Restriction Map of CAF40/YNL288W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CAF40/YNL288W on chromosome XIV from coordinates 90303 to 91424.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.12372

BsrDI | Cac8I | |TaqII | || Hpy166II | || | FatI PflMI | || | |CviAII BsiYI* | || | || NlaIII AciI |TstI | || | || | BsaXI | BsrBI CviJI |BsaXI | || | || | | TstI \ \ \ \\ \ \\ \ \\ \ \ \ ATGTTTTCCGCTCAAAAGCCAATATATGGCAATGGAGCAGGCGTGAACATGGGTGGTGGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAAAAGGCGAGTTTTCGGTTATATACCGTTACCTCGTCCGCACTTGTACCCACCACCA / / /// / // / / // / BsrBI | ||BsaXI | |Cac8I | | || BsaXI AciI | |BsiYI* | TaqII | | || TstI | |PflMI BsrDI | | |FatI | TstI | | CviAII CviJI | NlaIII Hpy166II M F S A Q K P I Y G N G A G V N M G G G C F P L K S Q Y M A M E Q A * T W V V V V F R S K A N I W Q W S R R E H G W W W ----:----|----:----|----:----|----:----|----:----|----:----| X N E A * F G I Y P L P A P T F M P P P X T K R E F A L I H C H L L R S C P H H H K G S L L W Y I A I S C A H V H T T T Hin4II* | PfoI | BssKI | EcoRII | | ScrFI | | BseBI | | | MboI | | | XhoII | | | | DpnI | | | | |BstKTI | | | | || BinI* | | | | || | FatI | | | | || | |CviAII | | | | || | || BssKI | | | | || | || EcoRII | | | | || | || NlaIII AsuI* | | | | || | || |SecI* AvaII | | | | || | || ||ScrFI |NlaIV AsuI* | | | | || | || ||BseBI |BmgT120I AvaII | | | | || | || ||BsiYI* ||BssKI |BmgT120I | | | | || | || ||| NlaIV ||EcoRII \\ \ \ \ \ \\ \ \\ \\\ \ \\\ GGTCCTTCAACTAATAATCCAGGATCTATGTCCATGCCTGGGGTTCCAACTTCAATGGGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGGAAGTTGATTATTAGGTCCTAGATACAGGTACGGACCCCAAGGTTGAAGTTACCCA // / / // / // // / / / // |AvaII Hin4II* | || | || || | | NlaIV |BmgT120I |AsuI* | || | || || | EcoRII NlaIV BmgT120I | || | || || | BssKI | || | || || | SecI* | || | || || BseBI | || | || || ScrFI | || | || |FatI | || | || BsiYI* | || | || CviAII | || | |NlaIII | || | BinI* | || XhoII | || MboI | |DpnI | EcoRII | BstKTI | BssKI | PfoI BseBI ScrFI G P S T N N P G S M S M P G V P T S M G V L Q L I I Q D L C P C L G F Q L Q W V S F N * * S R I Y V H A W G S N F N G S ----:----|----:----|----:----|----:----|----:----|----:----| P G E V L L G P D I D M G P T G V E I P H D K L * Y D L I * T W A Q P E L K L P T R * S I I W S R H G H R P N W S * H T ApoI TspEI | MnlI | TspDTI | | BsiYI* | | | AsuI* | | | DraII | | | |CviJI ScrFI | | | |HaeIII BseBI | | | |BmgT120I | FatI | | | ||NlaIV | |CviAII | | | ||| FatI | || TfiI | | | ||| |CviAII | || HinfI | | | ||| || NlaIII | || NlaIII | | | ||| || |MslI | || |MmeI | | | ||| || || BstXI Hpy188I \ \\ \\ \ \ \ \\\ \\ \\ \ \ CCAGGCATGAATCAACAAATTCCAAGTGGAGGCCCCATGCTAATGGGCAATACTCCGAAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCCGTACTTAGTTGTTTAAGGTTCACCTCCGGGGTACGATTACCCGTTATGAGGCTTA / / / // / // / //// /// / | | | || HinfI || BsiYI* |||| ||MslI Hpy188I | | | || TfiI |TspEI |||| |FatI | | | |FatI |ApoI |||| CviAII | | | CviAII |MnlI |||| BstXI | | | MmeI TspDTI |||NlaIII | | EcoRII ||DraII | | NlaIII ||AsuI* | | BssKI |BmgT120I | BseBI |NlaIV | ScrFI HaeIII AvaII CviJI AsuI* P G M N Q Q I P S G G P M L M