Restriction Map of MET2/YNL277W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

MET2/YNL277W on chromosome XIV from coordinates 117349 to 118809.


MwoI | AluI | CviJI | PflMI MseI | BsiYI* |AhaIII* | | SetI || TaqI | | |MnlI MseI \\ \ \ \ \\ \ ATGTCGCATACTTTAAAATCGAAAACGCTCCAAGAGCTGGACATTGAGGAGATTAAGGAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGCGTATGAAATTTTAGCTTTTGCGAGGTTCTCGACCTGTAACTCCTCTAATTCCTT // / / // / / / / |MseI TaqI | || | MnlI | BseRI AhaIII* | || CviJI MseI | || AluI | |SetI | BsiYI* | PflMI MwoI M S H T L K S K T L Q E L D I E E I K E C R I L * N R K R S K S W T L R R L R K V A Y F K I E N A P R A G H * G D * G N ----:----|----:----|----:----|----:----|----:----|----:----| X D C V K F D F V S W S S S M S S I L S X T A Y K L I S F A G L A P C Q P S * P H R M S * F R F R E L L Q V N L L N L F BetI* BspMII* |HpaII |Hpy178III* SpeI || SpeI BseRI BsrDI |MaeI MnlI || |MaeI \ \ \\ \ \\ \\ ACTAACCCATTGCTCAAACTAGTTCAAGGGCAGAGGATTGTTCAAGTTCCGGAACTAGTG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TGATTGGGTAACGAGTTTGATCAAGTTCCCGTCTCCTAACAAGTTCAAGGCCTTGATCAC / // / // // BsrDI || MnlI || |SpeI |SpeI || MaeI MaeI |BspMII* |BetI* Hpy178III* HpaII T N P L L K L V Q G Q R I V Q V P E L V L T H C S N * F K G R G L F K F R N * C * P I A Q T S S R A E D C S S S G T S A ----:----|----:----|----:----|----:----|----:----|----:----| V L G N S L S T * P C L I T * T G S S T F * G M A * V L E L A S S Q E L E P V L S V W Q E F * N L P L P N N L N R F * H MaeII |BtrI || SetI || TaiI || | Csp6I SmlI PleI Bce83I* || | |RsaI | HinfI |MlyI | TspEI PsiI || | ||Hpy166II \ \ \\ \ \ \ \\ \ \\\ CTTGAGTCTGGCGTGGTCATAAATAATTTCCCTATTGCTTATAAGACGTGGGGTACACTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTCAGACCGCACCAGTATTTATTAAAGGGATAACGAATATTCTGCACCCCATGTGAC / / / / / / / // /// | HinfI PleI Bce83I* TspEI | | || ||Hpy166II SmlI MlyI | | || ||Csp6I | | || |RsaI | | || TspRI | | |MaeII | | BtrI | TaiI | SetI PsiI L E S G V V I N N F P I A Y K T W G T L L S L A W S * I I S L L L I R R G V H * * V W R G H K * F P Y C L * D V G Y T E ----:----|----:----|----:----|----:----|----:----|----:----| S S D P T T M F L K G I A * L V H P V S A Q T Q R P * L Y N G * Q K Y S T P Y V K L R A H D Y I I E R N S I L R P T C Q BsiYI* |Tth111I || AsuI* || AvaII || |BsrI TspRI || |NlaIV | AluI TspDTI FatI || |BmgT120I | CviJI | HphI |CviAII || || AciI MwoI | | SetI | | TspEI || NlaIII || || | BfiI BstAPI \ \ \ \ \ \ \\ \ \\ \\ \ \ \ AATGAAGCTGGTGATAATGTTCTGGTAATTTGTCATGCCTTGACTGGGTCCGCAGATGTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTCGACCACTATTACAAGACCATTAAACAGTACGGAACTGACCCAGGCGTCTACAA / / / / / / // / / /// / / | CviJI | HphI | | || | | ||| | BstAPI | AluI TspDTI | | || | | ||| | MwoI SetI | | || | | ||| BfiI | | || | | ||| AciI | | || | | ||AvaII | | || | | ||AsuI* | | || | | |BmgT120I | | || | | NlaIV | | || | Tth111I | | || | BsrI | | || BsiYI* | | |FatI | | CviAII | NlaIII TspEI N E A G D N V L