Restriction Map of RPD3/YNL330C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RPD3/YNL330C on chromosome XIV from coordinates 19302 to 18001.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.13419

EMBOSS_001 BinI* | SetI | | TspDTI | | |MboI | | || DpnI | | || |BstKTI | | || || MboI | | || || Hpy188I | | || || | DpnI | | || || | |BstKTI MluI | | || || | || Tsp4CI* AflIII | | || || | || | CviJI | FnuDII* \ \ \\ \\ \ \\ \ \ \ \ ATGGTATATGAAGCAACACCTTTTGATCCGATCACGGTCAAGCCAAGCGATAAAAGACGC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCATATACTTCGTTGTGGAAAACTAGGCTAGTGCCAGTTCGGTTCGCTATTTTCTGCG / // // / // / / / / | || || | || | | CviJI FnuDII* | || || | || | Tsp4CI* | || || | || MboI | || || | |DpnI | || || | BstKTI | || || Hpy188I | || || MboI | || |DpnI | || BstKTI | |TspDTI | BinI* SetI M V Y E A T P F D P I T V K P S D K R R W Y M K Q H L L I R S R S S Q A I K D A G I * S N T F * S D H G Q A K R * K T R ----:----|----:----|----:----|----:----|----:----|----:----| X T Y S A V G K S G I V T L G L S L L R X P I H L L V K Q D S * P * A L R Y F V H Y I F C C R K I R D R D L W A I F S A BspMI CviRI* CviRI* | NdeI MaeIII CviRI* | MaeII | EcoT22I Tsp45I |HgaI | | SetI | | HphI BstEII ||SfaNI | | TaiI | | MwoI | SetI \\\ \ \ \ \ \ \ \ \ GTTGCATATTTTTACGATGCAGACGTTGGGAACTATGCATATGGAGCAGGTCACCCGATG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGTATAAAAATGCTACGTCTGCAACCCTTGATACGTATACCTCGTCCAGTGGGCTAC / / / / / / / / /// / / | | SfaNI | | MaeII | | ||HphI SetI BstEII | | HgaI | TaiI | | |BspMI Tsp45I | CviRI* | SetI | | |NdeI MaeIII AflIII CviRI* | | MwoI MluI | CviRI* EcoT22I V A Y F Y D A D V G N Y A Y G A G H P M L H I F T M Q T L G T M H M E Q V T R * C I F L R C R R W E L C I W S R S P D E ----:----|----:----|----:----|----:----|----:----|----:----| T A Y K * S A S T P F * A Y P A P * G I R Q M N K R H L R Q S S H M H L L D G S N C I K V I C V N P V I C I S C T V R H CviJI | TatI CviJI | Bsp1407I |AciI | |Csp6I |BisI | ||RsaI ||BlsI | ||TspDTI |||TauI TspDTI TspEI | ||| BccI \\\\ \ \ \ \\\ \ AAGCCGCATAGAATAAGAATGGCACATTCCCTTATTATGAATTATGGCTTGTACAAGAAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGGCGTATCTTATTCTTACCGTGTAAGGGAATAATACTTAATACCGAACATGTTCTTC //// / / / / //// |||AciI TspDTI | | | |||BccI ||BisI | | | ||Bsp1407I |BlsI | | | ||TatI CviJI | | | |Csp6I TauI | | | RsaI | | TspDTI | CviJI TspEI K P H R I R M A H S L I M N Y G L Y K K S R I E * E W H I P L L * I M A C T R R A A * N K N G T F P Y Y E L W L V Q E D ----:----|----:----|----:----|----:----|----:----|----:----| F G C L I L I A C E R I I F * P K Y L F S A A Y F L F P V N G * * S N H S T C S L R M S Y S H C M G K N H I I A Q V L L AluI CviJI |DdeI |EspI* ||SetI ||| MroNI ||| CviJI ||| Cfr10I ||| |MwoI ApoI ||| |HpaII TspEI ||| ||NaeI | MboII ||| ||Cac8I MslI \ \ \\\ \\\ \ ATGGAAATTTACAGAGCTAAGCCGGCAACGAAACAAGAAATGTGTCAGTTCCATACTGAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTTAAATGTCTCGATTCGGCCGTTGCTTTGTTCTTTACACAGTCAAGGTATGACTA // / / /// /// / || | | ||| ||Cfr10I Hin4I || | | ||| ||MroNI Hin4I || | | ||| |HpaII MslI || | | ||| Cac8I || | | ||| NaeI || | | ||CviJI || | | |EspI* || | | |DdeI || | | MwoI || | CviJI || | AluI || SetI |TspEI |ApoI MboII M E I Y R A K P A T K Q E M C Q F H T D W K F T E L S R Q R N K K C V S S I L M G N L Q S * A G N E T R N V S V P Y * * ----:----|----:----|----:----|----:----|----:----|----:----| I S I * L A L G A V F C S I H * N W V S S P F K C L * A P L S V L F T D T G Y Q H F N V S S L R C R F L F H T L E M S I BplI BplI BplI | GsuI BplI | MnlI Hpy178III* | Hin4I | TspDTI | Hin4I | | MseI Hin4I | Eco57MI | Hin4I | | |AhaIII* Hin4I | | TaqI MaeIII | | TspEI | | || MmeI \ \ \ \ \ \ \ \ \ \ \\ \ GAATACATTGATTTTTTATCGAGGGTTACTCCAGATAATTTAGAAATGTTTAAAAGAGAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATGTAACTAAAAAATAGCTCCCAATGAGGTCTATTAAATCTTTACAAATTTTCTCTT / // / // / // / // / BplI |MnlI TaqI || | || Hin4I || MmeI BplI Eco57MI || | |TspEI |MseI TspDTI || | BplI AhaIII* GsuI || | BplI || Hpy178III* |MaeIII Hin4I Hin4I E Y I D F L S R V T P D N L E M F K R E N T L I F Y R G L L Q I I * K C L K E K I H * F F I E G Y S R * F R N V * K R K ----:----|----:----|----:----|----:----|----:----|----:----| S Y M S K K D L T V G S L K S I N L L S H I C Q N K I S P * E L Y N L F T * F L F V N I K * R P N S W I I * F H K F S F CviJI | SduI | HgiJII* | | TatI | | |Csp6I | | ||RsaI | | ||ScaI Hin4I | | ||| SfeI* MseI Hpy188I BccI | | ||| |Tsp4CI* \ \ \ \ \ \\\ \\ AGTGTCAAGTTTAATGTCGGAGATGATTGTCCTGTCTTTGATGGGCTCTATGAGTACTGT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCACAGTTCAAATTACAGCCTCTACTAACAGGACAGAAACTACCCGAGATACTCATGACA // / / / / /// || Hpy188I BccI | CviJI ||Tsp4CI* |Hin4I HgiJII* ||TatI MseI SduI |Csp6I ScaI RsaI S V K F N V G D D C P V F D G L Y E Y C V S S L M S E M I V L S L M G S M S T V C Q V * C R R * L S C L * W A L * V L * ----:----|----:----|----:----|----:----|----:----|----:----| L T L N L T P S S Q G T K S P S * S Y Q F H * T * H R L H N D Q R Q H A R H T S T D L K I D S I I T R D K I P E I L V T TseI AluI CviJI CviJI |BisI |BbvI ||BlsI MnlI ||Hin4II* ||SetI |Hpy188I \\\ \\\ \\ AGCATATCTGGTGGTGGCTCTATGGAAGGAGCTGCTCGTCTGAATAGAGGCAAATGTGAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTATAGACCACCACCGAGATACCTTCCTCGACGAGCAGACTTATCTCCGTTTACACTA / // / / //// // SfeI* || BbvI | |||TseI |Hpy188I |Hin4II* | ||BisI MnlI CviJI | |BlsI | CviJI | AluI SetI S I S G G G S M E G A A R L N R G K C D A Y L V V A L W K E L L V * I E A N V M H I W W W L Y G R S C S S E * R Q M * C ----:----|----:----|----:----|----:----|----:----|----:----| L M D P P P E I S P A A R R F L P L H S Y C I Q H H S * P L L Q E D S Y L C I H A Y R T T A R H F S S S T Q I S A F T I BcgI | CviRI* | | FatI Hpy188I FauI | | |CviAII | HindIII HindII | | || CviRI* | | AluI Hpy166II | | || NlaIII | | CviJI | AciI | | || | SfaNI | | | SetI BcgI \ \ \ \ \\ \ \ \ \ \ \ \ GTTGCTGTCAACTATGCGGGTGGTTTGCATCATGCAAAAAAATCGGAAGCTTCTGGGTTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGACAGTTGATACGCCCACCAAACGTAGTACGTTTTTTTAGCCTTCGAAGACCCAAA / / / / / / // / / / / / / | FauI | BcgI | | || | | | | | BcgI Hpy166II AciI | | || | | | | HindIII HindII | | || | | | CviJI | | || | | | AluI | | || | | SetI | | || | Hpy188I | | || SfaNI | | |CviRI* | | |FatI | | CviAII | NlaIII CviRI* V A V N Y A G G L H H A K K S E A S G F L L S T M R V V C I M Q K N R K L L G F C C Q L C G W F A S C K K I G S F W V L ----:----|----:----|----:----|----:----|----:----|----:----| T A T L * A P P K C * A F F D S A E P N H Q Q * S H P H N A D H L F I P L K Q T N S D V I R T T Q M M C F F R F S R P K TatI MseI |Csp6I AluI |SwaI ||RsaI CviJI |AhaIII* ||ScaI BsrI BfiI | SetI \\ \\\ \ \ \ \ TGTTATTTAAATGACATAGTACTGGGCATTATTGAGCTACTACGATACCACCCCAGAGTT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ACAATAAATTTACTGTATCATGACCCGTAATAACTCGATGATGCTATGGTGGGGTCTCAA // /// / / / / |MseI ||| BsrI | | CviJI AhaIII* ||TatI | | AluI SwaI |Csp6I | SetI ScaI BfiI RsaI C Y L N D I V L G I I E L L R Y H P R V V I * M T * Y W A L L S Y Y D T T P E F L F K * H S T G H Y * A T T I P P Q S S ----:----|----:----|----:----|----:----|----:----|----:----| Q * K F S M T S P M I S S S R Y W G L T K N N L H C L V P C * Q A V V I G G W L T I * I V Y Y Q A N N L * * S V V G S N ApaLI | CviRI* | Hpy166II | | SduI | | BseSI | | HgiAI* | | |FatI | | |NcoI | | |StyI | | |SecI* | | |DsaI* | | ||BccI | | ||CviAII | | |||OliI | | |||MslI | | |||| NlaIII | | |||| |MslI | | |||| || BstXI | | |||| || | MnlI HphI MboI \ \ \\\\ \\ \ \ \ \ CTGTATATTGATATTGATGTGCACCATGGTGATGGTGTAGAGGAAGCGTTTTATACAACG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GACATATAACTATAACTACACGTGGTACCACTACCACATCTCCTTCGCAAAATATGTTGC / / // //// / / | | || |||| MnlI HphI | | || |||MslI | | || ||DsaI* | | || ||SecI* | | || ||StyI | | || ||NcoI | | || ||FatI | | || |CviAII | | || |BstXI | | || MslI | | || OliI | | || BccI | | |NlaIII | | ApaLI | Hpy166II | CviRI* HgiAI* BseSI SduI L Y I D I D V H H G D G V E E A F Y T T C I L I L M C T M V M V * R K R F I Q R V Y * Y * C A P W * W C R G S V L Y N G ----:----|----:----|----:----|----:----|----:----|----:----| R Y I S I S T C W P S P T S S A N * V V E T Y Q Y Q H A G H H H H L P L T K Y L Q I N I N I H V M T I T Y L F R K I C R DpnI |BstKTI || FatI || BspHI BssKI || BinI* SecI* || |CviAII EcoRII || |Hpy178III* |HphI || || NlaIII ||ScrFI || || |FatI ||BseBI || || |AflIII ||| EcoNI || || |TspGWI ||| | BseMII || || |BspLU11I* ||| | BsiYI* || || ||CviAII ||| | |BspCNI || || ||| NspI MslI ||| | || SetI || || ||| NlaIII | BstXI ||| | || |Hpy166II \\ \\ \\\ \ \ \ \\\ \ \\ \\ GATCGTGTCATGACATGTTCTTTCCACAAATATGGTGAGTTTTTCCCTGGCACAGGTGAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGCACAGTACTGTACAAGAAAGGTGTTTATACCACTCAAAAAGGGACCGTGTCCACTT // / // /// // / / / //// / / || | || ||| |BspLU11I* | MslI | |||| SetI Hpy166II || | || ||| |AflIII