G N T P N Q A * I N K F Q V E A P C * W A I L R I R H E S T N S K W R P H A N G Q Y S E * ----:----|----:----|----:----|----:----|----:----|----:----| G P M F * C I G L P P G M S I P L V G F D L C S D V F E L H L G W A L P C Y E S W A H I L L N W T S A G H * H A I S R I BceAI | MwoI | |SfaNI | || AciI | || | MaeIII BsrDI TspDTI MwoI | || | | BceAI \ \ \ \ \\ \ \ \ AATAATAATAGCAATGAAAATGGCGAGAACAACGGCAATAACGGCAATAACGGCGGTAAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTATTATCGTTACTTTTACCGCTCTTGTTGCCGTTATTGCCGTTATTGCCGCCATTG / / / / / / // BsrDI TspDTI MwoI | | | |MaeIII | | | BceAI | | SfaNI | | AciI | BceAI MwoI N N N S N E N G E N N G N N G N N G G N I I I A M K M A R T T A I T A I T A V T * * * Q * K W R E Q R Q * R Q * R R * R ----:----|----:----|----:----|----:----|----:----|----:----| L L L L L S F P S F L P L L P L L P P L Y Y Y Y C H F H R S C R C Y R C Y R R Y I I I A I F I A L V V A I V A I V A T V FatI CviRI* |MwoI |CviAII |BstAPI ||BtsI ||Cac8I ||TspRI FatI ||| SphI |CviAII Hin6I ||| NspI || NlaIII |GlaI ||| NlaIII BceAI TaqI || | MnlI ||HhaI ||| | XbaI \ \ \\ \ \ \\\ \\\ \ \ GATGCTAACGCAACTCGAAACAATCCCAACATGGTCAATAATAGAGGCGCAGTGCATGCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTACGATTGCGTTGAGCTTTGTTAGGGTTGTACCAGTTATTATCTCCGCGTCACGTACGA / / / // / /// / / /// BceAI TaqI | || MnlI ||| | | ||FatI | |FatI ||| | | |CviAII | CviAII ||| | | Cac8I NlaIII ||| | CviRI* ||| | NlaIII ||| | BtsI ||| | NspI ||| | SphI ||| BstAPI ||| MwoI ||Hin6I |GlaI TspRI HhaI D A N A T R N N P N M V N N R G A V H A M L T Q L E T I P T W S I I E A Q C M L C * R N S K Q S Q H G Q * * R R S A C S ----:----|----:----|----:----|----:----|----:----|----:----| S A L A V R F L G L M T L L L P A T C A R H * R L E F C D W C P * Y Y L R L A H I S V C S S V I G V H D I I S A C H M S SetI | CspCI | |AsuI* | ||CviJI MaeI | ||HaeIII BinI* | ||BmgT120I Hpy178III* | ||| FalI | MboI | ||| FalI | | DpnI AccI | ||| |BsiYI* | | |BstKTI |BssNAI BsrI MfeI | ||| || MnlI | | ||CspCI |Hpy166II TspRI TspEI | ||| || |BceAI \ \ \\\ \\ \ \ \ \\\ \\ \\ CTAGATGATCCCAATGTATACCACTGGATTTGTCAATTGACCTACGGCCCTCAAAAGGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GATCTACTAGGGTTACATATGGTGACCTAAACAGTTAACTGGATGCCGGGAGTTTTCCTT /// // / // / // / /// / / ||| || MboI |TspRI BsrI || | ||| BsiYI* MnlI ||| |CspCI |AccI || | ||AsuI* ||| |DpnI Hpy166II || | |BmgT120I ||| BstKTI BssNAI || | |FalI ||XbaI || | |FalI |Hpy178III* || | HaeIII |MaeI || | CviJI BinI* || CspCI |SetI TspEI MfeI L D D P N V Y H W I C Q L T Y G P Q K E * M I P M Y T T G F V N * P T A L K R N R * S Q C I P L D L S I D L R P S K G T ----:----|----:----|----:----|----:----|----:----|----:----| R S S G L T Y W Q I Q * N V * P G * F S E L H D W H I G S S K D I S R R G E F P * I I G I Y V V P N T L Q G V A R L L F SetI TspRI | FalI BceAI MboII BtsI | TspEI | FalI |Tsp4CI* SetI BbvII* \ \ \ \ \ \\ \ \ CAAGCACTGCTTGAATTAGGTCGCAAAAGAGAACAGTTTGATGACCTTGCCGTTGTGCTT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCGTGACGAACTTAATCCAGCGTTTTCTCTTGTCAAACTACTGGAACGGCAACACGAA / / / / / / / / BceAI | FalI | BceAI SetI | BbvII* TspRI | FalI Tsp4CI* MboII