V I C H A L T G S A D V M K L V I M F W * F V M P * L G P Q M L * S W * * C S G N L S C L D W V R R C C ----:----|----:----|----:----|----:----|----:----|----:----| F S A P S L T R T I Q * A K V P D A S T S H L Q H Y H E P L K D H R S Q T R L H I F S T I I N Q Y N T M G Q S P G C I N BsrI MboII | AsuI* | DraII | Bsp120I | |AsuI* | |DraII | |NlaIV | |BmgT120I | ||CviJI | ||NlaIV | ||HaeIII | ||BmgT120I | ||| ApaI | ||| SduI | ||| BseSI | ||| HgiJII* | ||| | BsiYI* | ||| | |BsiYI* | ||| | ||Ksp632I* DdeI | ||| | ||| MaeIII | BsmI BccI | ||| | ||| |MnlI | | TaqI |SetI \ \\\ \ \\\ \\ \ \ \ \\ GCTGACTGGTGGGGCCCTCTTCTGGGTAACGACTTAGCATTCGACCCATCAAGGTTTTTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTGACCACCCCGGGAGAAGACCCATTGCTGAATCGTAAGCTGGGTAGTTCCAAAAAA // ///// // // / // / / / || ||||| || || | |DdeI TaqI | BccI || ||||| || || | BsmI SetI || ||||| || || MaeIII || ||||| || |Ksp632I* || ||||| || MnlI || ||||| |BsiYI* || ||||| BsiYI* || ||||Bsp120I || ||||DraII || ||||AsuI* || |||BmgT120I || |||DraII || |||AsuI* || ||BmgT120I || ||HaeIII || ||NlaIV || ||CviJI || |NlaIV || HgiJII* || BseSI || SduI || ApaI |MboII BsrI A D W W G P L L G N D L A F D P S R F F L T G G A L F W V T T * H S T H Q G F L * L V G P S S G * R L S I R P I K V F Y ----:----|----:----|----:----|----:----|----:----|----:----| A S Q H P G R R P L S K A N S G D L N K Q Q S T P G E E P Y R S L M R G M L T K S V P P A R K Q T V V * C E V W * P K K CviJI MseI | SduI MnlI |PmeI | HgiJII* | Esp3I NdeI |AhaIII* | | NdeI MseI | BsmAI \ \\ \ \ \ \ \ \ ATCATATGTTTAAACTCTATGGGCTCTCCATATGGGTCTTTTTCGCCATTAACGATAAAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTATACAAATTTGAGATACCCGAGAGGTATACCCAGAAAAAGCGGTAATTGCTATTTA / // / / / / / NdeI |MseI | CviJI NdeI | MnlI AhaIII* HgiJII* MseI PmeI SduI I I C L N S M G S P Y G S F S P L T I N S Y V * T L W A L H M G L F R H * R * M H M F K L Y G L S I W V F F A I N D K * ----:----|----:----|----:----|----:----|----:----|----:----| I M H K F E I P E G Y P D K E G N V I F * * I N L S * P S E M H T K K A M L S L D Y T * V R H A R W I P R K R W * R Y I TatI |Csp6I ||RsaI ||| Tsp4CI* AsuI* ||| | Hin6I AvaII ||| | |GlaI |BmgT120I ||| | ||HhaI ||NlaIV ||| | ||FnuDII* ||| ApoI ||| | ||| MaeII ||| TspEI ||| | ||| | SetI BseRI ||| EcoRI ||| | ||| | TaiI \ \\\ \ \\\ \ \\\ \ \ GAGGAGACGGGCGTTAGATATGGACCCGAATTCCCATTATGTACTGTGCGCGATGACGTT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTCTGCCCGCAATCTATACCTGGGCTTAAGGGTAATACATGACACGCGCTACTGCAA / / // / /// /// / / BsmAI BseRI |AvaII EcoRI ||| ||| | MaeII Esp3I |AsuI* TspEI ||| ||| TaiI | ApoI ||| ||| SetI BmgT120I ||| ||FnuDII* NlaIV ||| ||Hin6I ||| |GlaI ||| HhaI ||Tsp4CI* ||TatI |Csp6I RsaI E E T G V R Y G P E F P L C T V R D D V R R R A L D M D P N S H Y V L C A M T L G D G R * I W T R I P I M Y C A R * R * ----:----|----:----|----:----|----:----|----:----|----:----| S S V P T L Y P G S N G N H V T R S S T H P S P R * I H V R I G M I Y Q A R H R L L R