Restriction Map of YNL339W-B



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YNL339W-B on chromosome XIV from coordinates 734 to 1216.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.31851

SfeI* | TseI | CviRI* | |BisI | ||BlsI | ||PstI | |||AluI | |||CviJI | |||| SetI | |||| | MaeII | |||| | | Csp6I | |||| | | |RsaI | |||| | | |SetI | |||| | | |TaiI | |||| | | ||BbvI | |||| | | ||| AciI | |||| | | ||| | AsuI* | |||| | | ||| | AvaII | |||| | | ||| | |BmgT120I Hin6I | |||| | | ||| | ||NlaIV |GlaI | |||| | | ||| | ||| MwoI |Eco47III | |||| | | ||| | ||| |SfeI* ||HhaI | |||| | | ||| | ||| || DrdI |||HaeII | |||| | | ||| | ||| || CviRI* |||| FatI Cac8I | |||| | | ||| | ||| || | PstI |||| |CviAII \ \ \\\\ \ \ \\\ \ \\\ \\ \ \ \\\\ \\ ATGATGCCTGCTAAACTGCAGCTTGACGTACTGCGGACCCTGCAGTCCAGCGCTCGTCAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTACGGACGATTTGACGTCGAACTGCATGACGCCTGGGACGTCAGGTCGCGAGCAGTA / / //// / /// ///// / / / //// / / Cac8I | |||| | ||| ||||| | | | |||| | CviAII | |||| | ||| ||||| | | | |||| NlaIII | |||| | ||| ||||| | | | |||Hin6I | |||| | ||| ||||| | | | ||Eco47III | |||| | ||| ||||| | | | ||GlaI | |||| | ||| ||||| | | | |HhaI | |||| | ||| ||||| | | | HaeII | |||| | ||| ||||| | | SfeI* | |||| | ||| ||||| | CviRI* | |||| | ||| ||||| DrdI | |||| | ||| ||||| PstI | |||| | ||| ||||AvaII | |||| | ||| ||||AsuI* | |||| | ||| |||BmgT120I | |||| | ||| |||NlaIV | |||| | ||| ||MwoI | |||| | ||| |AciI | |||| | ||| BbvI | |||| | ||Csp6I | |||| | |RsaI | |||| | MaeII | |||| TaiI | |||| SetI | |||CviJI | |||TseI | |||AluI | ||SfeI* | ||BisI | |BlsI | |SetI | CviRI* PstI M M P A K L Q L D V L R T L Q S S A R H * C L L N C S L T Y C G P C S P A L V M D A C * T A A * R T A D P A V Q R S S W ----:----|----:----|----:----|----:----|----:----|----:----| X I G A L S C S S T S R V R C D L A R * X S A Q * V A A Q R V A S G A T W R E D H H R S F Q L K V Y Q P G Q L G A S T M AvaI XhoI SmlI Hpy178III* |TaqI |BmeT110I || Hin6I || |GlaI || |Eco47III || ||HhaI Tsp4CI* NlaIII || |||HaeII MmeI | DrdI \ \\ \\\\ \ \ \ GGAACGCAAACGCTGAAAAACTCCAACTTTCTCGAGCGCTTCCACAAAGACCGTATCGTC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTGCGTTTGCGACTTTTTGAGGTTGAAAGAGCTCGCGAAGGTGTTTCTGGCATAGCAG / ////// / / / FatI |||||Hin6I MmeI | DrdI ||||Eco47III Tsp4CI* ||||GlaI |||HhaI ||HaeII ||SmlI ||XhoI ||AvaI |BmeT110I |TaqI Hpy178III* G T Q T L K N S N F L E R F H K D R I V E R K R * K T P T F S S A S T K T V S S N A N A E K L Q L S R A L P Q R P Y R L ----:----|----:----|----:----|----:----|----:----|----:----| P V C V S F F E L K R S R K W L S R I T H F A F A S F S W S E R A S G C L G Y R S R L R Q F V G V K E L A E V F V T D D TatI |Csp6I ||RsaI ||ScaI ||| SfeI* ||| | TseI MnlI ||| | CviRI* |BssKI ||| | |BisI || BslFI ||| | ||BlsI || HpaII ||| | ||PstI || ScrFI ||| | ||| MboII MboII || CauII* BfiI BsrI ||| | ||| BbvII* \ \\ \ \ \ \\\ \ \\\ \ TTTTGCCTCCCATTCTTCCCGGCACTTTTTTTCGTCCCAGTTCAAAAAGTACTGCAGCAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AAAACGGAGGGTAAGAAGGGCCGTGAAAAAAAGCAGGGTCAAGTTTTTCATGACGTCGTG / / //// / / /// ///// MboII MnlI |||BslFI BfiI BsrI ||| ||||SetI ||BssKI ||| |||MboII |HpaII ||| |||TseI CauII* ||| ||SfeI* ScrFI ||| ||BisI ||| |BlsI ||| CviRI* ||TatI ||PstI |Csp6I ScaI RsaI F C L P F F P A L F F V P V Q K V L Q H F A S H S S R H F F S S Q F K K Y C S T L P P I L P G T F F R P S S K S T A A P ----:----|----:----|----:----|----:----|----:----|----:----| K Q R G N K G A S K K T G T * F T S C C R K G G M R G P V K K R G L E F L V A A K A E W E E R C K K E D W N L F Y Q L V SetI | BbvI | | TaqI | | |MnlI MboI | | ||TfiI | DpnI | | ||HinfI PsiI | |BstKTI \ \ \\\ \ \ \\ CTCTGTCTTCGATTCACGCAAGTTGCTCCATACTTTATAATACAACTCTTTGATCTGCCT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GAGACAGAAGCTAAGTGCGTTCAACGAGGTATGAAATATTATGTTGAGAAACTAGACGGA / /// / / // / BbvII* ||| HinfI PsiI || MboI ||| TfiI |DpnI ||TaqI BstKTI |BbvI MnlI L C L R F T Q V A P Y F I I Q L F D L P S V F D S R K L L H T L * Y N S L I C L L S S I H A S C S I L Y N T T L * S A F ----:----|----:----|----:----|----:----|----:----|----:----| R Q R R N V C T A G Y K I I C S K S R G G R D E I * A L Q E M S * L V V R Q D A E T K S E R L N S W V K Y Y L E K I Q R Hpy178III* | FatI | |CviAII | ||Hin4II* TaqI | ||| AciI | TfiI | ||| NspI CviJI | HinfI TspEI | ||| NlaIII |NlaIV Cac8I | |MnlI | MboII \ \\\ \ \\ \ \ \\ \ \ TCCAGACATGCGGAAAACTTGGCTCCCTTGCTTGCCTCTTGTCGAATCCAATACACTAAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTCTGTACGCCTTTTGAACCGAGGGAACGAACGGAGAACAGCTTAGGTTATGTGATTA / // // / // / / / / | || || AciI |NlaIV Cac8I | HinfI MboII | || |FatI CviJI | TfiI | || CviAII MnlI | |Hin4II* TaqI | NlaIII | NspI Hpy178III* S R H A E N L A P L L A S C R I Q Y T N P D M R K T W L P C L P L V E S N T L I Q T C G K L G S L A C L L S N P I H * L ----:----|----:----|----:----|----:----|----:----|----:----| E L C A S F K A G K S A E Q R I W Y V L K W V H P F S P E R A Q R K D F G I C * G S M R F V Q S G Q K G R T S D L V S I CfrI | BalI | BssKI | CviJI | EcoRII | HaeIII | |AjuI | ||ScrFI | ||BseBI | ||| Acc65I | ||| HgiCI* TspEI DdeI | ||| |Csp6I | BseMII |Hpy188I | ||| ||RsaI | |BspCNI || AjuI | ||| ||SetI | ||Hin4I || | MboI Ksp632I* | ||| ||NlaIV | ||| BplI || | BglII MboII | MaeI | ||| ||| KpnI | ||| BplI || | XhoII \ \ \ \ \\\ \\\ \ \ \\\ \ \\ \ \ TGTTTCTCTTCTTCTAGTAATGGCCAGGTACCAAGCATAATTTCTCTGTATCTGAGAGTA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ACAAAGAGAAGAAGATCATTACCGGTCCATGGTTCGTATTAAAGAGACATAGACTCTCAT / // / / /////// /// // / TspEI || | | ||||||HgiCI* ||BspCNI || DdeI MboII || | | ||||||Acc65I ||TspEI |Hpy188I || | | |||||Csp6I ||BplI AjuI || | | ||||NlaIV ||BplI || | | ||||RsaI |BseMII || | | |||EcoRII Hin4I || | | |||BssKI || | | ||KpnI || | | |BseBI || | | |ScrFI || | | CfrI || | | SetI || | HaeIII || | CviJI || | BalI || AjuI |MaeI Ksp632I* C F S S S S N G Q V P S I I S L Y L R V V S L L L V M A R Y Q A * F L C I * E * F L F F * * W P G T K H N F S V S E S R ----:----|----:----|----:----|----:----|----:----|----:----| Q K E E E L L P W T G L M I E R Y R L T N N R K K * Y H G P V L C L K E T D S L T E R R R T I A L Y W A Y N R Q I Q S Y AsuI* AvaII DraII PpuMI SanDI |NlaIV |BmgT120I ||NlaIV ||| FatI ||| |CviAII ||| || NlaIII ||| || | PflMI ||| || | BsiYI* Hin4I ||| || | | MboII DpnI | BplI ApoI ||| || | | CviJI |BstKTI | BplI TspEI BslFI SfeI* ||| || | | BbvII* \\ \ \ \ \ \ \\\ \\ \ \ \ GATCTCTCCCCTTTTTACGCTAAAAAATTTCAAATACCCTACAGGGTCCCCATGATATGG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGAGAGGGGAAAAATGCGATTTTTTAAAGTTTATGGGATGTCCCAGGGGTACTATACC // / / / / / / /// / // // || XhoII | BplI TspEI BslFI | ||| | |FatI |CviJI || BglII | BplI ApoI | ||| | | MboII || MboI Hin4I | ||| | BsiYI* |DpnI | ||| | CviAII BstKTI | ||| | PflMI | ||| NlaIII | ||SanDI | ||PpuMI | ||DraII | ||AvaII | ||AsuI* | |BmgT120I | |NlaIV | NlaIV SfeI* D L S P F Y A K K F Q I P Y R V P M I W I S P L F T L K N F K Y P T G S P * Y G S L P F L R * K I S N T L Q G P H D M A ----:----|----:----|----:----|----:----|----:----|----:----| S R E G K * A L F N * I G * L T G M I H L D R G K K R * F I E F V R C P G W S I I E G R K V S F F K L Y G V P D G H Y P MnlI | TseI | |BisI AluI | ||BlsI CviJI TaqI | |||BsmI BbvI |MaeI \ \ \\\\ \ \\ CTCGATGTCTTCCAAGTATTCTTTGTATTCCTCGTCATTTCGCAGCATTCTCTCCACAGC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GAGCTACAGAAGGTTCATAAGAAACATAAGGAGCAGTAAAGCGTCGTAAGAGAGGTGTCG / / /// /// BbvII* | ||TseI ||CviJI TaqI | |BisI ||AluI | BlsI |BbvI | BsmI SetI MnlI L D V F Q V F F V F L V I S Q H S L H S S M S S K Y S L Y S S S F R S I L S T A R C L P S I L C I P R H F A A F S P Q L ----:----|----:----|----:----|----:----|----:----|----:----| S S T K W T N K T N R T M E C C E R W L A R H R G L I R Q I G R * K A A N E G C E I D E L Y E K Y E E D N R L M R E V A SetI \ TAG --- ATC / MaeI * X X --- * S L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AciI 2 BspACI,SsiI AjuI 1 AluI 2 AluBI ApoI 1 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BfiI 1 BmrI,BmuI BglII 1 BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 1 BmgT120I 2 BplI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseMII 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 1 BsrI 1 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 2 Cac8I 2 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI Csp6I 3 CviQI,RsaNI CviAII 3 CviJI 5 CviKI-1 CviRI* 3 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 2 MalI DraII 1 EcoO109I DrdI 2 AasI,DseDI Eco47III 2 Aor51HI,AfeI EcoRII 1 AjnI,Psp6I,PspGI FatI 3 GlaI 2 HaeII 2 BstH2I HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 1 Hin4II* 1 HpyAV Hin6I 2 HinP1I,HspAI HinfI 2 HpaII 1 HapII,BsiSI,MspI Hpy178III* 2 Hpy188III Hpy188I 1 KpnI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MmeI 1 MnlI 4 MwoI 1 HpyF10VI,BstMWI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PpuMI 1 Psp5II,PspPPI PsiI 1 AanI PstI 3 RsaI 3 AfaI SanDI 1 ScaI 1 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SetI 5 SfeI* 4 BstSFI,SfcI,BfmI SmlI 1 SmoI TaiI 1 TaqI 4 TatI 1 TfiI 2 PfeI TseI 3 ApeKI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspEI 3 TasI,Tsp509I,Sse9I XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AccI AclI AcyI AflII AflIII AgeI AhaIII* AlfI AloI AlwNI ApaI ApaLI AscI AsuII AvrII BaeI BamHI BarI BbvCI BccI Bce83I* BceAI BcgI BciVI BclI BdaI BetI* BglI BinI* BmtI Bpu10I BsaAI BsaBI BsaXI BseGI BsePI BseRI BseSI BseYI BsgI BsiI* BsmAI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstF5I BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cfr10I Cfr9I ClaI CspCI DinI DraIII DsaI* Eam1105I EciI Ecl136II Eco31I Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FauI FnuDII* FokI FseI FspAI GsaI GsuI HgaI HgiAI* HgiJII* HindII HindIII HpaI HphI Hpy166II Hpy8I Hpy99I KasI MaeIII MauBI McrI* MfeI MluI MlyI Mph1103I MroNI MseI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PfoI PleI PmaCI PmeI PpiI PshAI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SapI SauI* SchI SduI SecI* SexAI SfaNI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqII TauI TsoI Tsp45I TspDTI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769