BtsI TspEI SetI Q A L L E L G R K R E Q F D D L A V V L K H C L N * V A K E N S L M T L P L C F S T A * I R S Q K R T V * * P C R C A L ----:----|----:----|----:----|----:----|----:----|----:----| C A S S S N P R L L S C N S S R A T T S V L V A Q I L D C F L V T Q H G Q R Q A L C Q K F * T A F S F L K I V K G N H K BdaI BdaI BdaI |FatI BdaI ||CviAII | SetI MnlI ||| TseI | BsrDI | TspGWI BbvI ||| NlaIII \ \ \ \ \ \\\ \ TGGTCTTCCTTTGGTGTAATGACCTCATTGCTGAACGAAATCATTTCCGTATATCCCATG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| ACCAGAAGGAAACCACATTACTGGAGTAACGACTTGCTTTAGTAAAGGCATATAGGGTAC / / / / / / / / // | | BsrDI | TspGWI | | | |FatI | SetI MnlI | | | CviAII BdaI | | NlaIII BdaI | BdaI | BdaI BbvI W S S F G V M T S L L N E I I S V Y P M G L P L V * * P H C * T K S F P Y I P C V F L W C N D L I A E R N H F R I S H A ----:----|----:----|----:----|----:----|----:----|----:----| Q D E K P T I V E N S F S I M E T Y G M K T K R Q H L S R M A S R F * K R I D W P R G K T Y H G * Q Q V F D N G Y I G H BisI |BlsI |SfaNI ||CviRI* ||| DdeI ||| |SetI ||| || Hpy188I ||| || | MnlI CviRI* ||| || | | BspCNI | MboII ||| || | | |BseMII | | MaeI \\\ \\ \ \ \\ \ \ \ CTGCAACCTCAGATGCTCTCTAACAATCTATCAAATCGTGTATGCAACGCTCTAGTTCTT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GACGTTGGAGTCTACGAGAGATTGTTAGATAGTTTAGCACATACGTTGCGAGATCAAGAA /// // // / // / / / ||| || |DdeI | |BseMII | MboII MaeI ||| || | | BspCNI CviRI* ||| || | MnlI ||| || Hpy188I ||| |SfaNI ||| SetI ||CviRI* ||TseI |BisI BlsI L Q P Q M L S N N L S N R V C N A L V L C N L R C S L T I Y Q I V Y A T L * F F A T S D A L * Q S I K S C M Q R S S S S ----:----|----:----|----:----|----:----|----:----|----:----| S C G * I S E L L R D F R T H L A R T R A A V E S A R * C D I L D H I C R E L E Q L R L H E R V I * * I T Y A V S * N K SfeI* | Tsp4CI* | | HphI | | TspRI AsuI* | | | CviRI* |CviJI | | | | Hin4I |HaeIII | | | | Hin4I |BmgT120I | | | | |BsmAI ||Hin4I | | | | || SfaNI TaqII ||Hin4I \ \ \ \ \\ \ \ \\\ CTACAGTGTGTTGCATCTCACCCAGAGACAAAACATCTCTTTTTACAGGCCCATATTCCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GATGTCACACAACGTAGAGTGGGTCTCTGTTTTGTAGAGAAAAATGTCCGGGTATAAGGA / // / / / / / / /// | || | CviRI* | SfaNI TaqII | ||AsuI* | || | Hin4I BsmAI | |BmgT120I | || | Hin4I | HaeIII | || HphI | CviJI | |SfeI* Hin4I | Tsp4CI* Hin4I TspRI L Q C V A S H P E T K H L F L Q A H I P Y S V L H L T Q R Q N I S F Y R P I F L T V C C I S P R D K T S L F T G P Y S S ----:----|----:----|----:----|----:----|----:----|----:----| R C H T A D * G S V F C R K K C A W I G E V T H Q M E G L S L V D R K V P G Y E * L T N C R V W L C F M E K * L G M N R Hin4II* TatI | SetI |Csp6I | BssKI ||RsaI | EcoRII ||ScaI GsuI | | ScrFI ||| SmlI MnlI Eco57MI | | BseBI MnlI ||| | TspDTI \ \ \ \ \ \ \\\ \ \ CTCTTTCTTTTCCCCTTCCTAAATACTACCTCCAGGCAAAGAACTTTTGAGTACTTGAGA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GAGAAAGAAAAGGGGAAGGATTTATGATGGAGGTCCGTTTCTTGAAAACTCATGAACTCT / / / / / / / /// / MnlI Eco57MI | SetI | | MnlI ||| SmlI GsuI Hin4II* | EcoRII ||TspDTI | BssKI ||TatI BseBI |Csp6I ScrFI ScaI RsaI L F L F P F L N T T S R Q R T F E Y L R S F