A N S I S G F E W * T S H A I V N AluI CviJI Ecl136II |BtgZI ||SetI ||SduI ||SacI ||HgiAI* Hpy178III* ||HgiJII* | TfiI ||| TspEI | HinfI CviJI \\\ \ \ \ \ AGAGCTCACAGAATTGTTCTGGATTCTCTGGGAGTAAAGTCAATAGCCTGTGTTATTGGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCGAGTGTCTTAACAAGACCTAAGAGACCCTCATTTCAGTTATCGGACACAATAACCA / / / / / / / | | BtgZI TspEI | HinfI CviJI | Ecl136II | TfiI | CviJI Hpy178III* | AluI HgiJII* HgiAI* SacI SduI SetI R A H R I V L D S L G V K S I A C V I G E L T E L F W I L W E * S Q * P V L L V S S Q N C S G F S G S K V N S L C Y W W ----:----|----:----|----:----|----:----|----:----|----:----| L A * L I T R S E R P T F D I A Q T I P * L E C F Q E P N E P L L T L L R H * Q S S V S N N Q I R Q S Y L * Y G T N N T TseI CviJI |BisI CviJI ||BlsI | SfaNI DdeI ||| FatI | | BseMII |BseGI ||| |CviAII | | |BspCNI ||BbvI FokI ||| || NlaIII \ \ \\ \\\ \ \\\ \\ \ GGCTCTATGGGGGGGATGCTGAGTTTGGAATGGGCTGCCATGTATGGTAAGGAATATGTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CCGAGATACCCCCCCTACGACTCAAACCTTACCCGACGGTACATACCATTCCTTATACAC / // / / / / ///// // CviJI |BspCNI | | BbvI | ||||| |FatI |SfaNI | DdeI | ||||| CviAII BseMII BseGI | ||||NlaIII | |||TseI | ||BisI | |BlsI | CviJI FokI G S M G G M L S L E W A A M Y G K E Y V A L W G G C * V W N G L P C M V R N M * L Y G G D A E F G M G C H V W * G I C E ----:----|----:----|----:----|----:----|----:----|----:----| P E I P P I S L K S H A A M Y P L S Y T H S * P P S A S N P I P Q W T H Y P I H A R H P P H Q T Q F P S G H I T L F I H BssKI EcoRII | ScrFI | BseBI | | CviRI* | | | BseMII | | | |BspCNI DdeI MboII MwoI | | | || MnlI |Hpy188I \ \ \ \ \ \\ \ \\ AAGAATATGGTTGCTCTGGCGACATCAGCAAGACATTCTGCCTGGTGCATATCGTGGTCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTATACCAACGAGACCGCTGTAGTCGTTCTGTAAGACGGACCACGTATAGCACCAGA / / / / /// / / MboII MwoI | | ||| MnlI Hpy188I | | ||BspCNI | | |BseMII | | CviRI* | EcoRII | BssKI BseBI ScrFI K N M V A L A T S A R H S A W C I S W S R I W L L W R H Q Q D I L P G A Y R G L E Y G C S G D I S K T F C L V H I V V * ----:----|----:----|----:----|----:----|----:----|----:----| F F I T A R A V D A L C E A Q H M D H D S S Y P Q E P S M L L V N Q R T C I T T L I H N S Q R C * C S M R G P A Y R P R BinI* | DdeI | | MboI | | XhoII | | Hpy188I BspCNI MnlI TaqI | | | DpnI |BseMII Csp6I BetI* CviJI ClaI | | | |BstKTI ||BstXI |RsaI |HpaII \ \ \ \ \ \\ \\\ \\ \\ GAGGCTCAAAGACAATCGATTTACTCAGATCCCAACTACTTGGACGGGTACTATCCGGTA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCGAGTTTCTGTTAGCTAAATGAGTCTAGGGTTGATGAACCTGCCCATGATAGGCCAT / / / / //// / // // / // | CviJI ClaI | |||| | |BseMII || | |BetI* DdeI TaqI | |||| | BspCNI || | HpaII | |||| | BstXI || MnlI | |||| XhoII |Csp6I | |||| MboI RsaI | |||DpnI | ||BstKTI | |DdeI | Hpy188I BinI* E A Q R Q S I Y S D P N Y L D G Y Y P V R L K D N R F T Q I P T T W T G T I R * G S K T I D L L R S Q L L G R V L S G R ----:----|----:----|----:----|----:----|----:----|----:----| S