BstXI | |||BspCNI || | || ||| |FatI | |||EcoNI || | || ||| CviAII | ||EcoRII || | || ||NlaIII | ||BseMII || | || ||NspI | ||BssKI || | || |BspHI | |BsiYI* || | || |FatI | |SecI* || | || Hpy178III* | BseBI || | || TspGWI | ScrFI || | || CviAII HphI || | |BinI* || | NlaIII || MboI |DpnI BstKTI D R V M T C S F H K Y G E F F P G T G E I V S * H V L S T N M V S F S L A Q V N S C H D M F F P Q I W * V F P W H R * T ----:----|----:----|----:----|----:----|----:----|----:----| S R T M V H E K W L Y P S N K G P V P S P D H * S M N K G C I H H T K G Q C L H I T D H C T R E V F I T L K E R A C T F AciI Esp3I HphI FnuDII* BsmAI DdeI TaqII CviRI* | BsgI | MseI SfaNI \ \ \ \ \ \ \ \ CTGAGAGATATAGGGGTGGGTGCAGGAAAAAACTACGCGGTCAATGTGCCATTAAGAGAC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GACTCTCTATATCCCCACCCACGTCCTTTTTTGATGCGCCAGTTACACGGTAATTCTCTG /// / / / / / ||HphI CviRI* | BsgI BsmAI Tsp4CI* |TaqII | AciI Esp3I DdeI FnuDII* MseI L R D I G V G A G K N Y A V N V P L R D * E I * G W V Q E K T T R S M C H * E T E R Y R G G C R K K L R G Q C A I K R R ----:----|----:----|----:----|----:----|----:----|----:----| S L S I P T P A P F F * A T L T G N L S V S L Y L P P H L F F S R P * H A M L L Q S I Y P H T C S F V V R D I H W * S V MaeII |BsaAI |SnaBI || SetI || TaiI || | MboI || | BglII || | XhoII || | | DpnI EcoP15I Tsp4CI* || | | |BstKTI SetI | TspEI \ \\ \ \ \\ \ \ \ GGTATTGACGATGCTACGTATAGATCTGTGTTTGAACCTGTGATAAAAAAAATTATGGAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAACTGCTACGATGCATATCTAGACACAAACTTGGACACTATTTTTTTTAATACCTT / / // // / / / / SfaNI | || || XhoII SetI | TspEI | || || BglII EcoP15I | || || MboI | || |DpnI | || BstKTI | |MaeII | SnaBI | BsaAI TaiI SetI G I D D A T Y R S V F E P V I K K I M E V L T M L R I D L C L N L * * K K L W N Y * R C Y V * I C V * T C D K K N Y G M ----:----|----:----|----:----|----:----|----:----|----:----| P I S S A V Y L D T N S G T I F F I I S R Y Q R H * T Y I Q T Q V Q S L F F * P T N V I S R I S R H K F R H Y F F N H F HinfI Hin4II* | Eam1105I | MaeIII | | HpaII | | Tsp4CI* | | | BslFI | | | Hin4I | | | | MboI | | | Hin4I | | | | | DpnI | | | | MlyI | | | | | |PvuI | | | | PleI | | | | | |McrI* SetI | | | | TspRI | | | | | |BstKTI \ \ \ \ \ \ \ \ \ \ \ \\ TGGTATCAACCTTCTGCTGTCGTGTTACAGTGTGGTGGGGACTCCTTGTCCGGCGATCGT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ACCATAGTTGGAAGACGACAGCACAATGTCACACCACCCCTGAGGAACAGGCCGCTAGCA / / // / // // / // / SetI | || | |PleI || | || Hin4I | || | MlyI || | || Hin4I | || Tsp4CI* || | || MboI | || MaeIII || | |BslFI | |Hin4I || | |DpnI | |Hin4I || | BstKTI | TspRI || | McrI* Hin4II* || | PvuI || HpaII |Eam1105I HinfI W Y Q P S A V V L Q C G G D S L S G D R G I N L L L S C Y S V V G T P C P A I V V S T F C C R V T V W W G L L V R R S S ----:----|----:----|----:----|----:----|----:----|----:----| H Y * G E A T T N C H P P S E K D P S R I T D V K Q Q R T V T H H P S R T R R D P I L R R S D H * L T T P V G Q G