F S P S * I L P P G K E L L S T * D L S F P L P K Y Y L Q A K N F * V L E I ----:----|----:----|----:----|----:----|----:----|----:----| R K R K G K R F V V E L C L V K S Y K L E R E K G R G L Y * R W A F F K Q T S S E K K E G E * I S G G P L S S K L V Q S Hin6I MaeII SetI |GlaI MlyI | SetI AclI Bce83I* ||HhaI PleI HinfI | TaiI MaeII \ \\\ \ \ \ \ \ TTGACTTCATTAGGTGTGATAGGCGCATTGGTCAAAAATGACTCACAAGACGTAATAACG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AACTGAAGTAATCCACACTATCCGCGTAACCAGTTTTTACTGAGTGTTCTGCATTATTGC / / /// // / / / / / | Bce83I* ||Hin6I |PleI HinfI | | | MaeII SetI |GlaI MlyI | | | AclI HhaI | | TaiI | | SetI | MaeII TaiI SetI L T S L G V I G A L V K N D S Q D V I T * L H * V * * A H W S K M T H K T * * R D F I R C D R R I G Q K * L T R R N N V ----:----|----:----|----:----|----:----|----:----|----:----| N V E N P T I P A N T L F S E C S T I V I S K M L H S L R M P * F H S V L R L L Q S * * T H Y A C Q D F I V * L V Y Y R DdeI SauI* | MboI | | DpnI | | |FatI | | |MboII | | |BstKTI | | ||CviAII | | ||| MboII | | ||| |NlaIII | | ||| ||TfiI | | ||| ||HinfI DdeI | | ||| ||BinI* |Hpy188I SetI DdeI | | ||| |||BseMII || AluI TaiI | BceAI EcoRV | | ||| ||||BspCNI || CviJI \ \ \ \ \ \ \\\ \\\\\ \\ \ TTTTTGCTAAGAACCGATATCGTGCCGTTATGCCTAAGGATCATGGAATCTTCTTCTGAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAACGATTCTTGGCTATAGCACGGCAATACGGATTCCTAGTACCTTAGAAGAAGACTC // / / ///////// / / /// |BceAI EcoRV | ||||||||| HinfI | ||CviJI DdeI | ||||||||| TfiI | ||AluI | ||||||||BinI* | |DdeI | |||||||BspCNI | SetI | ||||||BseMII Hpy188I | ||||||FatI | |||||CviAII | ||||MboII | |||MboI | ||NlaIII | |MboII | |DpnI | BstKTI SauI* DdeI F L L R T D I V P L C L R I M E S S S E F C * E P I S C R Y A * G S W N L L L S F A K N R Y R A V M P K D H G I F F * A ----:----|----:----|----:----|----:----|----:----|----:----| N K S L V S I T G N H R L I M S D E E S T K A L F R Y R A T I G L S * P I K K Q K Q * S G I D H R * A * P D H F R R R L MaeII TspDTI | SetI SetI Tsp4CI* MmeI MaeI | TaiI CviRI* \ \ \ \ \ \ \ CTTTCCAAGACAGTCGCCATTTTCATTTTACAGAAAATCCTACTAGATGACGTTGGATTG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAGGTTCTGTCAGCGGTAAAAGTAAAATGTCTTTTAGGATGATCTACTGCAACCTAAC // / / / / / |Tsp4CI* MmeI | | MaeII CviRI* TspDTI | TaiI | SetI MaeI L S K T V A I F I L Q K I L L D D V G L F P R Q S P F S F Y R K S Y * M T L D C F Q D S R H F H F T E N P T R * R W I A ----:----|----:----|----:----|----:----|----:----|----:----| S E L V T A M K M K C F I R S S S T P N A K W S L R W K * K V S F G V L H R Q I K G L C D G N E N * L F D * * I V N S Q StyI SecI* | SetI | BceAI | | EcoNI | | | BsiYI* | | | | SetI MaeIII MseI \ \ \ \ \ \ \ CAATACATCTGTGCCACCTTGGAAAGGTTCTACGCCGTAACTAATGTCTTAAAAGATATG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GTTATGTAGACACGGTGGAACCTTTCCAAGATGCGGCATTGATTACAGAATTTTCTATAC / /// / / / SetI ||| SetI MaeIII MseI ||EcoNI |SecI* |BceAI |StyI BsiYI* Q Y I C A T L E R F Y A V T N V L K D M N T S V P P W K G S T P * L M S * K I W I H L C H L G K V L R R N * C L K R Y G ----:----|----:----|----:----|----:----|----:----|----:----| C Y M Q A V K S L N * A T