A * L C D I * E S G L * K S P Y * G T Q P E F V I S K S L D W S S P R T S D P L S L S L R N V * I G V V Q V P V I R Y SetI TseI | BsgI CviJI | CfrI |BisI HindII | |BbvI ||BlsI Hpy166II | ||CviJI |||CviRI* | MaeII | ||BseRI |||| MaeII | | Csp6I | ||HaeIII |||| |BsaAI | | |RsaI | ||BsiYI* |||| || SetI | | |SetI | |||HpaII |||| || TaiI CviRI* | | |TaiI \ \\\\ \\\\ \\ \ \ \ \ \\ GAGGAGCAACCTGTGGCCGGACTATCGGCTGCACGTATGTCTGCATTGTTGACGTACAGG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTCGTTGGACACCGGCCTGATAGCCGACGTGCATACAGACGTAACAACTGCATGTCC / /// / // ///// // / // /// | ||| | |HpaII ||||| |MaeII CviRI* || ||Csp6I | ||| | |BbvI ||||| BsaAI || |RsaI | ||| | CfrI ||||TaiI || MaeII | ||| HaeIII ||||SetI |TaiI | ||| CviJI |||CviRI* |SetI | ||BseRI |||TseI Hpy166II | |BsiYI* ||BisI HindII | BsgI |BlsI SetI CviJI E E Q P V A G L S A A R M S A L L T Y R R S N L W P D Y R L H V C L H C * R T G G A T C G R T I G C T Y V C I V D V Q D ----:----|----:----|----:----|----:----|----:----|----:----| S S C G T A P S D A A R I D A N N V Y L L P A V Q P R V I P Q V Y T Q M T S T C L L L R H G S * R S C T H R C Q Q R V P AloI PpiI BsaXI Tsp4CI* Hpy178III* | GsuI | MboI | Eco57MI | BglII | | TaqI | XhoII | | |Hpy178III* | | DpnI | | || ApoI | | |BstKTI | | || XmnI | | || BsaXI | | || TspEI | | || | AloI Hin4II* | | || | FalI | | || | PpiI | FalI | | || | FalI | | || | | MboII | FalI \ \ \\ \ \ \ \ \\ \ \ \ \ \ ACAAGAAACAGTTTCGAGAACAAATTCTCCAGAAGATCTCCTTCAATAGCACAACAACAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTCTTTGTCAAAGCTCTTGTTTAAGAGGTCTTCTAGAGGAAGTTATCGTGTTGTTGTT / / // // / / / / //// / / / | | || || | | | | |||| MboII | FalI | | || || | | | | |||XhoII | FalI | | || || | | | | |||BglII Hin4II* | | || || | | | | |||MboI | | || || | | | | ||BsaXI | | || || | | | | ||PpiI | | || || | | | | ||AloI | | || || | | | | |DpnI | | || || | | | | BstKTI | | || || | | | Hpy178III* | | || || | | TspEI | | || || | | ApoI | | || || | XmnI | | || || FalI | | || || FalI | | || |Hpy178III* | | || TaqI | | |Eco57MI | | |GsuI | | Tsp4CI* | BsaXI PpiI AloI T R N S F E N K F S R R S P S I A Q Q Q Q E T V S R T N S P E D L L Q * H N N K K K Q F R E Q I L Q K I S F N S T T T K ----:----|----:----|----:----|----:----|----:----|----:----| V L F L K S F L N E L L D G E I A C C C S L F C N R S C I R W F I E K L L V V V C S V T E L V F E G S S R R * Y C L L L AluI CviJI | MnlI PsrI | SetI |BccI | | BsmAI BseRI |Tsp4CI* \ \ \ \ \\ AAAGCTCAAAGGGAGGAGACACGCAAACCATCTACTGTCAGCGAACACTCCCTACAAATC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCGAGTTTCCCTCCTCTGTGCGTTTGGTAGATGACAGTCGCTTGTGAGGGATGTTTAG / // / / / / / | |MnlI BsmAI | PsrI | BccI | CviJI BseRI Tsp4CI* | AluI SetI K A Q R E E T R K P S T V S E H S L Q I K L K G R R H A N H L L S A N T P Y K S S S K G G D T Q T I Y C Q R T L P T N P ----:----|----:----|----:----|----:----|----:----|----:----| F A * L S S V R L G D V T L S C E R C I F L E F P P S V C V M * Q * R V S