Restriction Map of THI12/YNL332W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

THI12/YNL332W on chromosome XIV from coordinates 14832 to 15854.


BplI | AccI MboI | |SfeI* | DpnI | |Hpy166II | |BstKTI BsrI TspEI \ \\ \ \\ \ \ ATGTCTACAGACAAGATCACATTTTTGTTGAACTGGCAACCAACCCCATACCATATTCCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGATGTCTGTTCTAGTGTAAAAACAACTTGACCGTTGGTTGGGGTATGGTATAAGGT // / // / / || SfeI* || MboI BsrI |AccI |DpnI Hpy166II BstKTI M S T D K I T F L L N W Q P T P Y H I P C L Q T R S H F C * T G N Q P H T I F Q V Y R Q D H I F V E L A T N P I P Y S N ----:----|----:----|----:----|----:----|----:----|----:----| X D V S L I V N K N F Q C G V G Y W I G X T * L C S * M K T S S A V L G M G Y E H R C V L D C K Q Q V P L W G W V M N W FokI | XbaI | SetI | AjuI | |MaeI | |Hpy178III* | || FatI | || |CviAII | || || CfrI | || || |NlaIII | || || ||BalI | || || ||CviJI | || || ||HaeIII | || || |||BseGI AjuI MaeIII | || || |||| AjuI CviJI | SetI | || || |||| |MaeI \ \ \ \ \\ \\ \\\\ \\ ATTTTCTTGGCTCAAACCAAAGGTTACTTCAAGGAGCAAGGTCTAGACATGGCCATCCTA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAAGAACCGAGTTTGGTTTCCAATGAAGTTCCTCGTTCCAGATCTGTACCGGTAGGAT / / / / / // //// /// / / | AjuI CviJI SetI MaeIII |SetI |||| ||| CfrI MaeI TspEI AjuI |||| ||HaeIII |||| ||CviJI |||| ||BalI |||| ||AjuI |||| |BseGI |||| |FatI |||| CviAII |||NlaIII ||XbaI |Hpy178III* |MaeI FokI I F L A Q T K G Y F K E Q G L D M A I L F S W L K P K V T S R S K V * T W P S * F L G S N Q R L L Q G A R S R H G H P R ----:----|----:----|----:----|----:----|----:----|----:----| I K K A * V L P * K L S C P R S M A M R L K R P E F W L N S * P A L D L C P W G N E Q S L G F T V E L L L T * V H G D * BseMII |BspCNI |Hpy188I || MaeIII || Tsp45I || | Hin4II* || | | DdeI || | | | AjuI || | | | |TspRI || | | | ||MseI || | | | |||TspEI || | | | |||| MboI || | | | |||| XhoII || | | | |||| | DpnI || | | | |||| | |BstKTI || | | | |||| | || BinI* || | | | |||| | || | SalI || | | | |||| | || | |TaqI || | | | |||| | || | |AccI || | | | |||| | || | |SetI || | | | |||| | || | ||HindII || | | | |||| | || | ||Hpy166II || | | | |||| | || | ||| FatI || | | | |||| | || | ||| |CviAII BccI || | | | |||| | || | ||| || NlaIII \ \\ \ \ \ \\\\ \ \\ \ \\\ \\ \ GAACCAACCAATCCTTCCGATGTCACTGAGTTAATTGGATCTGGTAAGGTCGACATGGGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGGTTGGTTAGGAAGGCTACAGTGACTCAATTAACCTAGACCATTCCAGCTGTACCCA / /// // / / / / / // / / /// // BccI ||| || | | | | | || | | ||| |FatI ||| || | | | | | || | | ||| CviAII ||| || | | | | | || | | ||NlaIII ||| || | | | | | || | | ||SalI ||| || | | | | | || | | |AccI ||| || | | | | | || | | |TaqI ||| || | | | | | || | | Hpy166II ||| || | | | | | || | | HindII ||| || | | | | | || | BinI* ||| || | | | | | || | SetI ||| || | | | | | || XhoII ||| || | | | | | || MboI ||| || | | | | | |DpnI ||| || | | | | | BstKTI ||| || | | | | TspEI ||| || | | | MseI ||| || | | DdeI ||| || | Tsp45I ||| || | MaeIII ||| || AjuI ||| |Hin4II* ||| TspRI ||Hpy188I |BspCNI BseMII E P T N P S D V T E L I G S G K V D M G N Q P I L P M S L S * L D L V R S T W V T N Q S F R C H * V N W I W * G R H G F ----:----|----:----|----:----|----:----|----:----|----:----| S G V L G E S T V S N I P D P L T S M P L V L W D K R H * Q T L Q I Q Y P R C P F W G I R G I D S L * N S R T L D V H T CviJI |FatI ||CviAII ||| BbvI ||| TfiI ||| HinfI ||| NlaIII ||| | CspCI ||| | | StyI ||| | | SecI* ||| | | | SetI ||| | | | | TseI ||| | | | | CviJI ||| | | | | |BisI ||| | | | | ||BlsI ||| | | | | ||| StyI ||| | | | | ||| SecI* ||| | | | | ||| | MwoI ||| | | | | ||| | | AsuI* BsrI ||| | | | | ||| | | |CviJI | MaeIII ||| | | | | ||| | | |HaeIII | Tsp45I ||| | | | | ||| | | |BmgT120I | | MmeI ||| | | | | ||| | | || SecI* | | | TspRI ||| | | | | ||| | | || DsaI* | | | CspCI ||| | | | | ||| | | || | BfiI | | | | SetI \\\ \ \ \ \ \\\ \ \ \\ \ \ \ \ \ \ \ TTGAAAGCCATGATTCACACCTTGGCTGCCAAGGCCCGTGGTTTCCCAGTGACCTCTGTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTTCGGTACTAAGTGTGGAACCGACGGTTCCGGGCACCAAAGGGTCACTGGAGACAA // // // / ///// //// // / / / / || || || SetI ||||MwoI |||| || | | | Tsp45I || || |CspCI ||||TseI |||| || | | | MaeIII || || |BbvI |||BisI |||| || | | CspCI || || HinfI ||BlsI |||| || | | SetI || || TfiI |CviJI |||| || | MmeI || |FatI SecI* |||| || TspRI || CviAII StyI |||| || BsrI |NlaIII |||| |DsaI* CviJI |||| |SecI* |||| BfiI |||AsuI* ||BmgT120I |HaeIII |CviJI SecI* StyI L K A M I H T L A A K A R G F P V T S V * K P * F T P W L P R P V V S Q * P L L E S H D S H L G C Q G P W F P S D L C C ----:----|----:----|----:----|----:----|----:----|----:----| K F A M I * V K A A L A R P K G T V E T N S L W S E C R P Q W P G H N G L S R Q Q F G H N V G Q S G L G T T E W H G R N AgeI BtsI BetI* TatI TspRI Cfr10I |Csp6I |Hin4I BsiYI* ||RsaI |Hin4I MnlI MnlI |HpaII ||| MseI || BslFI \ \ \\ \\\ \ \\ \ GCCTCTTTGTTGGACGAACCATTTACCGGTGTCTTGTACTTAAAGGGCAGTGGTATCACT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAGAAACAACCTGCTTGGTAAATGGCCACAGAACATGAATTTCCCGTCACCATAGTGA / / / // /// / / / / / MnlI MnlI | |Cfr10I ||| | | | | TspRI | |BetI* ||| | | | BtsI | |AgeI ||| | | Hin4I | HpaII ||| | | Hin4I BsiYI* ||| | TspRI ||| MseI ||TatI |Csp6I RsaI A S L L D E P F T G V L Y L K G S G I T P L C W T N H L P V S C T * R A V V S L L F V G R T I Y R C L V L K G Q W Y H * ----:----|----:----|----:----|----:----|----:----|----:----| A E K N S S G N V P T K Y K F P L P I V Q R K T P R V M * R H R T S L P C H Y * G R Q Q V F W K G T D Q V * L A T T D S BarI |Eco57I |Eco57MI || Hin4I ApoI || Hin4I TspEI || | MboI EcoRI || | | DpnI | BarI || | | |BstKTI | BinI* TspRI || | | || MaeIII | | HphI | BbvII* || | | || | MaeII | | |MboI | |BsrI || | | || | |MboII | | |XhoII | |Eam1105I || | | || | || SetI | | || DpnI | || MboII || | | || | || TaiI | | || |BstKTI \ \\ \ \\ \ \ \\ \ \\ \ \ \ \\ \\ GAAGACTTCCAGTCCCTAAAGGGTAAGAAGATCGGTTACGTTGGTGAATTCGGTAAGATC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTGAAGGTCAGGGATTTCCCATTCTTCTAGCCAATGCAACCACTTAAGCCATTCTAG / // / / / / // / //// / / / / // / BslFI || | | | Hin4I || | |||MaeII | | | | || XhoII || | | | Hin4I || | ||MaeIII | | | | || MboI || | | Eco57MI || | |MboII | | | | |DpnI || | | Eco57I || | TaiI | | | | BstKTI || | BarI || | SetI | | | HphI || BbvII* || MboI | | BinI* || MboII |DpnI | EcoRI |Eam1105I BstKTI | TspEI BsrI | ApoI BarI E D F Q S L K G K K I G Y V G E F G K I K T S S P * R V R R S V T L V N S V R S R L P V P K G * E D R L R W * I R * D P ----:----|----:----|----:----|----:----|----:----|----:----| S S K W D R F P L F I P * T P S N P L I Q L S G T G L P Y S S R N R Q H I R Y S F V E L G * L T L L D T V N T F E T L D TspDTI BsaBI |BbvII* | TaqI TspDTI || AciI | ClaI TspEI | Tsp4CI* CviJI || | MboII Hpy188I \ \ \ \ \ \ \\ \ \ \ CAAATCGATGAATTGACCAAGCACTACGGTATGAAGCCAGAAGACTACACCGCAGTCAGA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTAGCTACTTAACTGGTTCGTGATGCCATACTTCGGTCTTCTGATGTGGCGTCAGTCT / / / / / / / // / BsaBI ClaI TspEI | Tsp4CI* CviJI TspDTI |AciI Hpy188I TaqI TspDTI BbvII* MboII Q I D E L T K H Y G M K P E D Y T A V R K S M N * P S T T V * S Q K T T P Q S D N R * I D Q A L R Y E A R R L H R S Q M ----:----|----:----|----:----|----:----|----:----|----:----| W I S S N V L C * P I F G S S * V A T L G F R H I S W A S R Y S A L L S C R L * L D I F Q G L V V T H L W F V V G C D S TatI |Csp6I ||RsaI ||TspDTI ||| Hin4II* ||| | TaqI ||| | | SfaNI ||| | | | SetI TaqI \\\ \ \ \ \ \ TGTGGTATGAATGTCGCCAAGTACATCATCGAAGGTAAGATTGATGCTGGTATTGGTATC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| ACACCATACTTACAGCGGTTCATGTAGTAGCTTCCATTCTAACTACGACCATAACCATAG / /// // / | ||| |SetI SfaNI | ||| TaqI | ||Hin4II* | ||TatI | |Csp6I | RsaI TspDTI C G M N V A K Y I I E G K I D A G I G I V V * M S P S T S S K V R L M L V L V S W Y E C R Q V H H R R * D * C W Y W Y R ----:----|----:----|----:----|----:----|----:----|----:----| H P I F T A L Y M M S P L I S A P I P I I H Y S H R W T C * R L Y S Q H Q Y Q Y T T H I D G L V D D F T L N I S T N T D TaqI | TspEI | |Ksp632I* SfaNI | || TsoI | AluI | || | TatI CviJI | CviJI | || | |Csp6I MboII | | SetI | || | ||RsaI |DdeI | | |AlwNI CviRI* | || | ||ScaI |EspI* | | || Hpy188I \ \ \\ \ \\\ \\ \ \ \\ \ GAATGTATGCAACAAGTCGAATTGGAAGAGTACTTGGCTAAGCAAGGCAGACCAGCTTCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTACATACGTTGTTCAGCTTAACCTTCTCATGAACCGATTCGTTCCGTCTGGTCGAAGA / / / / /// // / / / // TaqI CviRI* | | ||| || EspI* | | |Hpy188I | | ||| || DdeI | | MwoI | | ||| |CviJI | AlwNI | | ||| MboII | CviJI | | ||TatI | SfaNI | | |Csp6I | AluI | | ScaI SetI | | RsaI | Ksp632I* | TspEI | TsoI TaqI E C M Q Q V E L E E Y L A K Q G R P A S N V C N K S N W K S T W L S K A D Q L L M Y A T S R I G R V L G * A R Q T S F * ----:----|----:----|----:----|----:----|----:----|----:----| S H I C C T S N S S Y K A L C P L G A E R I Y A V L R I P L T S P * A L C V L K F T H L L D F Q F L V Q S L L A S W S R Csp6I MwoI