V L T K F S I A I C R H W R P F T R R R L * H R L L Y L V D T G G Q F P E V G Y S I D * F I H Tsp4CI* | SduI | HgiAI* | | BssKI | | |HpaII | | ||ScrFI | | ||CauII* SduI | | |||BdaI BslFI HgiAI* | | |||BdaI | SfaNI \ \ \ \\\\ \ \ GTTGAGCACTTGACCGTGAGCACACCACCGGGACGACTACTGAAACATATCATTAGATGC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTCGTGAACTGGCACTCGTGTGGTGGCCCTGCTGATGACTTTGTATAGTAATCTACG / / / / / / / / HgiAI* | HgiAI* | | BssKI | SfaNI SduI | SduI | CauII* BslFI Tsp4CI* | HpaII | ScrFI BdaI BdaI V E H L T V S T P P G R L L K H I I R C L S T * P * A H H R D D Y * N I S L D A * A L D R E H T T G T T T E T Y H * M L ----:----|----:----|----:----|----:----|----:----|----:----| T S C K V T L V G G P R S S F C I M L H P Q A S S R S C V V P V V V S V Y * * I N L V Q G H A C W R S S * Q F M D N S A MboI |Hpy99I ||DpnI SmlI |||BstKTI AflII ||||Hpy178III* |MseI ||||| Cac8I BseMII |BdaI ||||| | Cac8I |BspCNI |BdaI MseI |||||TaqI | | CviJI ||SetI \\ \ \\\\\\ \ \ \ \\\ TACTTAAGATTAAGCGACGATCTCGAAGCACGCAGGCTATTGAAAATAGTCTTACCTGCC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAATTCTAATTCGCTGCTAGAGCTTCGTGCGTCCGATAACTTTTATCAGAATGGACGG / // / / // / // / / / // | || | | || | |TaqI | | CviJI |BspCNI | || | | || | | | Cac8I BseMII | || | | || | | Cac8I SetI | || | | || | Hpy178III* | || | | || MboI | || | | |DpnI | || | | BstKTI | || | Hpy99I | || MseI | |AflII | |SmlI | MseI BdaI BdaI Y L R L S D D L E A R R L L K I V L P A T * D * A T I S K H A G Y * K * S Y L P L K I K R R S R S T Q A I E N S L T C Q ----:----|----:----|----:----|----:----|----:----|----:----| * K L N L S S R S A R L S N F I T K G A S S L I L R R D R L V C A I S F L R V Q V * S * A V I E F C A P * Q F Y D * R G TspGWI | Tth111I | |AcyI | |MaeII | ||ZraI Hin4I | |||Hpy99I |TatI | ||||SetI ||Csp6I | ||||TaiI |||RsaI | ||||AatII |||ScaI | |||||Eam1105I |||Esp3I | ||||||Hpy99I |||BsmAI | |||||||AsuI* |||| DdeI | |||||||AvaII BspMI |||| Hin4I | ||||||||NlaIV XcmI |DdeI |||| Hin4I | ||||||||BmgT120I |Hin4I \\ \\\\ \ \ \\\\\\\\\ \\ AAACTGAGAGATAACACTTTTACGGAAGTACTAAGAGACGACGTCGGGTCCAAGAGATGT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGACTCTCTATTGTGAAAATGCCTTCATGATTCTCTGCTGCAGCCCAGGTTCTCTACA / / / /// /// / ///// /// / / / BspMI | | ||| ||| | ||||| ||| | | Hin4I DdeI | | ||| ||| | ||||| ||| | | Hin4I | | ||| ||| | ||||| ||| | XcmI | | ||| ||| | ||||| ||| Hin4I | | ||| ||| | ||||| ||AvaII | | ||| ||| | ||||| ||AsuI* | | ||| ||| | ||||| |BmgT120I | | ||| ||| | ||||| NlaIV | | ||| ||| | ||||Eam1105I | | ||| ||| | |||MaeII | | ||| ||| | |||AcyI | | ||| ||| | ||ZraI | | ||| ||| | |Tth111I | | ||| ||| | |Hpy99I | | ||| ||| | AatII | | ||| ||| | TaiI | | ||| ||| | SetI | | ||| ||| Hpy99I | | ||| ||TspGWI | | ||| |DdeI | | ||| BsmAI | | ||| Esp3I | | ||TatI | | |Csp6I | | ScaI | | RsaI | Hin4I | Hin4I Hin4I K L R D N T F T E V L R D D V G S K R C N * E I T L L R K Y * E T T S G P R D V T E R * H F Y G S T K R R R R V Q E M S ----:----|----:----|----:----|----:----|----:----|----:----| L S L S L V K V S T S L S S T P D L L H W V S L Y C K * P L V L L R R R T W S I F Q S I V S K R F Y * S V V D P G L S T FatI