G V F F S L P L L C A F W R S D A F V G * L D BcgI | BtgZI BccI | | CviJI | MslI | | | Cac8I | | PsrI | | | | BtsI Cac8I | | BstXI | | | | | MwoI TspRI |BccI BcgI \ \ \ \ \ \ \ \ \ \ \\ \ CACAATGATGGGTATAAAACAAAAGCCAGCACTGCCATCGCTGGCATTTCTGGGCAAAAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTTACTACCCATATTTTGTTTTCGGTCGTGACGGTAGCGACCGTAAAGACCCGTTTTT // / / / // / / / / || MslI BcgI | |MwoI | BccI BcgI SetI |BstXI | Cac8I Cac8I PsrI | TspRI BccI | BtsI CviJI BtgZI H N D G Y K T K A S T A I A G I S G Q K T M M G I K Q K P A L P S L A F L G K K Q * W V * N K S Q H C H R W H F W A K R ----:----|----:----|----:----|----:----|----:----|----:----| W L S P Y L V F A L V A M A P M E P C F G C H H T Y F L L W C Q W R Q C K Q A F V I I P I F C F G A S G D S A N R P L F TspDTI | SfaNI | | Hpy188I | | |TfiI | | |HinfI | | || MboII MboII | | || | ApoI Hpy166II | | || | TspEI | AciI | | || | EcoRI TaqI SetI BcgI | MboII | | || | | BcgI ClaI \ \ \ \ \ \ \\ \ \ \ \ GGTCAAAGCGTGGTGTCCACCGCATCTTCTTCGGATTCATTGAATTCTTCAACATCGATG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGTTTCGCACCACAGGTGGCGTAGAAGAAGCCTAAGTAACTTAAGAAGTTGTAGCTAC / // / / / / / / / / / BcgI || | | TspDTI | | HinfI | EcoRI ClaI || | AciI | | MboII | TspEI TaqI || MboII | | TfiI | ApoI |Hpy166II | SfaNI BcgI MboII Hpy188I G Q S V V S T A S S S D S L N S S T S M V K A W C P P H L L R I H * I L Q H R * S K R G V H R I F F G F I E F F N I D D ----:----|----:----|----:----|----:----|----:----|----:----| P * L T T D V A D E E S E N F E E V D I L D F R P T W R M K K P N M S N K L M S T L A H H G G C R R R I * Q I R * C R H CviJI | Cac8I | | Hin6I | | |BsgI | | |GlaI | | |MstI* | | ||HhaI | | ||| MaeII | | ||| | SetI MaeIII Hin4II* HphI | | ||| | TaiI \ \ \ \ \ \\\ \ \ ACTTCGGTAAGTTCTGTAACGGGTGAAGTGAAGGACATAAAGCCTGCGCAGACGTATTTT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGCCATTCAAGACATTGCCCACTTCACTTCCTGTATTTCGGACGCGTCTGCATAAAA / / / / ///// / / | Hin4II* HphI | ||||| | MaeII MaeIII | ||||| TaiI | ||||| SetI | ||||Hin6I | |||MstI* | |||GlaI | ||HhaI | |BsgI | Cac8I CviJI T S V S S V T G E V K D I K P A Q T Y F L R * V L * R V K * R T * S L R R R I F F G K F C N G * S E G H K A C A D V F F ----:----|----:----|----:----|----:----|----:----|----:----| V E T L E T V P S T F S M F G A C V Y K S K P L N Q L P H L S P C L A Q A S T N S R Y T R Y R T F H L V Y L R R L R I K Acc65I HgiCI* |Csp6I ||RsaI ||SetI ||NlaIV |||BssKI |||EcoRII ||||KpnI ||||SecI* |||||ScrFI SetI |||||BseBI |TaqI CviRI* |||||| TspDTI || AcyI | MaeIII |||||| | SduI || | Hpy99I | |MnlI |||||| | BseSI || | | MfeI | || SmlI |||||| | | Bce83I* || | | TspEI \ \\ \ \\\\\\ \ \ \ \\ \ \ \ TCTGCACAAAGTTACTTGAGGTACCAGGGCACAAAGTTCATCAATAGGTTCGACGCCAAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AGACGTGTTTCAATGAACTCCATGGTCCCGTGTTTCAAGTAGTTATCCAAGCTGCGGTTA / / / /// /////// / / / / / | MnlI | ||| ||||||| Bce83I* SetI | | AcyI CviRI* | ||| ||||||EcoRII | TaqI | ||| ||||||BssKI