A I T Hin4II* |FatI |NcoI |StyI |SecI* |DsaI* ||CviAII ||| NlaIII ||| | CviJI ||| | HaeIII ||| | |FatI ||| | ||CviAII Hin4I ||| | ||| NlaIII Hin4I MseI ||| | ||| | TspEI Hpy166II BinI* \ \ \\\ \ \\\ \ \ \ \ CTTGGTTGCTTTAATCTTTCCATGGAAGGCCATGCTAATTGTGTAAACTATGTGAAATCC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GAACCAACGAAATTAGAAAGGTACCTTCCGGTACGATTAACACATTTGATACACTTTAGG / / / // // // / / MseI | | || || |FatI | Hpy166II | | || || CviAII TspEI | | || |NlaIII | | || HaeIII | | || CviJI | | |DsaI* | | |SecI* | | |StyI | | |NcoI | | |FatI | | CviAII | NlaIII Hin4II* L G C F N L S M E G H A N C V N Y V K S L V A L I F P W K A M L I V * T M * N P W L L * S F H G R P C * L C K L C E I L ----:----|----:----|----:----|----:----|----:----|----:----| R P Q K L R E M S P W A L Q T F * T F D D Q N S * D K W P L G H * N H L S H S I K T A K I K G H F A M S I T Y V I H F G MboI BamHI XhoII | DpnI | NlaIV | |BstKTI | ||BccI | ||| BinI* MnlI | ||| | BsiYI* | MnlI CviJI BseRI CviRI* \ \\\ \ \ \ \ \ \ \ TTTGGGATCCCAATGATGGTTGTTGGTGGAGGAGGCTATACTATGAGAAATGTTGCAAGG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCCTAGGGTTACTACCAACAACCACCTCCTCCGATATGATACTCTTTACAACGTTCC / // // / / / / / / / | || || | BinI* | MnlI CviJI BseRI CviRI* | || || BsiYI* MnlI | || |BccI | || XhoII | || BamHI | || MboI | |NlaIV | |DpnI | BstKTI BinI* F G I P M M V V G G G G Y T M R N V A R L G S Q * W L L V E E A I L * E M L Q G W D P N D G C W W R R L Y Y E K C C K D ----:----|----:----|----:----|----:----|----:----|----:----| K P I G I I T T P P P P * V I L F T A L R Q S G L S P Q Q H L L S Y * S F H Q L K P D W H H N N T S S A I S H S I N C P AclI FatI AccI MaeII Tsp4CI* |CviAII SetI | SetI |Csp6I || NlaIII |Hpy166II | TaiI ||RsaI \\ \ \\ \ \ \\\ ACATGGTGCTTTGAAACAGGTCTACTAAATAACGTTGTCTTGGATAAAGATTTACCGTAC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TGTACCACGAAACTTTGTCCAGATGATTTATTGCAACAGAACCTATTTCTAAATGGCATG / // / // / / / // | |FatI SetI |AccI | MaeII | |Csp6I | CviAII Hpy166II | AclI | RsaI NlaIII TaiI Tsp4CI* SetI T W C F E T G L L N N V V L D K D L P Y H G A L K Q V Y * I T L S W I K I Y R T M V L * N R S T K * R C L G * R F T V Q ----:----|----:----|----:----|----:----|----:----|----:----| V H H K S V P R S F L T T K S L S K G Y S M T S Q F L D V L Y R Q R P Y L N V T C P A K F C T * * I V N D Q I F I * R V SspI |TspDTI || AsuI* || AvaII || Tsp4CI* || |BmgT120I SetI || || Hpy178III* |TaqI XmnI SspI || || | PsiI MseI |AsuII |Hin4II* \ \\ \\ \ \ \ \\ \\ AATGAATATTACGAATATTACGGTCCAGATTATAAGTTAAGTGTTAGACCTTCGAATATG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTATAATGCTTATAATGCCAGGTCTAATATTCAATTCACAATCTGGAAGCTTATAC / // / // / / / / / / SspI |SspI | || | PsiI MseI SetI | Hin4II* | | || Hpy178III* | XmnI | | |AvaII AsuII | | |AsuI* TaqI | | BmgT120I | Tsp4CI* TspDTI N E Y Y E Y Y G P D Y K L S V R P S N M M N I T N I T V Q I I S * V L D L R I C * I L R I L R S R L * V K C * T F E Y V ----:----|----:----|----:----|----:----|----:----|----:----| L S Y * S Y * P G S * L N L T L G E F I C H I N R I N R D L N Y T L H * V K S Y I F I V F I V T W I I L * T N S R R I H Hpy178III* | Hpy178III* | | SetI TspEI \ \ \ \ TTCAATGTAAATACTCCCGAATATCTTGACAAGGTAATGACCAATATATTTGCTAATTTG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTACATTTATGAGGGCTTATAGAACTGTTCCATTACTGGTTATATAAACGATTAAAC / / / / | | SetI TspEI | Hpy178III* Hpy178III* F N V N T P E Y L D K V M T N I F A N L S M * I L P N I L T R * * P I Y L L I W Q C K Y S R I S * Q G N D Q Y I C * F G ----:----|----:----|----:----|----:----|----:----|----:----| N L T F V G S Y R S L T I V L I N A L K T * H L Y E R I D Q C P L S W Y I Q * N E I Y I S G F I K V L Y H G I Y K S I Q SfaNI | StyI | AvrII | SecI* TfiI | |MaeI TaqII MaeI HinfI | ||SetI | BseGI \ \ \ \\\ \ \ GAAAACACAAAGTATGCCCCTAGTGTTCAGTTGAATCACACACCTAGGGATGCCGAAGAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTGTGTTTCATACGGGGATCACAAGTCAACTTAGTGTGTGGATCCCTACGGCTTCTA / / / / // / / MaeI | | | || | BseGI | | | || TaqII | | | |SecI* | | | |AvrII | | | |StyI | | | MaeI | | SfaNI | SetI HinfI TfiI E N T K Y A P S V Q L N H T P R D A E D K T Q S M P L V F S * I T H L G M P K I K H K V C P * C S V E S H T * G C R R F ----:----|----:----|----:----|----:----|----:----|----:----| S F V F Y A G L T * N F * V G L S A S S P F C L T H G * H E T S D C V * P H R L F V C L I G R T N L Q I V C R P I G F I HphI | TfiI | HinfI | | MnlI | | | MboII | | | |SecI* | | | || MboII | | | || | CviJI NmeAIII FokI MboII | | | || | | Hin4II* | MnlI \ \ \ \ \ \\ \ \ \ \ \ TTGGGTGATGTTGAAGAAGATTCTGCCGAGGCTAAAGATACGAAGGGTGGTTCGCAATAT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCACTACAACTTCTTCTAAGACGGCTCCGATTTCTATGCTTCCCACCAAGCGTTATA // / / / / / // / / / |MboII HphI | | | | || Hin4II* | MnlI FokI | | | | |CviJI NmeAIII | | | | SecI* | | | MboII | | MboII | HinfI | TfiI MnlI L G D V E E D S A E A K D T K G G S Q Y W V M L K K I L P R L K I R R V V R N M G * C * R R F C R G * R Y E G W F A I C ----:----|----:----|----:----|----:----|----:----|----:----| K P S T S S S E A S A L S V F P P E C Y N P H H Q L L N Q R P * L Y S P H N A I Q T I N F F I R G L S F I R L T T R L I AsuI* AvaII DraII PpuMI |NlaIV |BmgT120I || SetI || |FatI || |AflIII || |BspLU11I* || ||CviAII || ||| NspI || ||| NlaIII || ||| | BslFI || ||| | | FatI || ||| | | |CviAII || ||| | | || NlaIII || ||| | | || | ApoI || ||| | | || | TspEI || ||| | | || |MslI EcoRI \\ \\\ \ \ \\ \\ \ GCGAGGGACCTACATGTTGAGCATGACAATGAATTCTATTGA 1270 1280 1290 1300 ----:----|----:----|----:----|----:----|-- CGCTCCCTGGATGTACAACTCGTACTGTTACTTAAGATAACT /// / // / //// / ||| | || | |||MslI EcoRI ||| | || | ||FatI TspEI ||| | || | |CviAII ApoI ||| | || | BslFI ||| | || NlaIII ||| | |BspLU11I* ||| | |AflIII ||| | |FatI ||| | CviAII ||| NlaIII ||| NspI ||PpuMI ||DraII ||AvaII ||AsuI* |BmgT120I NlaIV SetI A R D L H V E H D N E F Y * R G T Y M L S M T M N S I X E G P T C * A * Q * I L L X ----:----|----:----|----:----|----:----|-- A L S R C T S C S L S N * Q H S P G V H Q A H C H I R N R P V * M N L M V I F E I S # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 3 BspACI,SsiI AclI 1 Psp1406I AflIII 3 AhaIII* 2 DraI AluI 4 AluBI ApaLI 1 Alw44I,VneI ApoI 2 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BamHI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BccI 4 BcgI 1 BfiI 1 BmrI,BmuI BglII 1 BinI* 4 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 2 BplI 2 BsaAI 1 BstBAI,Ppu21I BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 1 BseRI 1 BseSI 1 BaeGI,BstSLI BsgI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BspHI 1 CciI,PagI,RcaI BspLU11I* 2 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 6 BstXI 2 Cac8I 1 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 4 CviQI,RsaNI CviAII 9 CviJI 13 CviKI-1 CviRI* 8 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 6 MalI DraII 1 EcoO109I DsaI* 2 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco57MI 1 EcoNI 1 BstENI,XagI EcoP15I 1 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FatI 9 FauI 1 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 GsuI 1 BpmI HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4I 5 Hin4II* 5 HpyAV HindII 1 HincII HindIII 1 HinfI 3 HpaII 2 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 4 MaeI 2 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 3 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 McrI* 1 BsiEI,BstMCI,Bsh1285I MluI 1 MlyI 1 SchI MmeI 1 MnlI 7 MroNI 1 NgoMIV MseI 6 Tru1I,Tru9I MslI 5 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NaeI 1 PdiI NcoI 2 Bsp19I NdeI 1 FauNDI NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NmeAIII 1 NspI 2 BstNSI,XceI OliI 1 AleI PleI 1 PpsI PpuMI 1 Psp5II,PspPPI PsiI 1 AanI PvuI 1 MvrI,Ple19I,BpvUI RsaI 4 AfaI ScaI 2 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 5 BseDI,BssECI,BsaJI SetI 17 SfaNI 4 LweI SfeI* 1 BstSFI,SfcI,BfmI SnaBI 1 Eco105I,BstSNI SspI 2 StyI 3 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 3 TaqI 2 TaqII 2 TatI 3 TauI 1 TfiI 2 PfeI TseI 1 ApeKI Tsp45I 1 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 7 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AcyI AflII AgeI AjuI AlfI AloI AlwNI ApaI AscI Asp718I AvaI BaeI BalI BarI BbvCI BbvII* Bce83I* BceAI BciVI BclI BdaI BetI* BglI BmeT110I BmtI Bpu10I BsaBI BsaXI BsePI BseYI BsiI* BsmI Bsp120I BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstZ17I BtgZI BtrI BtsI CauII* Cfr9I CfrI ClaI CspCI DinI DraIII DrdI EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoRV EgeI EheI FalI FseI FspAI GlaI GsaI HaeII HgiCI* HhaI Hin6I HinP1I HpaI Hpy99I HspAI KasI KpnI Ksp632I* MauBI MfeI MstI* NarI NheI NotI NruI NspBII* PacI PasI PflMI PfoI PmaCI PmeI PpiI PshAI PspOMI PspXI PsrI PstI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI TsoI TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769