphI 6 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 7 Hpy188III Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 3 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 MfeI 3 MunI MlyI 2 SchI MnlI 10 MseI 10 Tru1I,Tru9I MslI 5 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PfoI 1 PleI 2 PpsI PshAI 1 BstPAI,BoxI PsiI 1 AanI PstI 1 RsaI 2 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 3 BmrFI,MspR9I,Bme1390I SecI* 1 BseDI,BssECI,BsaJI SetI 21 SfaNI 3 LweI SfeI* 5 BstSFI,SfcI,BfmI SmlI 2 SmoI SspI 2 StuI 1 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 5 TaqII 1 TauI 1 TfiI 3 PfeI TseI 2 ApeKI TsoI 2 Tsp45I 1 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 11 TspEI 17 TasI,Tsp509I,Sse9I TspRI 3 TscAI XcmI 2 XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AclI AcyI AflII AflIII AgeI AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BciVI BetI* BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseGI BsePI BseRI BseSI BseYI BsgI BsmI Bsp120I Bsp1407I BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstF5I BstXI BstZ17I BtrI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I Ecl136II Eco57I EcoICRI EcoNI EcoP15I EcoRI EcoT22I EgeI EheI Esp3I EspI* FalI FnuDII* FokI FseI FspAI GsaI HgiAI* HgiJII* Hin4II* HindIII HpaII Hpy188I KasI KpnI MauBI McrI* MluI MmeI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI PacI PasI PmaCI PmeI PpiI PpuMI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SapI ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TatI TspGWI TspMI TstI Tth111I VspI XbaI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769