Hpy99I | ||| ||||||SecI* | ||| |||||BseSI | ||| |||||SduI | ||| ||||BseBI | ||| ||||ScrFI | ||| |||TspDTI | ||| ||HgiCI* | ||| ||Acc65I | ||| |Csp6I | ||| NlaIV | ||| RsaI | ||KpnI | |SmlI | SetI MaeIII S A Q S Y L R Y Q G T K F I N R F D A N L H K V T * G T R A Q S S S I G S T P I C T K L L E V P G H K V H Q * V R R Q L ----:----|----:----|----:----|----:----|----:----|----:----| E A C L * K L Y W P V F N M L L N S A L K Q V F N S S T G P C L T * * Y T R R W R C L T V Q P V L A C L E D I P E V G I AflIII | MaeII | |BccI | |BsaAI | || SetI | || TaiI HgaI | || BciVI MaeIII | || |Hpy166II BseMII | BsrDI | || || BsrI BsmAI |BspCNI \ \ \ \\ \\ \ \ \\ TGTTACATTGCCATCACACGTAAACTGGATACGCACGATTTGGCAAGAGACAGAGTAGAT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| ACAATGTAACGGTAGTGTGCATTTGACCTATGCGTGCTAAACCGTTCTCTGTCTCATCTA / / / / // / / / // | | MaeIII | || | BsrI BsmAI |BspCNI | | HgaI | || Hpy166II BseMII | BsrDI | |AflIII TspEI | |MaeII MfeI | |BciVI | |BccI | BsaAI TaiI SetI C Y I A I T R K L D T H D L A R D R V D V T L P S H V N W I R T I W Q E T E * M L H C H H T * T G Y A R F G K R Q S R * ----:----|----:----|----:----|----:----|----:----|----:----| Q * M A M V R L S S V C S K A L S L T S N N C Q W * V Y V P Y A R N P L L C L L T V N G D C T F Q I R V I Q C S V S Y I DdeI | FokI | | AsuI* | | AvaII | | DraII | | PpuMI MboI | | TspRI BclI | | |BmgT120I |BccI | | || FokI BccI ||DpnI MmeI MnlI | | ||SetI | BseGI | BseGI |||BstKTI | BccI Hpy188I \ \ \ \\\ \ \ \ \ \\\\ \ \ \ GACATCACTGAGGTCCTTTCTACCATCCAACAACCATCCCTGATCATCGGTATCCAATCT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTAGTGACTCCAGGAAAGATGGTAGGTTGTTGGTAGGGACTAGTAGCCATAGGTTAGA // // // / / / // / / // // |TspRI || |PpuMI | FokI BseGI || | MmeI || |BciVI MnlI || |DraII BseGI BccI || BclI || Hpy188I || |AvaII || MboI |BstXI || |AsuI* |BccI BccI || BmgT120I |DpnI || FokI BstKTI |DdeI SetI D I T E V L S T I Q Q P S L I I G I Q S T S L R S F L P S N N H P * S S V S N L H H * G P F Y H P T T I P D H R Y P I * ----:----|----:----|----:----|----:----|----:----|----:----| S M V S T R E V M W C G D R I M P I W D H C * Q P G K * W G V V M G S * R Y G I V D S L D K R G D L L W G Q D D T D L R Hpy188I | ApoI | TspEI CviJI BstXI Tsp4CI* | |BseMII |DdeI SduI BciVI | Hpy166II | ||BspCNI |EspI* HgiAI* TspEI \ \ \ \ \\\ \\ \ \ GATGGACTGTTCACATATTCAGAACAAGAATTTTTGGCTGAGCACATACCGAAGTCGCAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCTGACAAGTGTATAAGTCTTGTTCTTAAAAACCGACTCGTGTATGGCTTCAGCGTT / / / // / / // | Hpy166II | || | | |EspI* Tsp4CI* | || | | |DdeI | || | | HgiAI* | || | | SduI | || | CviJI | || TspEI | || ApoI | |BspCNI | BseMII Hpy188I D G L F T Y S E Q E F L A E H I P K S Q M D C S H I Q N K N F W L S T Y R S R N W T V H I F R T R I F G * A H T E V A I ----:----|----:----|----:----|----:----|----:----|----:----| S P S N V Y E S C S N K A S C M G F D C Q H V T * M N L V L I K P Q A C V S T A I S Q E C I * F L F K Q S L V Y R L R L