SetI BspHI Hin4I |CviAII Hin4I |Hpy178III* | MfeI || MboII | TspEI MseI || |NlaIII \ \ \ \\ \\ CTGGCACAATTGCTACTGACATTAAACGAAGAAACCTCATGA 1090 1100 1110 1120 ----:----|----:----|----:----|----:----|-- GACCGTGTTAACGATGACTGTAATTTGCTTCTTTGGAGTACT / / / / /// TspEI MseI | | ||BspHI MfeI | | ||FatI | | |Hpy178III* | | |CviAII | | MboII | NlaIII SetI L A Q L L L T L N E E T S * W H N C Y * H * T K K P H X G T I A T D I K R R N L M X ----:----|----:----|----:----|----:----|-- R A C N S S V N F S S V E H D P V I A V S M L R L F R M Q C L Q * Q C * V F F G * S # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 1 FblI,XmiI AciI 2 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AluI 1 AluBI ApoI 1 AcsI,XapI AsuI* 6 Cfr13I,PspPI,Sau96I,AspS9I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI Bce83I* 1 BpuEI BceAI 7 BdaI 4 BinI* 3 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 6 BsaXI 1 BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseMII 3 BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BspCNI 3 BspHI 1 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrBI 1 AccBSI,MbiI BsrDI 3 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 1 BstKTI 4 BstXI 1 BtsI 2 Cac8I 4 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Csp6I 2 CviQI,RsaNI CspCI 1 CviAII 9 CviJI 6 CviKI-1 CviRI* 5 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 4 MalI DraII 1 EcoO109I Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco57MI 1 EcoNI 1 BstENI,XagI EcoRII 4 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 1 BsmBI FalI 2 FatI 9 GlaI 2 GsuI 1 BpmI HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 2 HpyAV Hin6I 2 HinP1I,HspAI HinfI 3 HpaII 1 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 3 Hpy99I 3 MaeI 3 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 2 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MfeI 2 MunI MlyI 1 SchI MmeI 2 MnlI 7 MseI 4 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PfoI 1 PleI 1 PpsI RsaI 2 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 2 BmcAI,AssI,ZrmI ScrFI 5 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 16 SfaNI 4 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 2 SmoI SphI 1 PaeI,BbuI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 2 TaqII 2 TatI 2 TfiI 2 PfeI TseI 1 ApeKI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 4 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 4 TscAI TstI 1 Tth111I 1 PflFI,PsyI,AspI XbaI 1 XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BccI BcgI BciVI BclI BetI* BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BseGI BsePI BseRI BseSI BseYI BsgI BsiI* BsmI Bsp120I Bsp1407I BspLU11I* BspMII* BspOI BstEII BstF5I BtgZI BtrI BtsCI Cfr10I Cfr9I CfrI ClaI DinI DraIII DrdI DsaI* EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoP15I EcoRI EcoT22I EgeI EheI EspI* FauI FnuDII* FokI FseI FspAI GsaI HaeII HgaI HgiCI* HgiJII* HindII HindIII HpaI KasI KpnI Ksp632I* MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TauI TsoI Tsp45I TspMI VspI XhoI XmaCI XmaI XmaIII* XmnI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769