CviJI |RsaI | DdeI TspEI | Cac8I MwoI || Tsp4CI* \ \ \ \ \ \ \\ \ GATGCTAAGATGTTGAGAATTGACAAGTTGGCTTGCTTGGGTTGCTGTTGCTTCTGTACC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTACGATTCTACAACTCTTAACTGTTCAACCGAACGAACCCAACGACAACGAAGACATGG / / / / / /// DdeI TspEI | | MwoI ||Tsp4CI* | Cac8I |Csp6I CviJI RsaI D A K M L R I D K L A C L G C C C F C T M L R C * E L T S W L A W V A V A S V P C * D V E N * Q V G L L G L L L L L Y R ----:----|----:----|----:----|----:----|----:----|----:----| S A L I N L I S L N A Q K P Q Q Q K Q V Q H * S T S F Q C T P K S P N S N S R Y I S L H Q S N V L Q S A Q T A T A E T G MboII | MboII | BsiYI* | | SetI | | |BdaI ApoI | | |BdaI CviRI* TspEI TspDTI | | ||Hpy188I Hpy178III* \ \ \ \ \ \\\ \ GTTCTTTACATCTGCAACGATGAATTTTTGAAGAAGAACCCTGAAAAGGTCAGAAAGTTC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGAAATGTAGACGTTGCTACTTAAAAACTTCTTCTTGGGACTTTTCCAGTCTTTCAAG / / / // / / / / CviRI* TspEI TspDTI || | | | Hpy188I ApoI || | | BdaI || | | BdaI || | SetI || MboII |BsiYI* MboII V L Y I C N D E F L K K N P E K V R K F F F T S A T M N F * R R T L K R S E S S S L H L Q R * I F E E E P * K G Q K V L ----:----|----:----|----:----|----:----|----:----|----:----| T R * M Q L S S N K F F F G S F T L F N R E K C R C R H I K S S S G Q F P * F T N K V D A V I F K Q L L V R F L D S L E BdaI BdaI | MaeII | | SetI | | TaiI | | | MaeI CviJI | | | | CviJI | Hin4II* | | | | | Hin4II* | | Hpy178III* | | | | | | BsiYI* | | | BccI | | | | | | | CviJI \ \ \ \ \ \ \ \ \ \ \ \ TTGAAAGCCATCAAGAAGGCAACCGACTACGTTCTAGCCGACCCTGTGAAGGCTTGGAAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTTCGGTAGTTCTTCCGTTGGCTGATGCAAGATCGGCTGGGACACTTCCGAACCTTT / // / / / / / // / / / | || | BccI BdaI | | || | BsiYI* CviJI | || | BdaI | | || Hin4II* | || Hpy178III* | | |CviJI | |Hin4II* | | MaeI | CviJI | MaeII Hpy178III* TaiI SetI L K A I K K A T D Y V L A D P V K A W K * K P S R R Q P T T F * P T L * R L G K E S H Q E G N R L R S S R P C E G L E R ----:----|----:----|----:----|----:----|----:----|----:----| K F A M L F A V S * T R A S G T F A Q F R S L W * S P L R S R E L R G Q S P K S Q F G D L L C G V V N * G V R H L S P F MnlI | MboI CviJI | | DpnI TaqI | TaqI | | |BstKTI \ \ \ \ \ \\ GAATACATCGACTTCAAGCCTCGATTGAACAACGATCTATCTTACAAGCAATACCAAAGA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATGTAGCTGAAGTTCGGAGCTAACTTGTTGCTAGATAGAATGTTCGTTATGGTTTCT / / / / // / TaqI | TaqI MnlI || MboI CviJI |DpnI BstKTI E Y I D F K P R L N N D L S Y K Q Y Q R N T S T S S L D * T T I Y L T S N T K D I H R L Q A S I E Q R S I L Q A I P K M ----:----|----:----|----:----|----:----|----:----|----:----| S Y M S K L G R N F L S R D * L C Y W L L I C R S * A E I S C R D I K C A I G F F V D V E L R S Q V V I * R V L L V L S MaeIII BstEII Ksp632I* Hpy166II | SetI | TatI | MaeIII | | AgeI | Bsp1407I | Tsp45I | | BetI* | |Csp6I | Tsp4CI* | | Cfr10I MboII | ||HphI | | Hin4II* | | |HpaII MaeIII TspDTI | ||RsaI | | | BsrI | | ||MboII \ \ \ \\\ \ \ \ \ \ \ \\\ TGTTACGCTTACTTCTCTTCATCTTTGTACAATGTTCACCGTGACTGGAAGAAGGTTACC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ACAATGCGAATGAAGAGAAGTAGAAACATGTTACAAGTGGCACTGACCTTCTTCCAATGG // / //// / / // / / // |MboII | |||| | | || BsrI SetI |Hin4I MaeIII | |||| | | |Tsp45I |Hin4I TspDTI | |||| | | |MaeIII BstEII | |||| | | Hin4II* MaeIII | |||| | Tsp4CI* MboII | |||| Hpy166II | |||Bsp1407I | |||TatI | ||Csp6I | |RsaI | HphI Ksp632I* C Y A Y F S S S L Y N V H R D W K K V T V T L T S L H L C T M F T V T G R R L P L R L L L F I F V Q C S P * L E E G Y R ----:----|----:----|----:----|----:----|----:----|----:----| H * A * K E E D K Y L T * R S Q F F T V I N R K S R K M K T C H E G H S S S P * T V S V E R * R Q V I N V T V P L L N G TsoI | Hin4I | Hin4I MaeIII | Tth111I | Hin4I | | Hpy178III* | Hin4I Hin4I | | |TaqI | | Tsp4CI* CviJI | BccI | | || BsmAI Hin4I \ \ \ \ \ \ \ \ \\ \ \ GGTTACGGTAAGAGATTAGCCATCTTGCCACCAGACTATGTCTCGAACTACACTAATGAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CCAATGCCATTCTCTAATCGGTAGAACGGTGGTCTGATACAGAGCTTGATGTGATTACTT // / // / // / // / / || Tsp4CI* |Hin4I | |Hin4I | || | Hin4I || MaeIII CviJI | |Hin4I | || BsmAI |Cfr10I | TsoI | |TaqI |BetI* BccI | Hpy178III* |AgeI Tth111I HpaII G Y G K R L A I L P P D Y V S N Y T N E V T V R D * P S C H Q T M S R T T L M N L R * E I S H L A T R L C L E L H * * I ----:----|----:----|----:----|----:----|----:----|----:----| P * P L L N A M K G G S * T E F * V L S R N R Y S I L W R A V L S H R S S C * H T V T L S * G D Q W W V I D R V V S I F BssKI EcoRII | ScrFI | BseBI | |CfrI BinI* | ||TspDTI |SetI AluI | |||BalI || MboI CviJI | |||CviJI || Hpy188I | SetI | |||HaeIII || |MboII | |TsoI | |||| Ksp632I* || ||DpnI | || BccI | |||| |MnlI || |||BstKTI | || | TspDTI \ \\\\ \\ \\ \\\\ \ \\ \ \ TACTTGTCCTGGCCAGAACCAGAAGAGGTTTCTGATCCTTTGGAAGCTCAAAGATTGATG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAACAGGACCGGTCTTGGTCTTCTCCAAAGACTAGGAAACCTTCGAGTTTCTAACTAC // / / / / / / //// / / // // || | | | | | | |||| MboI | |TsoI |TspDTI || | | | | | | |||DpnI | CviJI BccI || | | | | | | ||BstKTI | AluI || | | | | | | |MboII SetI || | | | | | | Hpy188I || | | | | | BinI* || | | | | SetI || | | | Ksp632I* || | | MnlI || | CfrI || EcoRII || HaeIII || BssKI || CviJI || BalI |BseBI |ScrFI TspDTI Y L S W P E P E E V S D P L E A Q R L M T C P G Q N Q K R F L I L W K L K D * W L V L A R T R R G F * S F G S S K I D G ----:----|----:----|----:----|----:----|----:----|----:----| Y K D Q G S G S S T E S G K S A * L N I I S T R A L V L L P K Q D K P L E F I S V Q G P W F W F L N R I R Q F S L S Q H MwoI |SapI |Ksp632I* Csp6I || AluI Hpy178III* |BplI || CviJI | CviRI* |RsaI Hpy178III* || | MseI CviJI | | Hin4II* |SetI | MboII CviJI || | SetI \ \ \ \ \\ \ \ \ \\ \ \ GCTATTCATCAAGAAAAATGCAGACAGGAAGGTACTTTCAAGAGATTGGCTCTTCCAGCT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CGATAAGTAGTTCTTTTTACGTCTGTCCTTCCATGAAAGTTCTCTAACCGAGAAGGTCGA / / // // // // / / / /// CviJI | || || |Csp6I |MboII | | | ||BplI | || || RsaI | | | | |Ksp632I* | || |SetI | | | | |SapI | || BplI | | | | CviJI | |Hin4II* | | | | AluI | CviRI* | | | SetI Hpy178III* | | MwoI | CviJI Hpy178III* A I H Q E K C R Q E G T F K R L A L P A L F I K K N A D R K V L S R D W L F Q L Y S S R K M Q T G R Y F Q E I G S S S L ----:----|----:----|----:----|----:----|----:----|----:----| A I * * S F H L C S P V K L L N A R G A P * E D L F I C V P L Y K * S I P E E L S N M L F F A S L F T S E L S Q S K W S TAA --- ATT / MseI * X X --- * K L # Enzymes that cut Frequency Isoschizomers AccI 2 FblI,XmiI AciI 1 BspACI,SsiI AgeI 2 AsiGI,BshTI,CspAI,PinAI AjuI 2 AluI 3 AluBI AlwNI 1 CaiI ApoI 2 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I BalI 2 MlsI,MluNI,MscI,Msp20I BarI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 4 BdaI 2 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BinI* 3 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 1 BplI 1 BsaBI 1 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 1 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BsrI 4 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 6 BtsI 1 Cac8I 1 BstC8I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 6 CviQI,RsaNI CspCI 1 CviAII 3 CviJI 19 CviKI-1 CviRI* 3 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 6 MalI DsaI* 1 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco57I 1 AcuI Eco57MI 1 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FatI 3 FokI 1 HaeIII 3 BsnI,BsuRI,BshFI,PhoI Hin4I 5 Hin4II* 6 HpyAV HindII 1 HincII HinfI 1 HpaII 2 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 5 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 8 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 10 MmeI 1 MnlI 4 MseI 3 Tru1I,Tru9I MwoI 4 HpyF10VI,BstMWI NlaIII 3 Hin1II,Hsp92II,FaeI RsaI 6 AfaI SalI 1 SapI 1 LguI,PciSI,BspQI ScaI 1 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 3 BseDI,BssECI,BsaJI SetI 15 SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 8 TatI 4 TfiI 1 PfeI TseI 1 ApeKI TsoI 3 Tsp45I 3 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 7 TasI,Tsp509I,Sse9I TspRI 4 TscAI Tth111I 1 PflFI,PsyI,AspI XbaI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AflIII AhaIII* AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BamHI BbvCI Bce83I* BceAI BcgI BciVI BclI BglI BglII BmeT110I BmtI Bpu10I BsaAI BsaXI BsePI BseRI BseSI BseYI BsgI BsiI* BsmI Bsp120I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstXI BstZ17I BtgZI BtrI CauII* Cfr9I DinI DraII DraIII DrdI EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRV EcoT22I EgeI EheI Esp3I FalI FauI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin6I HindIII HinP1I HpaI Hpy99I HspAI KasI KpnI MauBI McrI* MfeI MluI MlyI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SanDI SauI* SchI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqII TauI TspGWI TspMI TstI VspI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769