TspEI | TfiI | HinfI | | Hin4II* Hin4II* | | | Hpy178III* | MseI | | | | SfaNI | | AluI | | | | | CviJI | | CviJI | | | | | HaeIII | | | SetI \ \ \ \ \ \ \ \ \ \ TTAGAAAAAATTGAATCTCCCGAAGGCCACGATGCCTTCCTATTGGAGTTTAAGCTGATA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTTTTTTAACTTAGAGGGCTTCCGGTGCTACGGAAGGATAACCTCAAATTCGACTAT / / // / // / / / TspEI | || | |HaeIII Hin4II* | CviJI | || | |CviJI | AluI | || | SfaNI MseI | || Hpy178III* SetI | |HinfI | |TfiI | Hin4II* TspEI L E K I E S P E G H D A F L L E F K L I * K K L N L P K A T M P S Y W S L S * * R K N * I S R R P R C L P I G V * A D K ----:----|----:----|----:----|----:----|----:----|----:----| N S F I S D G S P W S A K R N S N L S I I L F F Q I E R L G R H R G I P T * A S * F F N F R G F A V I G E * Q L K L Q Y AciI TatI CviRI* BisI |Csp6I | SfaNI |BlsI ||RsaI MseI | |CviJI ||TauI ||| TspEI |AhaIII* | |HaeIII ||BsrBI \\\ \ \\ \ \\ \\\ AACAAACTGATAGTACAATTTTTAAAAACCAACTGCAAGGCCATTACCGATGCCGCTCCA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTTGACTATCATGTTAAAAATTTTTGGTTGACGTTCCGGTAATGGCTACGGCGAGGT /// / // / / / //// // ||| | |MseI | | SfaNI |||| |BsaXI ||| | AhaIII* | HaeIII |||| MwoI ||| TspEI | CviJI |||BsrBI ||TatI CviRI* |||AciI |Csp6I ||BisI RsaI |BlsI TauI N K L I V Q F L K T N C K A I T D A A P T N * * Y N F * K P T A R P L P M P L Q Q T D S T I F K N Q L Q G H Y R C R S K ----:----|----:----|----:----|----:----|----:----|----:----| F L S I T C N K F V L Q L A M V S A A G L C V S L V I K L F W S C P W * R H R E V F Q Y Y L K * F G V A L G N G I G S W AcyI MaeII |ZraI MaeIII || SetI MwoI Tsp45I || TaiI |BsaXI | SetI || AatII || MnlI | | MaeII || PshAI || AluI | | | SetI || BbvII* || CviJI | | | TaiI || |TspDTI || |BstXI | | | | MaeIII || || MnlI CviJI || ||SetI | | | | | HphI BsaXI || || MboII HaeIII \\ \\\ \ \ \ \ \ \ \ \\ \\ \ \ AGAGCTTGGGGAGGTGACGTTGGTAACGATGAAACGAAGACGTCTGTCTTTGGTGAGGCC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCGAACCCCTCCACTGCAACCATTGCTACTTTGCTTCTGCAGACAGAAACCACTCCGG //// / / // / / / / /// / / |||CviJI SetI | || | | BsaXI | ||| BbvII* HaeIII |||AluI | || | MaeIII | ||| MboII CviJI ||MnlI | || HphI | ||| MnlI |SetI | |MaeII | ||PshAI BstXI | Tsp45I | |TspDTI | MaeIII | |MaeII TaiI | |AcyI SetI | ZraI AatII TaiI SetI R A W G G D V G N D E T K T S V F G E A E L G E V T L V T M K R R R L S L V R P S L G R * R W * R * N E D V C L W * G R ----:----|----:----|----:----|----:----|----:----|----:----| L A Q P P S T P L S S V F V D T K P S A L L K P L H R Q Y R H F S S T Q R Q H P S S P S T V N T V I F R L R R D K T L G HphI | MaeIII MboII BsrI \ \ \ \ GAAGAAGTTACCAACTGGTAG 1450 1460 ----:----|----:----|- CTTCTTCAATGGTTGACCATC / // / HphI || BsrI |MboII MaeIII E E V T N W * K K L P T G X R S Y Q L V X ----:----|----:----|- S S T V L Q Y R L L * W S T F F N G V P L # Enzymes that cut Frequency Isoschizomers AatII 1 Acc65I 1 Asp718I AciI 3 BspACI,SsiI AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AhaIII* 3 DraI AloI 1 AluI 6 AluBI ApaI 1 ApoI 4 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 8 Bce83I* 2 BpuEI BcgI 2 BciVI 2 BfuI BclI 1 FbaI,Ksp22I BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 5 BsaAI 2 BstBAI,Ppu21I BsaXI 2 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 5 BseRI 4 BseSI 2 BaeGI,BstSLI BsgI 2 BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BsmAI 3 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp120I 1 PspOMI BspCNI 5 BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 1 AccBSI,MbiI BsrDI 2 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstAPI 1 BstKTI 3 BstXI 4 BtgZI 2 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 3 BstC8I CfrI 1 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 6 CviQI,RsaNI CviAII 2 CviJI 20 CviKI-1 CviRI* 5 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 3 MalI DraII 3 EcoO109I Ecl136II 1 EcoICRI Eco57MI 1 EcoRI 2 EcoRII 2 AjnI,Psp6I,PspGI Esp3I 1 BsmBI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 2 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 2 GsuI 1 BpmI HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 3 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4II* 4 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HinfI 4 HpaII 3 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 5 Hpy99I 1 KpnI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 8 HpyCH4IV MaeIII 7 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 8 MfeI 1 MunI MlyI 1 SchI MmeI 1 MnlI 11 MseI 6 Tru1I,Tru9I MslI 1 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 5 HpyF10VI,BstMWI NdeI 2 FauNDI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I PflMI 1 BasI,AccB7I,Van91I PleI 1 PpsI PmeI 1 MssI PpiI 1 PpuMI 1 Psp5II,PspPPI PshAI 1 BstPAI,BoxI PsiI 1 AanI PsrI 1 RsaI 6 AfaI SacI 1 Psp124BI,SstI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 5 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 21 SfaNI 4 LweI SmlI 2 SmoI SpeI 2 BcuI,AhlI TaiI 8 TaqI 6 TatI 2 TauI 1 TfiI 3 PfeI TseI 2 ApeKI Tsp45I 1 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 11 TasI,Tsp509I,Sse9I TspRI 3 TscAI Tth111I 1 PflFI,PsyI,AspI XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI AccI AclI AflII AgeI AjuI AlfI AlwNI ApaLI AscI AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BceAI BdaI BglI BmeT110I BmtI BplI Bpu10I BsaBI BsePI BseYI BsiI* BslFI BsmFI Bsp1407I BspHI BspLU11I* BspMI BspOI BssNAI Bst1107I BstEII BstZ17I CauII* Cfr10I Cfr9I CspCI DinI DraIII DrdI DsaI* Eam1105I EciI Eco31I Eco47III Eco57I EcoNI EcoP15I EcoRV EcoT22I EgeI EheI FaqI FauI FseI FspAI GsaI HaeII Hin4I HindIII HpaI KasI MauBI McrI* MluI Mph1103I MroNI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PfoI PmaCI PspXI PstI PvuI PvuII RsrII SacII SalI SanDI SapI SauI* ScaI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqII TsoI TspGWI TspMI TstI VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769